ID: 900379515

View in Genome Browser
Species Human (GRCh38)
Location 1:2376991-2377013
Sequence CTCCCTGAGGCCCGGGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 719
Summary {0: 1, 1: 1, 2: 2, 3: 54, 4: 661}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900379515_900379531 27 Left 900379515 1:2376991-2377013 CCTCCCACCCGGGCCTCAGGGAG 0: 1
1: 1
2: 2
3: 54
4: 661
Right 900379531 1:2377041-2377063 CAGCGTGGAGAGTTACGTGCGGG 0: 1
1: 0
2: 0
3: 4
4: 67
900379515_900379525 12 Left 900379515 1:2376991-2377013 CCTCCCACCCGGGCCTCAGGGAG 0: 1
1: 1
2: 2
3: 54
4: 661
Right 900379525 1:2377026-2377048 GTCCAGGCCGATGCCCAGCGTGG 0: 1
1: 0
2: 1
3: 10
4: 124
900379515_900379530 26 Left 900379515 1:2376991-2377013 CCTCCCACCCGGGCCTCAGGGAG 0: 1
1: 1
2: 2
3: 54
4: 661
Right 900379530 1:2377040-2377062 CCAGCGTGGAGAGTTACGTGCGG 0: 1
1: 0
2: 0
3: 2
4: 53
900379515_900379532 28 Left 900379515 1:2376991-2377013 CCTCCCACCCGGGCCTCAGGGAG 0: 1
1: 1
2: 2
3: 54
4: 661
Right 900379532 1:2377042-2377064 AGCGTGGAGAGTTACGTGCGGGG 0: 1
1: 0
2: 0
3: 4
4: 19
900379515_900379522 -4 Left 900379515 1:2376991-2377013 CCTCCCACCCGGGCCTCAGGGAG 0: 1
1: 1
2: 2
3: 54
4: 661
Right 900379522 1:2377010-2377032 GGAGCACCCAGGCACAGTCCAGG 0: 1
1: 0
2: 7
3: 52
4: 330

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900379515 Original CRISPR CTCCCTGAGGCCCGGGTGGG AGG (reversed) Intronic