ID: 900379517

View in Genome Browser
Species Human (GRCh38)
Location 1:2376995-2377017
Sequence GGTGCTCCCTGAGGCCCGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 336
Summary {0: 1, 1: 0, 2: 1, 3: 36, 4: 298}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900379517_900379531 23 Left 900379517 1:2376995-2377017 CCACCCGGGCCTCAGGGAGCACC 0: 1
1: 0
2: 1
3: 36
4: 298
Right 900379531 1:2377041-2377063 CAGCGTGGAGAGTTACGTGCGGG 0: 1
1: 0
2: 0
3: 4
4: 67
900379517_900379525 8 Left 900379517 1:2376995-2377017 CCACCCGGGCCTCAGGGAGCACC 0: 1
1: 0
2: 1
3: 36
4: 298
Right 900379525 1:2377026-2377048 GTCCAGGCCGATGCCCAGCGTGG 0: 1
1: 0
2: 1
3: 10
4: 124
900379517_900379530 22 Left 900379517 1:2376995-2377017 CCACCCGGGCCTCAGGGAGCACC 0: 1
1: 0
2: 1
3: 36
4: 298
Right 900379530 1:2377040-2377062 CCAGCGTGGAGAGTTACGTGCGG 0: 1
1: 0
2: 0
3: 2
4: 53
900379517_900379522 -8 Left 900379517 1:2376995-2377017 CCACCCGGGCCTCAGGGAGCACC 0: 1
1: 0
2: 1
3: 36
4: 298
Right 900379522 1:2377010-2377032 GGAGCACCCAGGCACAGTCCAGG 0: 1
1: 0
2: 7
3: 52
4: 330
900379517_900379532 24 Left 900379517 1:2376995-2377017 CCACCCGGGCCTCAGGGAGCACC 0: 1
1: 0
2: 1
3: 36
4: 298
Right 900379532 1:2377042-2377064 AGCGTGGAGAGTTACGTGCGGGG 0: 1
1: 0
2: 0
3: 4
4: 19

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900379517 Original CRISPR GGTGCTCCCTGAGGCCCGGG TGG (reversed) Intronic