ID: 900379525

View in Genome Browser
Species Human (GRCh38)
Location 1:2377026-2377048
Sequence GTCCAGGCCGATGCCCAGCG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 124}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900379515_900379525 12 Left 900379515 1:2376991-2377013 CCTCCCACCCGGGCCTCAGGGAG 0: 1
1: 1
2: 2
3: 54
4: 661
Right 900379525 1:2377026-2377048 GTCCAGGCCGATGCCCAGCGTGG 0: 1
1: 0
2: 1
3: 10
4: 124
900379521_900379525 -1 Left 900379521 1:2377004-2377026 CCTCAGGGAGCACCCAGGCACAG 0: 1
1: 0
2: 5
3: 50
4: 403
Right 900379525 1:2377026-2377048 GTCCAGGCCGATGCCCAGCGTGG 0: 1
1: 0
2: 1
3: 10
4: 124
900379516_900379525 9 Left 900379516 1:2376994-2377016 CCCACCCGGGCCTCAGGGAGCAC 0: 1
1: 0
2: 0
3: 16
4: 317
Right 900379525 1:2377026-2377048 GTCCAGGCCGATGCCCAGCGTGG 0: 1
1: 0
2: 1
3: 10
4: 124
900379517_900379525 8 Left 900379517 1:2376995-2377017 CCACCCGGGCCTCAGGGAGCACC 0: 1
1: 0
2: 1
3: 36
4: 298
Right 900379525 1:2377026-2377048 GTCCAGGCCGATGCCCAGCGTGG 0: 1
1: 0
2: 1
3: 10
4: 124
900379518_900379525 5 Left 900379518 1:2376998-2377020 CCCGGGCCTCAGGGAGCACCCAG 0: 1
1: 0
2: 8
3: 92
4: 649
Right 900379525 1:2377026-2377048 GTCCAGGCCGATGCCCAGCGTGG 0: 1
1: 0
2: 1
3: 10
4: 124
900379519_900379525 4 Left 900379519 1:2376999-2377021 CCGGGCCTCAGGGAGCACCCAGG 0: 1
1: 0
2: 10
3: 153
4: 737
Right 900379525 1:2377026-2377048 GTCCAGGCCGATGCCCAGCGTGG 0: 1
1: 0
2: 1
3: 10
4: 124
900379510_900379525 25 Left 900379510 1:2376978-2377000 CCTGGAGCAGCTGCCTCCCACCC 0: 1
1: 0
2: 5
3: 61
4: 587
Right 900379525 1:2377026-2377048 GTCCAGGCCGATGCCCAGCGTGG 0: 1
1: 0
2: 1
3: 10
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900379525 Original CRISPR GTCCAGGCCGATGCCCAGCG TGG Intronic