ID: 900379538

View in Genome Browser
Species Human (GRCh38)
Location 1:2377071-2377093
Sequence CCACACACAGGCTGGGACCG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 270
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 239}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900379527_900379538 15 Left 900379527 1:2377033-2377055 CCGATGCCCAGCGTGGAGAGTTA 0: 1
1: 0
2: 0
3: 6
4: 60
Right 900379538 1:2377071-2377093 CCACACACAGGCTGGGACCGAGG 0: 1
1: 0
2: 2
3: 28
4: 239
900379528_900379538 9 Left 900379528 1:2377039-2377061 CCCAGCGTGGAGAGTTACGTGCG 0: 1
1: 0
2: 0
3: 1
4: 7
Right 900379538 1:2377071-2377093 CCACACACAGGCTGGGACCGAGG 0: 1
1: 0
2: 2
3: 28
4: 239
900379526_900379538 20 Left 900379526 1:2377028-2377050 CCAGGCCGATGCCCAGCGTGGAG 0: 1
1: 0
2: 1
3: 11
4: 148
Right 900379538 1:2377071-2377093 CCACACACAGGCTGGGACCGAGG 0: 1
1: 0
2: 2
3: 28
4: 239
900379529_900379538 8 Left 900379529 1:2377040-2377062 CCAGCGTGGAGAGTTACGTGCGG 0: 1
1: 0
2: 0
3: 0
4: 11
Right 900379538 1:2377071-2377093 CCACACACAGGCTGGGACCGAGG 0: 1
1: 0
2: 2
3: 28
4: 239

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900379538 Original CRISPR CCACACACAGGCTGGGACCG AGG Intronic