ID: 900379510 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:2376978-2377000 |
Sequence | GGGTGGGAGGCAGCTGCTCC AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 654 | |||
Summary | {0: 1, 1: 0, 2: 5, 3: 61, 4: 587} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
900379510_900379520 | -2 | Left | 900379510 | 1:2376978-2377000 | CCTGGAGCAGCTGCCTCCCACCC | 0: 1 1: 0 2: 5 3: 61 4: 587 |
||
Right | 900379520 | 1:2376999-2377021 | CCGGGCCTCAGGGAGCACCCAGG | 0: 1 1: 0 2: 2 3: 38 4: 416 |
||||
900379510_900379522 | 9 | Left | 900379510 | 1:2376978-2377000 | CCTGGAGCAGCTGCCTCCCACCC | 0: 1 1: 0 2: 5 3: 61 4: 587 |
||
Right | 900379522 | 1:2377010-2377032 | GGAGCACCCAGGCACAGTCCAGG | 0: 1 1: 0 2: 7 3: 52 4: 330 |
||||
900379510_900379525 | 25 | Left | 900379510 | 1:2376978-2377000 | CCTGGAGCAGCTGCCTCCCACCC | 0: 1 1: 0 2: 5 3: 61 4: 587 |
||
Right | 900379525 | 1:2377026-2377048 | GTCCAGGCCGATGCCCAGCGTGG | 0: 1 1: 0 2: 1 3: 10 4: 124 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
900379510 | Original CRISPR | GGGTGGGAGGCAGCTGCTCC AGG (reversed) | Intronic | ||