ID: 900379523

View in Genome Browser
Species Human (GRCh38)
Location 1:2377016-2377038
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 167}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900379523_900379534 24 Left 900379523 1:2377016-2377038 CCCAGGCACAGTCCAGGCCGATG 0: 1
1: 0
2: 0
3: 15
4: 167
Right 900379534 1:2377063-2377085 GGCCTCAGCCACACACAGGCTGG 0: 1
1: 0
2: 3
3: 31
4: 352
900379523_900379533 20 Left 900379523 1:2377016-2377038 CCCAGGCACAGTCCAGGCCGATG 0: 1
1: 0
2: 0
3: 15
4: 167
Right 900379533 1:2377059-2377081 GCGGGGCCTCAGCCACACACAGG 0: 1
1: 0
2: 0
3: 17
4: 203
900379523_900379531 2 Left 900379523 1:2377016-2377038 CCCAGGCACAGTCCAGGCCGATG 0: 1
1: 0
2: 0
3: 15
4: 167
Right 900379531 1:2377041-2377063 CAGCGTGGAGAGTTACGTGCGGG 0: 1
1: 0
2: 0
3: 4
4: 67
900379523_900379535 25 Left 900379523 1:2377016-2377038 CCCAGGCACAGTCCAGGCCGATG 0: 1
1: 0
2: 0
3: 15
4: 167
Right 900379535 1:2377064-2377086 GCCTCAGCCACACACAGGCTGGG 0: 1
1: 0
2: 3
3: 68
4: 914
900379523_900379530 1 Left 900379523 1:2377016-2377038 CCCAGGCACAGTCCAGGCCGATG 0: 1
1: 0
2: 0
3: 15
4: 167
Right 900379530 1:2377040-2377062 CCAGCGTGGAGAGTTACGTGCGG 0: 1
1: 0
2: 0
3: 2
4: 53
900379523_900379532 3 Left 900379523 1:2377016-2377038 CCCAGGCACAGTCCAGGCCGATG 0: 1
1: 0
2: 0
3: 15
4: 167
Right 900379532 1:2377042-2377064 AGCGTGGAGAGTTACGTGCGGGG 0: 1
1: 0
2: 0
3: 4
4: 19

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900379523 Original CRISPR CATCGGCCTGGACTGTGCCT GGG (reversed) Intronic