ID: 900379530

View in Genome Browser
Species Human (GRCh38)
Location 1:2377040-2377062
Sequence CCAGCGTGGAGAGTTACGTG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 56
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 53}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900379521_900379530 13 Left 900379521 1:2377004-2377026 CCTCAGGGAGCACCCAGGCACAG 0: 1
1: 0
2: 5
3: 50
4: 403
Right 900379530 1:2377040-2377062 CCAGCGTGGAGAGTTACGTGCGG 0: 1
1: 0
2: 0
3: 2
4: 53
900379524_900379530 0 Left 900379524 1:2377017-2377039 CCAGGCACAGTCCAGGCCGATGC 0: 1
1: 0
2: 0
3: 13
4: 146
Right 900379530 1:2377040-2377062 CCAGCGTGGAGAGTTACGTGCGG 0: 1
1: 0
2: 0
3: 2
4: 53
900379523_900379530 1 Left 900379523 1:2377016-2377038 CCCAGGCACAGTCCAGGCCGATG 0: 1
1: 0
2: 0
3: 15
4: 167
Right 900379530 1:2377040-2377062 CCAGCGTGGAGAGTTACGTGCGG 0: 1
1: 0
2: 0
3: 2
4: 53
900379518_900379530 19 Left 900379518 1:2376998-2377020 CCCGGGCCTCAGGGAGCACCCAG 0: 1
1: 0
2: 8
3: 92
4: 649
Right 900379530 1:2377040-2377062 CCAGCGTGGAGAGTTACGTGCGG 0: 1
1: 0
2: 0
3: 2
4: 53
900379517_900379530 22 Left 900379517 1:2376995-2377017 CCACCCGGGCCTCAGGGAGCACC 0: 1
1: 0
2: 1
3: 36
4: 298
Right 900379530 1:2377040-2377062 CCAGCGTGGAGAGTTACGTGCGG 0: 1
1: 0
2: 0
3: 2
4: 53
900379519_900379530 18 Left 900379519 1:2376999-2377021 CCGGGCCTCAGGGAGCACCCAGG 0: 1
1: 0
2: 10
3: 153
4: 737
Right 900379530 1:2377040-2377062 CCAGCGTGGAGAGTTACGTGCGG 0: 1
1: 0
2: 0
3: 2
4: 53
900379516_900379530 23 Left 900379516 1:2376994-2377016 CCCACCCGGGCCTCAGGGAGCAC 0: 1
1: 0
2: 0
3: 16
4: 317
Right 900379530 1:2377040-2377062 CCAGCGTGGAGAGTTACGTGCGG 0: 1
1: 0
2: 0
3: 2
4: 53
900379515_900379530 26 Left 900379515 1:2376991-2377013 CCTCCCACCCGGGCCTCAGGGAG 0: 1
1: 1
2: 2
3: 54
4: 661
Right 900379530 1:2377040-2377062 CCAGCGTGGAGAGTTACGTGCGG 0: 1
1: 0
2: 0
3: 2
4: 53

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900379530 Original CRISPR CCAGCGTGGAGAGTTACGTG CGG Intronic