ID: 900379529

View in Genome Browser
Species Human (GRCh38)
Location 1:2377040-2377062
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 12
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 11}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900379529_900379535 1 Left 900379529 1:2377040-2377062 CCAGCGTGGAGAGTTACGTGCGG 0: 1
1: 0
2: 0
3: 0
4: 11
Right 900379535 1:2377064-2377086 GCCTCAGCCACACACAGGCTGGG 0: 1
1: 0
2: 3
3: 68
4: 914
900379529_900379540 14 Left 900379529 1:2377040-2377062 CCAGCGTGGAGAGTTACGTGCGG 0: 1
1: 0
2: 0
3: 0
4: 11
Right 900379540 1:2377077-2377099 ACAGGCTGGGACCGAGGAATGGG 0: 1
1: 0
2: 0
3: 10
4: 180
900379529_900379539 13 Left 900379529 1:2377040-2377062 CCAGCGTGGAGAGTTACGTGCGG 0: 1
1: 0
2: 0
3: 0
4: 11
Right 900379539 1:2377076-2377098 CACAGGCTGGGACCGAGGAATGG 0: 1
1: 0
2: 3
3: 20
4: 283
900379529_900379534 0 Left 900379529 1:2377040-2377062 CCAGCGTGGAGAGTTACGTGCGG 0: 1
1: 0
2: 0
3: 0
4: 11
Right 900379534 1:2377063-2377085 GGCCTCAGCCACACACAGGCTGG 0: 1
1: 0
2: 3
3: 31
4: 352
900379529_900379538 8 Left 900379529 1:2377040-2377062 CCAGCGTGGAGAGTTACGTGCGG 0: 1
1: 0
2: 0
3: 0
4: 11
Right 900379538 1:2377071-2377093 CCACACACAGGCTGGGACCGAGG 0: 1
1: 0
2: 2
3: 28
4: 239
900379529_900379533 -4 Left 900379529 1:2377040-2377062 CCAGCGTGGAGAGTTACGTGCGG 0: 1
1: 0
2: 0
3: 0
4: 11
Right 900379533 1:2377059-2377081 GCGGGGCCTCAGCCACACACAGG 0: 1
1: 0
2: 0
3: 17
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900379529 Original CRISPR CCGCACGTAACTCTCCACGC TGG (reversed) Intronic