ID: 900379540

View in Genome Browser
Species Human (GRCh38)
Location 1:2377077-2377099
Sequence ACAGGCTGGGACCGAGGAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 180}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900379529_900379540 14 Left 900379529 1:2377040-2377062 CCAGCGTGGAGAGTTACGTGCGG 0: 1
1: 0
2: 0
3: 0
4: 11
Right 900379540 1:2377077-2377099 ACAGGCTGGGACCGAGGAATGGG 0: 1
1: 0
2: 0
3: 10
4: 180
900379527_900379540 21 Left 900379527 1:2377033-2377055 CCGATGCCCAGCGTGGAGAGTTA 0: 1
1: 0
2: 0
3: 6
4: 60
Right 900379540 1:2377077-2377099 ACAGGCTGGGACCGAGGAATGGG 0: 1
1: 0
2: 0
3: 10
4: 180
900379526_900379540 26 Left 900379526 1:2377028-2377050 CCAGGCCGATGCCCAGCGTGGAG 0: 1
1: 0
2: 1
3: 11
4: 148
Right 900379540 1:2377077-2377099 ACAGGCTGGGACCGAGGAATGGG 0: 1
1: 0
2: 0
3: 10
4: 180
900379528_900379540 15 Left 900379528 1:2377039-2377061 CCCAGCGTGGAGAGTTACGTGCG 0: 1
1: 0
2: 0
3: 1
4: 7
Right 900379540 1:2377077-2377099 ACAGGCTGGGACCGAGGAATGGG 0: 1
1: 0
2: 0
3: 10
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900379540 Original CRISPR ACAGGCTGGGACCGAGGAAT GGG Intronic