ID: 900379519

View in Genome Browser
Species Human (GRCh38)
Location 1:2376999-2377021
Sequence CCTGGGTGCTCCCTGAGGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 901
Summary {0: 1, 1: 0, 2: 10, 3: 153, 4: 737}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900379519_900379525 4 Left 900379519 1:2376999-2377021 CCGGGCCTCAGGGAGCACCCAGG 0: 1
1: 0
2: 10
3: 153
4: 737
Right 900379525 1:2377026-2377048 GTCCAGGCCGATGCCCAGCGTGG 0: 1
1: 0
2: 1
3: 10
4: 124
900379519_900379532 20 Left 900379519 1:2376999-2377021 CCGGGCCTCAGGGAGCACCCAGG 0: 1
1: 0
2: 10
3: 153
4: 737
Right 900379532 1:2377042-2377064 AGCGTGGAGAGTTACGTGCGGGG 0: 1
1: 0
2: 0
3: 4
4: 19
900379519_900379530 18 Left 900379519 1:2376999-2377021 CCGGGCCTCAGGGAGCACCCAGG 0: 1
1: 0
2: 10
3: 153
4: 737
Right 900379530 1:2377040-2377062 CCAGCGTGGAGAGTTACGTGCGG 0: 1
1: 0
2: 0
3: 2
4: 53
900379519_900379531 19 Left 900379519 1:2376999-2377021 CCGGGCCTCAGGGAGCACCCAGG 0: 1
1: 0
2: 10
3: 153
4: 737
Right 900379531 1:2377041-2377063 CAGCGTGGAGAGTTACGTGCGGG 0: 1
1: 0
2: 0
3: 4
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900379519 Original CRISPR CCTGGGTGCTCCCTGAGGCC CGG (reversed) Intronic