ID: 900379534

View in Genome Browser
Species Human (GRCh38)
Location 1:2377063-2377085
Sequence GGCCTCAGCCACACACAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 387
Summary {0: 1, 1: 0, 2: 3, 3: 31, 4: 352}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900379527_900379534 7 Left 900379527 1:2377033-2377055 CCGATGCCCAGCGTGGAGAGTTA 0: 1
1: 0
2: 0
3: 6
4: 60
Right 900379534 1:2377063-2377085 GGCCTCAGCCACACACAGGCTGG 0: 1
1: 0
2: 3
3: 31
4: 352
900379523_900379534 24 Left 900379523 1:2377016-2377038 CCCAGGCACAGTCCAGGCCGATG 0: 1
1: 0
2: 0
3: 15
4: 167
Right 900379534 1:2377063-2377085 GGCCTCAGCCACACACAGGCTGG 0: 1
1: 0
2: 3
3: 31
4: 352
900379526_900379534 12 Left 900379526 1:2377028-2377050 CCAGGCCGATGCCCAGCGTGGAG 0: 1
1: 0
2: 1
3: 11
4: 148
Right 900379534 1:2377063-2377085 GGCCTCAGCCACACACAGGCTGG 0: 1
1: 0
2: 3
3: 31
4: 352
900379528_900379534 1 Left 900379528 1:2377039-2377061 CCCAGCGTGGAGAGTTACGTGCG 0: 1
1: 0
2: 0
3: 1
4: 7
Right 900379534 1:2377063-2377085 GGCCTCAGCCACACACAGGCTGG 0: 1
1: 0
2: 3
3: 31
4: 352
900379529_900379534 0 Left 900379529 1:2377040-2377062 CCAGCGTGGAGAGTTACGTGCGG 0: 1
1: 0
2: 0
3: 0
4: 11
Right 900379534 1:2377063-2377085 GGCCTCAGCCACACACAGGCTGG 0: 1
1: 0
2: 3
3: 31
4: 352
900379524_900379534 23 Left 900379524 1:2377017-2377039 CCAGGCACAGTCCAGGCCGATGC 0: 1
1: 0
2: 0
3: 13
4: 146
Right 900379534 1:2377063-2377085 GGCCTCAGCCACACACAGGCTGG 0: 1
1: 0
2: 3
3: 31
4: 352

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900379534 Original CRISPR GGCCTCAGCCACACACAGGC TGG Intronic