ID: 900379535

View in Genome Browser
Species Human (GRCh38)
Location 1:2377064-2377086
Sequence GCCTCAGCCACACACAGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 986
Summary {0: 1, 1: 0, 2: 3, 3: 68, 4: 914}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900379526_900379535 13 Left 900379526 1:2377028-2377050 CCAGGCCGATGCCCAGCGTGGAG 0: 1
1: 0
2: 1
3: 11
4: 148
Right 900379535 1:2377064-2377086 GCCTCAGCCACACACAGGCTGGG 0: 1
1: 0
2: 3
3: 68
4: 914
900379523_900379535 25 Left 900379523 1:2377016-2377038 CCCAGGCACAGTCCAGGCCGATG 0: 1
1: 0
2: 0
3: 15
4: 167
Right 900379535 1:2377064-2377086 GCCTCAGCCACACACAGGCTGGG 0: 1
1: 0
2: 3
3: 68
4: 914
900379529_900379535 1 Left 900379529 1:2377040-2377062 CCAGCGTGGAGAGTTACGTGCGG 0: 1
1: 0
2: 0
3: 0
4: 11
Right 900379535 1:2377064-2377086 GCCTCAGCCACACACAGGCTGGG 0: 1
1: 0
2: 3
3: 68
4: 914
900379528_900379535 2 Left 900379528 1:2377039-2377061 CCCAGCGTGGAGAGTTACGTGCG 0: 1
1: 0
2: 0
3: 1
4: 7
Right 900379535 1:2377064-2377086 GCCTCAGCCACACACAGGCTGGG 0: 1
1: 0
2: 3
3: 68
4: 914
900379524_900379535 24 Left 900379524 1:2377017-2377039 CCAGGCACAGTCCAGGCCGATGC 0: 1
1: 0
2: 0
3: 13
4: 146
Right 900379535 1:2377064-2377086 GCCTCAGCCACACACAGGCTGGG 0: 1
1: 0
2: 3
3: 68
4: 914
900379527_900379535 8 Left 900379527 1:2377033-2377055 CCGATGCCCAGCGTGGAGAGTTA 0: 1
1: 0
2: 0
3: 6
4: 60
Right 900379535 1:2377064-2377086 GCCTCAGCCACACACAGGCTGGG 0: 1
1: 0
2: 3
3: 68
4: 914

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900379535 Original CRISPR GCCTCAGCCACACACAGGCT GGG Intronic