ID: 900379526

View in Genome Browser
Species Human (GRCh38)
Location 1:2377028-2377050
Sequence CTCCACGCTGGGCATCGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 148}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900379526_900379534 12 Left 900379526 1:2377028-2377050 CCAGGCCGATGCCCAGCGTGGAG 0: 1
1: 0
2: 1
3: 11
4: 148
Right 900379534 1:2377063-2377085 GGCCTCAGCCACACACAGGCTGG 0: 1
1: 0
2: 3
3: 31
4: 352
900379526_900379538 20 Left 900379526 1:2377028-2377050 CCAGGCCGATGCCCAGCGTGGAG 0: 1
1: 0
2: 1
3: 11
4: 148
Right 900379538 1:2377071-2377093 CCACACACAGGCTGGGACCGAGG 0: 1
1: 0
2: 2
3: 28
4: 239
900379526_900379540 26 Left 900379526 1:2377028-2377050 CCAGGCCGATGCCCAGCGTGGAG 0: 1
1: 0
2: 1
3: 11
4: 148
Right 900379540 1:2377077-2377099 ACAGGCTGGGACCGAGGAATGGG 0: 1
1: 0
2: 0
3: 10
4: 180
900379526_900379539 25 Left 900379526 1:2377028-2377050 CCAGGCCGATGCCCAGCGTGGAG 0: 1
1: 0
2: 1
3: 11
4: 148
Right 900379539 1:2377076-2377098 CACAGGCTGGGACCGAGGAATGG 0: 1
1: 0
2: 3
3: 20
4: 283
900379526_900379531 -10 Left 900379526 1:2377028-2377050 CCAGGCCGATGCCCAGCGTGGAG 0: 1
1: 0
2: 1
3: 11
4: 148
Right 900379531 1:2377041-2377063 CAGCGTGGAGAGTTACGTGCGGG 0: 1
1: 0
2: 0
3: 4
4: 67
900379526_900379532 -9 Left 900379526 1:2377028-2377050 CCAGGCCGATGCCCAGCGTGGAG 0: 1
1: 0
2: 1
3: 11
4: 148
Right 900379532 1:2377042-2377064 AGCGTGGAGAGTTACGTGCGGGG 0: 1
1: 0
2: 0
3: 4
4: 19
900379526_900379535 13 Left 900379526 1:2377028-2377050 CCAGGCCGATGCCCAGCGTGGAG 0: 1
1: 0
2: 1
3: 11
4: 148
Right 900379535 1:2377064-2377086 GCCTCAGCCACACACAGGCTGGG 0: 1
1: 0
2: 3
3: 68
4: 914
900379526_900379533 8 Left 900379526 1:2377028-2377050 CCAGGCCGATGCCCAGCGTGGAG 0: 1
1: 0
2: 1
3: 11
4: 148
Right 900379533 1:2377059-2377081 GCGGGGCCTCAGCCACACACAGG 0: 1
1: 0
2: 0
3: 17
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900379526 Original CRISPR CTCCACGCTGGGCATCGGCC TGG (reversed) Intronic