ID: 900380101

View in Genome Browser
Species Human (GRCh38)
Location 1:2379642-2379664
Sequence TGGCCACGGCTGACAGTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 144}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900380092_900380101 17 Left 900380092 1:2379602-2379624 CCAAGAAGCGTCAAAGAGGGGGA 0: 1
1: 0
2: 0
3: 8
4: 74
Right 900380101 1:2379642-2379664 TGGCCACGGCTGACAGTGGGTGG 0: 1
1: 0
2: 0
3: 13
4: 144
900380097_900380101 -8 Left 900380097 1:2379627-2379649 CCGGGTGCGCAGTGGTGGCCACG 0: 1
1: 0
2: 1
3: 11
4: 118
Right 900380101 1:2379642-2379664 TGGCCACGGCTGACAGTGGGTGG 0: 1
1: 0
2: 0
3: 13
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900380101 Original CRISPR TGGCCACGGCTGACAGTGGG TGG Intronic
900380101 1:2379642-2379664 TGGCCACGGCTGACAGTGGGTGG + Intronic
900847195 1:5113406-5113428 TGGTGTGGGCTGACAGTGGGTGG + Intergenic
903660298 1:24973022-24973044 AGGCCGAGGCTGACAGTTGGAGG + Intergenic
903788378 1:25875874-25875896 TGGGCCCGGCTGACCCTGGGAGG + Intergenic
906943428 1:50275653-50275675 TGGCCACAGCAGCCAGAGGGCGG - Intergenic
907495327 1:54840154-54840176 TTGCCAGGGTTGGCAGTGGGAGG - Intronic
907973377 1:59407075-59407097 TGCCCAAGGCAGACAGAGGGAGG - Intronic
910047815 1:82938946-82938968 AGGCCACGTCTGACAGTGAAAGG - Intergenic
911887989 1:103327679-103327701 TGGCCAGGGATAACAATGGGTGG + Intergenic
915334021 1:155130197-155130219 TGGCCACGGCTGGGAGGGCGAGG - Intronic
915479714 1:156176451-156176473 AGGCCAAGGCTGACAGGTGGGGG - Exonic
917585864 1:176425903-176425925 TGGACACAGCTCCCAGTGGGAGG - Intergenic
920683064 1:208087764-208087786 TGGTAAGGGCTGAAAGTGGGTGG + Intronic
922881994 1:228988011-228988033 TGGCCACGCATGACTGTTGGAGG + Intergenic
923367084 1:233273342-233273364 TGGCCACAGCTCAAAGTGGGAGG + Intronic
924926765 1:248691656-248691678 TGGCCAAGGCTCCCAGAGGGCGG + Intergenic
924937838 1:248787382-248787404 TGGCCAGGGATGGCAGTTGGTGG - Intergenic
1065328676 10:24571676-24571698 TGCCCATGGGTGACACTGGGGGG + Intergenic
1070449590 10:76544412-76544434 CAGACACTGCTGACAGTGGGTGG - Intronic
1077412273 11:2409221-2409243 TGGCCAGGGCGGACAGAGGAGGG - Intronic
1083201172 11:61121911-61121933 TGGCCACAGCCCACAGTGGGTGG + Intronic
1083234925 11:61345286-61345308 TGGGCAGGGCTGGCAGGGGGTGG - Exonic
1083651711 11:64208131-64208153 GGGCCTGGGCTGCCAGTGGGTGG + Intronic
1084332882 11:68439965-68439987 TGGCCAGCACTGACGGTGGGAGG - Intronic
1084537123 11:69763854-69763876 AGGCCTCTGCTCACAGTGGGAGG - Intergenic
1085266248 11:75239883-75239905 GGGCCAGGGCTGAGGGTGGGGGG - Intergenic
1086448502 11:86892416-86892438 TGGCCATGGCTGAGAGTTGATGG + Intronic
1087168934 11:95031006-95031028 TGGCCACGTCTGTCAGTTGAGGG - Intergenic
1090449483 11:126793544-126793566 TGGCCACGGCAGATGCTGGGTGG + Intronic
1092563552 12:9641702-9641724 GGGCCACGGTGGACAGTAGGAGG - Intergenic
1096085835 12:48864631-48864653 TGGGGAGGGCTGACAGTTGGTGG - Intronic
1096774270 12:53954811-53954833 TGGGCACGGCCGCCAGGGGGAGG - Intergenic
1097431075 12:59507821-59507843 TGACCATGGGTGAGAGTGGGAGG + Intergenic
1099666626 12:85638923-85638945 TAGCCAAGAGTGACAGTGGGAGG + Intergenic
1102565899 12:113797324-113797346 GGGCCAGGGCTGACACTGGCGGG + Intergenic
1102915393 12:116748648-116748670 TGGTCACAGCTGACATTGGGTGG - Intronic
1103816997 12:123666338-123666360 TGTCCAATGCTGAAAGTGGGAGG + Intergenic
1104018381 12:124975459-124975481 TGGCCACGGCGGCCACTCGGCGG + Exonic
1104984568 12:132589425-132589447 TGTCATCGGCTGACACTGGGGGG + Intergenic
1108506381 13:51116241-51116263 GGGGCACGTCTGACAATGGGAGG + Intergenic
1112607483 13:100921363-100921385 AGTCCCCGGCTAACAGTGGGCGG + Intergenic
1114492636 14:23113024-23113046 TGGCCAGGGGTGACAGTGCTAGG + Intergenic
1117201136 14:53391327-53391349 TGGCATCAGCTGTCAGTGGGCGG - Intergenic
1119545978 14:75471718-75471740 CTGCCACAGCTGACAGTGAGAGG - Intronic
1122393582 14:101407292-101407314 TGGCCAGGGCAGTCAGTGAGGGG - Intergenic
1123019212 14:105389774-105389796 AGGCCAGGGCTGGCAGTGGTTGG + Intronic
1124434039 15:29633191-29633213 TGGAGAAGGCTGACAGTTGGTGG - Intergenic
1126082189 15:44974557-44974579 TAACCACGGCTGACATTGAGAGG + Intronic
1128520150 15:68369783-68369805 TGGACAAGGCAGCCAGTGGGCGG + Intronic
1132393800 15:101457741-101457763 TGGCCAGGGCTGCCTGTGTGTGG - Intronic
1132769121 16:1551272-1551294 TGACCACGGCTGGCAGGGGTGGG + Intronic
1136459395 16:30400314-30400336 TGGCGACGGCTGTCGGCGGGAGG + Intergenic
1138490400 16:57372991-57373013 AGGCCCTGGCTGACAGTGGCTGG + Intronic
1142174637 16:88639496-88639518 TGGCCACCTAGGACAGTGGGAGG - Intronic
1143377393 17:6474753-6474775 TGGCCAGTGCTGACTGTAGGTGG - Intronic
1143784270 17:9245068-9245090 TGACAACGCCTGACAGTGGGTGG + Intergenic
1144494471 17:15737626-15737648 GGGCCACGGCTGTCACTGGGAGG + Intronic
1144905795 17:18639050-18639072 GGGCCACGGCTGTCACTGGGAGG - Intronic
1146321473 17:31850133-31850155 TGGCCAAGGCTGTCGGAGGGAGG - Intergenic
1148074842 17:44929243-44929265 TGGCCACGGGTAATGGTGGGAGG + Intronic
1148162030 17:45455722-45455744 AGGCCAGAGATGACAGTGGGTGG - Intronic
1148198723 17:45733631-45733653 TGGCCGGGGCTGAAATTGGGAGG + Intergenic
1148485914 17:47990969-47990991 GGGACACTGCTGAGAGTGGGAGG + Intergenic
1148503200 17:48107502-48107524 TGGCTTCCCCTGACAGTGGGCGG + Intronic
1148725768 17:49788915-49788937 TGGCCACGCCTCACAGTGCTTGG + Intronic
1148860283 17:50601014-50601036 AGGCAACGGCTGAGAGGGGGAGG - Intronic
1150393262 17:64802371-64802393 AGGCCAGAGATGACAGTGGGTGG - Intergenic
1151175400 17:72284103-72284125 TGGCCACGCCTGAGAGTGATTGG + Intergenic
1152519765 17:80848577-80848599 TGGCCACGGGTGACCGGGGGTGG + Intronic
1154297654 18:13164534-13164556 AGGCCAGAGCTGACAGTGAGAGG + Intergenic
1157332904 18:46716462-46716484 TGGCCCAGGCTGCCTGTGGGTGG - Intronic
1158686225 18:59616975-59616997 TGGCAAAGGCTGAGAGTCGGTGG - Intronic
1158742523 18:60159711-60159733 TGGCGACGGGGGACAGCGGGTGG + Intergenic
1160718754 19:588631-588653 TGTGCCCGGCTGACAGTGGATGG - Intergenic
1164527530 19:29022892-29022914 TGGACAGGGCTGGCAGTGGCGGG - Intergenic
925350562 2:3198246-3198268 TGGCCACCTCTGAAATTGGGAGG - Intronic
925749878 2:7078472-7078494 AGGCCAGGGCTGAGAGTAGGTGG + Intergenic
925787865 2:7450443-7450465 TGTCCACGGCTGACACACGGTGG + Intergenic
926080114 2:9978280-9978302 TGGACACAGCTGAGAGTGTGAGG + Intronic
927474038 2:23398593-23398615 TGACCACGGCTGACAGTATGGGG - Intronic
931749916 2:65321245-65321267 TGGCCCCAGCTGACACTGGGAGG + Intronic
935853025 2:107243665-107243687 TGGCCAATGCTGATAGTGTGGGG + Intergenic
943676129 2:190717950-190717972 TGGCCAGGGCTGGCAGCTGGTGG - Intergenic
946362894 2:219229631-219229653 TGGCTGCGGGTGACAGTGAGTGG - Intronic
948894598 2:240922314-240922336 TGCCCACGGCTGGCAGAGGAGGG - Intronic
948946672 2:241224020-241224042 TGGCCACGAGGCACAGTGGGCGG - Intronic
1168960699 20:1867513-1867535 TGGGCAAGGCTTTCAGTGGGAGG + Intergenic
1171152364 20:22838291-22838313 TGGGCAGGACTGACAGTGGAAGG + Intergenic
1175267984 20:57714114-57714136 TGGCCACAGCTGAGGGTGGCTGG + Intergenic
1175326822 20:58135403-58135425 TGGCCAGGGAAGGCAGTGGGAGG + Intergenic
1175960852 20:62635612-62635634 TGGCCATGGCTGTCGGTGTGAGG + Intergenic
1178315421 21:31562737-31562759 TGCTCACAGCTGACTGTGGGAGG + Intergenic
1179518425 21:41925900-41925922 TGACCATGGCTGATTGTGGGAGG - Intronic
1180011362 21:45053674-45053696 TGGCCAGGGCAGACTGTGGAAGG - Intergenic
1181533515 22:23530386-23530408 TGGGCCCTGCTCACAGTGGGAGG + Intergenic
1181698601 22:24607678-24607700 CAGCCCCGGCGGACAGTGGGAGG - Intronic
1182521886 22:30889448-30889470 TGGCCTCTGCTGACGGTGAGGGG + Intronic
1182826930 22:33273695-33273717 GGGCCACTGCTGATAGAGGGTGG + Exonic
1183394553 22:37563833-37563855 TGGCCCCTTCTGAGAGTGGGAGG - Intronic
958959208 3:100492763-100492785 TGGCCACGTCTCGCATTGGGTGG - Exonic
963928900 3:150981357-150981379 TGGCAAGGGCTGAAAGTTGGGGG + Intergenic
967404615 3:189101463-189101485 GGTCCATGGTTGACAGTGGGGGG - Intronic
967738130 3:192975477-192975499 TGTCCAACGCTGAAAGTGGGAGG - Intergenic
969229806 4:5822050-5822072 TGGTCAGGGCTGAAGGTGGGGGG - Intronic
969987412 4:11226180-11226202 AGGCCAAGGCTGAGAGTTGGAGG - Intergenic
972270523 4:37506856-37506878 TGTCCAATGCTGAAAGTGGGTGG + Intronic
977238305 4:94535544-94535566 TGGCTACAGGTGAAAGTGGGAGG - Intronic
979302980 4:119108602-119108624 TGGCCACTGTAGACAATGGGTGG - Intergenic
982260240 4:153488389-153488411 GGGCCAGGGCTGCCTGTGGGAGG + Intronic
984188521 4:176576461-176576483 TGGCCATTGCTGACAGTTGTTGG - Intergenic
984878500 4:184390267-184390289 TGGGCACGGGTCACAGCGGGAGG + Intronic
985711810 5:1433609-1433631 TGGCCATGGATGACTGTGGATGG - Intronic
988211851 5:28214279-28214301 TGGCCACCGCTGGAAGTGTGTGG - Intergenic
990376698 5:55177564-55177586 TGGCAACGGCACACAGAGGGAGG - Intergenic
993646920 5:90474049-90474071 TGGCCACGGCAAGCAGTGGCCGG + Exonic
1001146449 5:169188677-169188699 TGGCCACGGCTGACCTTGGCTGG - Intronic
1001571151 5:172731604-172731626 TGGCCCTGGCTGACAGGAGGTGG - Intergenic
1002434250 5:179221448-179221470 GTGCCACGACTGAAAGTGGGGGG - Intronic
1002806738 6:583818-583840 TGTGTACGGCTGCCAGTGGGCGG - Intronic
1004295227 6:14404019-14404041 TGTCCACGGCTGACATCAGGAGG - Intergenic
1006920433 6:37624315-37624337 TGGCCAAGGCTGACAGAAGAGGG + Intergenic
1007477584 6:42129218-42129240 TGGCCACTGCGGACAGCAGGTGG - Intronic
1008113565 6:47520497-47520519 TGGCCTCCGCTGACAGCAGGGGG + Intronic
1009770862 6:68141415-68141437 TGTCCAGTGCTGAAAGTGGGAGG + Intergenic
1011856033 6:91692691-91692713 TGGTCACAGCAGACAGAGGGTGG + Intergenic
1013417962 6:109941195-109941217 GGGCCAGGGCTGACAGAAGGGGG + Intergenic
1016684967 6:146870853-146870875 TGACCACTGATGACAGTTGGAGG - Intergenic
1018098700 6:160417136-160417158 TGGCCAAGCCTGACACTGGGTGG - Intronic
1018798801 6:167207206-167207228 TGGCCACCTCTGACCATGGGAGG - Intergenic
1025010661 7:55394967-55394989 TGGCCCCCGCTGACAGTGTAGGG + Intronic
1027469853 7:78559870-78559892 TGCCCAGGTGTGACAGTGGGTGG - Intronic
1027702457 7:81485602-81485624 AGGCCAGGGCTGATAGTAGGAGG + Intergenic
1034298779 7:149996904-149996926 TGGCCCCGGGTGGCAGTGGTGGG - Intergenic
1034807238 7:154099877-154099899 TGGCCCCGGGTGGCAGTGGTGGG + Intronic
1035180821 7:157088408-157088430 TGGCCACGGTTGACTCTGGCTGG + Intergenic
1035233491 7:157481034-157481056 TGGCCAGTGCTGACTCTGGGAGG + Intergenic
1035288255 7:157819754-157819776 TGCCCATGGCTGGCAGTGGGTGG - Intronic
1035443222 7:158921315-158921337 AGACCACGGTGGACAGTGGGAGG + Intronic
1035638226 8:1163125-1163147 TGGCCACGGAGGACAGGAGGAGG - Intergenic
1041611120 8:59850978-59851000 TGGCCACCACTTACACTGGGAGG + Intergenic
1042262171 8:66870873-66870895 AGGTCACCGCTGTCAGTGGGAGG + Intronic
1042818125 8:72900417-72900439 TTGCCAAGGCTGACATTGAGAGG - Intronic
1044224197 8:89701101-89701123 CAGCCACTGGTGACAGTGGGGGG + Intergenic
1050284759 9:4089950-4089972 TGGGCATGGCACACAGTGGGAGG - Intronic
1057820254 9:98324673-98324695 TGGCCACTGCTGGCGGTGTGTGG + Intronic
1060994172 9:127866912-127866934 TGGAAACGGCTCACAGAGGGTGG + Exonic
1061246961 9:129405457-129405479 TGGGCCCTGCTCACAGTGGGAGG - Intergenic
1062181972 9:135195737-135195759 GGACCACTGCAGACAGTGGGTGG + Intergenic
1062286046 9:135772963-135772985 TGGAGACGGCTCCCAGTGGGGGG + Intronic
1203774945 EBV:67742-67764 TGGCCACGGCGGCCAGCCGGGGG - Intergenic
1185821485 X:3209047-3209069 GGGCAACAGCTGACAGAGGGTGG - Intergenic
1186594405 X:10965199-10965221 TGGCCCCTGCCGACAGTGGTGGG - Intergenic
1189597514 X:42585002-42585024 TGGCCACCACTGACAATGTGGGG - Intergenic
1190621059 X:52287591-52287613 TGGGCACTGATGAGAGTGGGAGG + Intergenic
1191846296 X:65550339-65550361 TGGCCCAGCCTGGCAGTGGGGGG + Intergenic
1198583681 X:138096170-138096192 AGGCCAGGGCTGCCAGTGGGTGG - Intergenic
1200079512 X:153569038-153569060 AAGCCACGGCTGCCAGTCGGTGG + Intronic
1200829460 Y:7676987-7677009 TGGACACGTTTGGCAGTGGGGGG - Intergenic