ID: 900382285

View in Genome Browser
Species Human (GRCh38)
Location 1:2391054-2391076
Sequence GTTTCTGGACAGCACCGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 95}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900382280_900382285 28 Left 900382280 1:2391003-2391025 CCCAAAGTGCTGGAAGTACAGGC 0: 31
1: 9187
2: 236331
3: 276019
4: 184706
Right 900382285 1:2391054-2391076 GTTTCTGGACAGCACCGGCCAGG 0: 1
1: 0
2: 1
3: 5
4: 95
900382281_900382285 27 Left 900382281 1:2391004-2391026 CCAAAGTGCTGGAAGTACAGGCA 0: 16
1: 4736
2: 103594
3: 240794
4: 248281
Right 900382285 1:2391054-2391076 GTTTCTGGACAGCACCGGCCAGG 0: 1
1: 0
2: 1
3: 5
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900382285 Original CRISPR GTTTCTGGACAGCACCGGCC AGG Intronic
900183667 1:1323262-1323284 GTTCCAGGACAGCACAGGGCAGG + Exonic
900215272 1:1478359-1478381 GTTTCTGGGCAGCTCCAGGCAGG - Intronic
900215317 1:1478556-1478578 GTGTCTGCACAGCTCCGGCACGG - Intronic
900310326 1:2030318-2030340 GTTTCTGGGCAGCTGCCGCCGGG - Exonic
900382285 1:2391054-2391076 GTTTCTGGACAGCACCGGCCAGG + Intronic
903811583 1:26037703-26037725 GTCTGTGGAAAGCACTGGCCTGG - Intronic
907404810 1:54247380-54247402 TTTTCTGGGCAGCAGGGGCCTGG + Intronic
912625582 1:111203025-111203047 TTCTCTGGAGAGCACTGGCCTGG - Intronic
915661866 1:157411461-157411483 TTTTCTGGACAGAACTAGCCAGG - Intergenic
918599330 1:186336172-186336194 GTTTCTAGACAGCACGGTCTGGG + Intronic
920171471 1:204074684-204074706 GTTGCCGGACAGTACCGGGCGGG + Intronic
922470740 1:225875667-225875689 GTGTCTGCACTGCACAGGCCAGG - Intronic
923457311 1:234175728-234175750 GTTTCTAGACAGCAAAGACCAGG + Intronic
923510632 1:234649228-234649250 GTTTCTGCACAGTACCAACCTGG - Intergenic
924414931 1:243849698-243849720 GTGTCTGGGCTGCCCCGGCCCGG - Intronic
1065019656 10:21494182-21494204 GTTTCTTCCCAGCACCGGGCAGG - Exonic
1067993415 10:51241779-51241801 GTTTAAGGACAGCACAGGACAGG - Intronic
1068526923 10:58140924-58140946 GTTTCTGAACAGCACCAGGAAGG + Intergenic
1075708701 10:124518712-124518734 CTTTCTGGCCAGCCCAGGCCAGG + Intronic
1077176405 11:1193161-1193183 GTGTCTGGAAAGCACGTGCCTGG - Intronic
1077467878 11:2742233-2742255 GATTCTGGCCAGCACCACCCAGG - Intronic
1077474397 11:2779525-2779547 CTTTCTGGACAGCACAGGCTGGG + Intronic
1078915113 11:15771535-15771557 ATTCCTGGACAGCACTGTCCTGG - Intergenic
1085503158 11:77040493-77040515 GTGTCTGGAGCGCGCCGGCCTGG + Exonic
1089329957 11:117682271-117682293 GTTTCTGGACAGGGCTGGACAGG - Intronic
1090955840 11:131512403-131512425 GTTTGAGGACAGCCCCTGCCTGG - Intronic
1092546468 12:9456244-9456266 GTTTTTGGAAAGCAGAGGCCGGG - Intergenic
1094506473 12:31065830-31065852 GTTTTTGGAAAGCAGAGGCCGGG + Intergenic
1095978224 12:47954293-47954315 GTGGCTGGCCAGCACCGCCCTGG - Intergenic
1105766837 13:23568238-23568260 GTTTCTGAACAGCACCAGGAAGG - Intergenic
1106346744 13:28886702-28886724 GTTTCTGGAGAGCACATTCCTGG - Intronic
1106428591 13:29657874-29657896 GTCTCTGGCCAGCACCAGCCTGG - Intergenic
1106788432 13:33130021-33130043 TTGTCTGTACAGCACTGGCCCGG + Exonic
1107064850 13:36202027-36202049 GTTTCTGTACAGTATCAGCCAGG + Exonic
1108648655 13:52454593-52454615 GAGTCTGGACTGCACCTGCCTGG - Intergenic
1118137399 14:63045190-63045212 GGGTCTGGAGAGCAGCGGCCAGG + Exonic
1121095910 14:91217901-91217923 GTTTCTCTCCAGCACCTGCCTGG + Intronic
1123984230 15:25630834-25630856 GACTCTGGACAGCACCTCCCAGG - Intergenic
1126746352 15:51829843-51829865 CTTCCTGGAAAGCACCGGGCTGG - Intronic
1126778809 15:52120753-52120775 GTGTCTGGCCAGCTCCTGCCAGG - Exonic
1129610184 15:77047365-77047387 CATTCTGGACAGCAAAGGCCTGG + Intronic
1132054943 15:98643768-98643790 GTTCCTGGAAAGCCCAGGCCTGG - Intergenic
1132314532 15:100880136-100880158 GTTTCTGGAGAGCCGCGCCCGGG - Intronic
1135498103 16:22970278-22970300 ATTTCAGGACACCAGCGGCCTGG + Intergenic
1142383436 16:89747047-89747069 GTTTCAGGACAGCACAGCCAGGG - Intronic
1142563238 17:823670-823692 GTCTCTGGAGAGCAGCAGCCTGG - Exonic
1143849809 17:9802414-9802436 GTTTCTGGACACCTCCCACCAGG - Exonic
1148550842 17:48550201-48550223 CTTCCTGGTCAGAACCGGCCTGG - Exonic
1150712900 17:67546757-67546779 GTTTCTGGCCAGTCCCTGCCGGG + Intronic
1157863322 18:51160749-51160771 TTTCCTGCACAGCACAGGCCAGG + Intergenic
1159224441 18:65514118-65514140 GTCTCTGTACTGCACCAGCCTGG - Intergenic
1160387630 18:78506074-78506096 GTTTCTTGGCAGCCCTGGCCGGG + Intergenic
1160401085 18:78612021-78612043 GGTTCTGGGGAGCACAGGCCGGG - Intergenic
1160499016 18:79393390-79393412 GCTTCGGGGCAGCTCCGGCCCGG + Intergenic
1160622522 18:80180888-80180910 GTATCTAGACAGCAGAGGCCGGG + Intronic
1160903857 19:1442923-1442945 GTCTCTGGGCAGCACTGGCCAGG + Intergenic
1163052378 19:14694087-14694109 CTTTCTGGAAAGCACAGGCATGG + Intronic
1164595327 19:29528029-29528051 GTGTCTGGACAGCACCCAGCGGG - Intronic
1165495773 19:36151375-36151397 GTTTCTGGGCAGGACTGACCAGG - Intronic
1166268565 19:41700095-41700117 GATCCTGGACAGCACCAGGCAGG + Intronic
931259489 2:60604902-60604924 GTTTATGGACAGCACCTGGAGGG + Intergenic
931564529 2:63601630-63601652 CTGTCTGGACAGCAAAGGCCAGG - Intronic
937569212 2:123334995-123335017 GGTTCTGGCCAGCACAGGTCTGG - Intergenic
939247172 2:139640523-139640545 GGTTCTGGACAGCACCTGCTTGG - Intergenic
947937572 2:234021295-234021317 GCTCATGGACAGCAGCGGCCTGG + Intergenic
948583006 2:239000654-239000676 GTTTCTGCGCAGCACAGGGCGGG + Intergenic
1172645529 20:36466808-36466830 GTCTCTGTACATCACTGGCCTGG + Intronic
1175783499 20:61698104-61698126 GTTGCTGGACAGCACAGACCTGG + Intronic
1175844205 20:62050181-62050203 GGTTCTGCACAGCAGCGACCAGG + Intronic
1176242690 20:64082443-64082465 GTTTCTCCCCAGCCCCGGCCAGG - Intronic
1176387349 21:6145223-6145245 GTGTCTAGACAGCACGGCCCAGG - Intergenic
1179457454 21:41508722-41508744 GTCTCTCGGCACCACCGGCCAGG + Intronic
1179736123 21:43393025-43393047 GTGTCTAGACAGCACGGCCCAGG + Intergenic
1181636189 22:24175941-24175963 GTTTCTTGGCAGCACCAACCTGG + Intronic
1182285585 22:29245141-29245163 GATTCAGGACAGCAGGGGCCAGG - Intronic
1183358705 22:37372458-37372480 GTTCCGGGACAGCACTGGGCTGG + Exonic
1184274480 22:43402386-43402408 GTTTCTGCACTGCCCCTGCCTGG + Intergenic
950433410 3:12964878-12964900 GTTTCTGGACAGTATTGGACAGG - Intronic
954753026 3:52824256-52824278 GTTGCTGGACAGCAGCAACCAGG - Exonic
959043053 3:101441190-101441212 GCTTCTGGACAGCATGGGCATGG - Intronic
961671826 3:128538037-128538059 GTTTCTGCTCAGCCCCAGCCTGG + Intergenic
968114897 3:196081949-196081971 GCTGCTGGACAGCACCGGAGCGG + Intronic
969604267 4:8194574-8194596 GTTTCTGGCCTGCTCCGGGCTGG - Intronic
971969996 4:33607502-33607524 GGTGCTGGACAGCACAGGTCTGG - Intergenic
983380770 4:166990119-166990141 GTTTCTGGAAAGTGCCTGCCAGG - Intronic
987188673 5:15451093-15451115 GTTGAGGGACAGCACTGGCCTGG - Intergenic
1002534494 5:179868817-179868839 GTGTCTGGACAGGACAGGGCAGG + Intronic
1002925317 6:1602348-1602370 ACTTCTGGACAGCCCCGGCATGG + Intergenic
1018384551 6:163291003-163291025 CTTTCTGGAAGGCACTGGCCTGG + Intronic
1021521548 7:21543521-21543543 GTTTCTGGAAAGCACCAGCCCGG + Exonic
1023994121 7:45148458-45148480 GTTTCTGCACAGGTCCAGCCCGG + Intergenic
1025850417 7:65239451-65239473 GTCTGTGGACACCACGGGCCAGG + Intergenic
1030797285 7:113804220-113804242 GTTTATCCACAGCACCAGCCAGG - Intergenic
1038668552 8:29562782-29562804 ATTTCTGCAGAGCACCAGCCTGG + Intergenic
1052834277 9:33238769-33238791 GTTTGAGGACAGCCCCAGCCAGG - Intronic
1061900905 9:133671503-133671525 GGGTCTGGACAGCACGGGGCGGG - Intronic
1061996806 9:134190212-134190234 GTTCCTGTACAGCGCCGGTCTGG - Intergenic
1062589242 9:137266048-137266070 GGGTGTGGACAGCAGCGGCCAGG + Intronic
1062730328 9:138104873-138104895 GTCTCTGGGCAGCACTGGCTGGG + Intronic
1185623326 X:1466531-1466553 GGTCCCGAACAGCACCGGCCCGG - Exonic
1188671937 X:32891136-32891158 TCTTTTGGACAGCACTGGCCTGG + Intronic
1189467584 X:41289021-41289043 CTTGCTGGAGAGCACAGGCCAGG - Intergenic