ID: 900379539

View in Genome Browser
Species Human (GRCh38)
Location 1:2377076-2377098
Sequence CACAGGCTGGGACCGAGGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 307
Summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 283}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900379527_900379539 20 Left 900379527 1:2377033-2377055 CCGATGCCCAGCGTGGAGAGTTA 0: 1
1: 0
2: 0
3: 6
4: 60
Right 900379539 1:2377076-2377098 CACAGGCTGGGACCGAGGAATGG 0: 1
1: 0
2: 3
3: 20
4: 283
900379529_900379539 13 Left 900379529 1:2377040-2377062 CCAGCGTGGAGAGTTACGTGCGG 0: 1
1: 0
2: 0
3: 0
4: 11
Right 900379539 1:2377076-2377098 CACAGGCTGGGACCGAGGAATGG 0: 1
1: 0
2: 3
3: 20
4: 283
900379526_900379539 25 Left 900379526 1:2377028-2377050 CCAGGCCGATGCCCAGCGTGGAG 0: 1
1: 0
2: 1
3: 11
4: 148
Right 900379539 1:2377076-2377098 CACAGGCTGGGACCGAGGAATGG 0: 1
1: 0
2: 3
3: 20
4: 283
900379528_900379539 14 Left 900379528 1:2377039-2377061 CCCAGCGTGGAGAGTTACGTGCG 0: 1
1: 0
2: 0
3: 1
4: 7
Right 900379539 1:2377076-2377098 CACAGGCTGGGACCGAGGAATGG 0: 1
1: 0
2: 3
3: 20
4: 283

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900379539 Original CRISPR CACAGGCTGGGACCGAGGAA TGG Intronic