ID: 900385000

View in Genome Browser
Species Human (GRCh38)
Location 1:2406507-2406529
Sequence TGCACTCCCAGCAGAACAGG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 707
Summary {0: 1, 1: 0, 2: 0, 3: 29, 4: 677}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900384994_900385000 9 Left 900384994 1:2406475-2406497 CCACCTCACCTTGCTGCTGCACC 0: 1
1: 1
2: 3
3: 60
4: 415
Right 900385000 1:2406507-2406529 TGCACTCCCAGCAGAACAGGTGG 0: 1
1: 0
2: 0
3: 29
4: 677
900384997_900385000 1 Left 900384997 1:2406483-2406505 CCTTGCTGCTGCACCACGCGGTG 0: 1
1: 0
2: 0
3: 6
4: 78
Right 900385000 1:2406507-2406529 TGCACTCCCAGCAGAACAGGTGG 0: 1
1: 0
2: 0
3: 29
4: 677
900384992_900385000 28 Left 900384992 1:2406456-2406478 CCAGGACGGCAGCAGGCTCCCAC 0: 1
1: 0
2: 0
3: 18
4: 181
Right 900385000 1:2406507-2406529 TGCACTCCCAGCAGAACAGGTGG 0: 1
1: 0
2: 0
3: 29
4: 677
900384993_900385000 10 Left 900384993 1:2406474-2406496 CCCACCTCACCTTGCTGCTGCAC 0: 1
1: 0
2: 4
3: 34
4: 354
Right 900385000 1:2406507-2406529 TGCACTCCCAGCAGAACAGGTGG 0: 1
1: 0
2: 0
3: 29
4: 677
900384995_900385000 6 Left 900384995 1:2406478-2406500 CCTCACCTTGCTGCTGCACCACG 0: 1
1: 0
2: 1
3: 15
4: 177
Right 900385000 1:2406507-2406529 TGCACTCCCAGCAGAACAGGTGG 0: 1
1: 0
2: 0
3: 29
4: 677
900384991_900385000 29 Left 900384991 1:2406455-2406477 CCCAGGACGGCAGCAGGCTCCCA 0: 1
1: 0
2: 0
3: 21
4: 180
Right 900385000 1:2406507-2406529 TGCACTCCCAGCAGAACAGGTGG 0: 1
1: 0
2: 0
3: 29
4: 677
900384990_900385000 30 Left 900384990 1:2406454-2406476 CCCCAGGACGGCAGCAGGCTCCC 0: 1
1: 0
2: 0
3: 13
4: 226
Right 900385000 1:2406507-2406529 TGCACTCCCAGCAGAACAGGTGG 0: 1
1: 0
2: 0
3: 29
4: 677

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900385000 Original CRISPR TGCACTCCCAGCAGAACAGG TGG Exonic
900385000 1:2406507-2406529 TGCACTCCCAGCAGAACAGGTGG + Exonic
901379875 1:8865940-8865962 TGCCCTGCCAGCAGGACAGACGG + Intronic
901540797 1:9914162-9914184 TGTAATCCCAGCAGTTCAGGAGG - Intergenic
901582042 1:10252531-10252553 TGCACTCCCAGCTACTCAGGGGG - Intronic
901687523 1:10951306-10951328 TGTAATCCCAGCAGTACGGGAGG + Intronic
901789592 1:11647351-11647373 TGCAATCCCACCAGAACAGCAGG + Intergenic
901847514 1:11992923-11992945 TGCAGTCCCAGCTGCTCAGGAGG - Intronic
901884075 1:12210496-12210518 TGTAATCCCAGCAGTTCAGGAGG - Intergenic
902041031 1:13492578-13492600 TGCAATCCCAGCTGCTCAGGAGG + Intronic
903252312 1:22064412-22064434 TGTACTCCCAGCTACACAGGAGG - Intronic
903612379 1:24625143-24625165 TGCAATCCCAGCAGTTTAGGAGG - Intergenic
904151559 1:28445770-28445792 TGCAGTCCCAGCTGTTCAGGAGG + Intronic
904157998 1:28500933-28500955 TGTACTCCCAGCTACACAGGAGG - Intergenic
904324666 1:29720510-29720532 TGCCCTCCCTGCAGGACAGAAGG - Intergenic
904690004 1:32286756-32286778 TGTAGTCCCAGCAGATCAGGAGG + Intergenic
905025927 1:34849424-34849446 AGCACTCACATTAGAACAGGAGG + Intronic
905328091 1:37172230-37172252 AGCACTCCCAGCAGCACACATGG + Intergenic
905676053 1:39825940-39825962 TGCTCATCCTGCAGAACAGGTGG + Intergenic
906218636 1:44059964-44059986 ACCACTCCCATTAGAACAGGGGG + Intergenic
906225897 1:44120860-44120882 TGTAGTCCCAGCAGCCCAGGAGG + Intronic
906516983 1:46445389-46445411 TGTAATCCCAGCAGTTCAGGAGG + Intergenic
906690264 1:47787937-47787959 AGAATTCCCAGCAGAACAGAGGG + Intronic
907457309 1:54583944-54583966 TACTCTCCAAGCAGAAGAGGTGG - Intronic
907477258 1:54714059-54714081 TCCACACCCAGCAGAACATCTGG - Intronic
908204831 1:61835658-61835680 TGCAATCCCAGCACATTAGGAGG - Intronic
908540114 1:65114191-65114213 TGCAGTCCCAGCTACACAGGAGG + Intergenic
908787951 1:67753872-67753894 TGCCTGCCCAGCAGGACAGGTGG + Intronic
909457909 1:75870549-75870571 TTCACTACCAGGAGAACATGGGG - Intronic
909791224 1:79680440-79680462 TGTAATCCCAGCTGCACAGGAGG + Intergenic
910364061 1:86445152-86445174 TGCAATCCCAGCACTTCAGGAGG - Intronic
910661874 1:89682053-89682075 TGCAGTCCCAGCTGCTCAGGAGG + Intronic
911178250 1:94839035-94839057 TGCACACCTAGGAGAAGAGGTGG + Intronic
911491786 1:98578490-98578512 TGCAGTCCCAGCTGCTCAGGAGG - Intergenic
911599768 1:99835378-99835400 TGTAATCCCAGCAACACAGGAGG + Intergenic
911745660 1:101439270-101439292 TGCCCTCCCAGCAGCCCAGGTGG + Intergenic
912036247 1:105319259-105319281 TGCACTCCCAGCTACTCAGGAGG + Intergenic
912050058 1:105518396-105518418 TGCAGTCCCAGCTGCTCAGGAGG - Intergenic
912365235 1:109127993-109128015 TGTAATCCCAGCTGCACAGGAGG - Intronic
912551809 1:110489769-110489791 ACCACTCCCAGAGGAACAGGAGG - Intergenic
912626746 1:111211595-111211617 TGCAGTCCCAGCAACTCAGGAGG - Intronic
914003527 1:143712674-143712696 TGTAATCCCAGCAAATCAGGAGG - Intergenic
914225362 1:145715425-145715447 TGCAATCCCAGCTGCTCAGGAGG + Intergenic
915398990 1:155608943-155608965 TGTACTCCCAGCTGCTCAGGAGG - Intergenic
915548184 1:156615432-156615454 TGTACTCCCAGCTAATCAGGAGG + Intergenic
915915238 1:159936863-159936885 TGCACTTCCAACACAGCAGGAGG + Exonic
916064474 1:161124837-161124859 TGTAGTCCCAGCTGCACAGGAGG + Intronic
916730135 1:167558731-167558753 TGTAATCCCAGCAGTTCAGGAGG - Intergenic
916759927 1:167806745-167806767 TGCAATCCCAGCACCTCAGGAGG + Intergenic
917101464 1:171450162-171450184 TGCAGTCCCAGCTGCTCAGGAGG + Intergenic
917918869 1:179732757-179732779 TGTAGTCCCAGCTGCACAGGAGG + Intergenic
919109299 1:193197802-193197824 TGCACTCCCAGCTACTCAGGAGG + Intronic
919517517 1:198545332-198545354 TGCAATCCCAGCACCCCAGGAGG - Intergenic
920106431 1:203556556-203556578 GGCACTCCCAGGAGAGCAGCTGG + Intergenic
920623851 1:207576992-207577014 TGTACTCCCAGCACATTAGGAGG + Intronic
921542688 1:216435670-216435692 TGTAATCCCAGCACTACAGGAGG - Intergenic
921818247 1:219588072-219588094 TGCTCTCCCAGGAAAACAGATGG - Intergenic
921901652 1:220457461-220457483 TGTAATCCCAGCAGCTCAGGAGG + Intergenic
921911862 1:220558006-220558028 TGTACTCCCAGCTGCTCAGGGGG + Intronic
922043332 1:221918593-221918615 TGCAATCCCAGCAAATCAGGAGG + Intergenic
922430017 1:225542136-225542158 TGTAATCCCAGCAGTTCAGGAGG - Intronic
922874255 1:228927450-228927472 TAAATTCCCAGCAGACCAGGAGG - Intergenic
923040099 1:230313679-230313701 TGCAATCCCAGCAGTTTAGGAGG - Intergenic
923349663 1:233091609-233091631 TGCAGTCCCAGCCACACAGGAGG + Intronic
923942573 1:238844359-238844381 TGCAGTCTCAGCAGACCAGCAGG - Intergenic
923983172 1:239349753-239349775 TGTAATCCCAGCAGTACAGGAGG + Intergenic
924144981 1:241064464-241064486 TGCAGTCCCAGCTACACAGGAGG + Intronic
924358470 1:243209812-243209834 TGTACTCCCAGCAACTCAGGAGG - Intronic
924782588 1:247165919-247165941 TGTAATCCCAGCAGTTCAGGAGG + Intronic
924824031 1:247521636-247521658 TGCAATCCCAGCACCTCAGGAGG - Intronic
924834673 1:247636515-247636537 TCCCCTCCCTGCAGATCAGGGGG + Intergenic
1063364774 10:5483215-5483237 TGTAATCCCAGCTGCACAGGAGG + Intergenic
1064084448 10:12334735-12334757 TGCAGTCCCAGCTGCACAGGAGG - Intergenic
1064218433 10:13419302-13419324 TGTACTCCCAGCTGCTCAGGAGG + Intergenic
1064321871 10:14312742-14312764 TGCAGTCCCAGCTAATCAGGAGG + Intronic
1064422036 10:15198777-15198799 TGCAGTCCCAGCAACTCAGGAGG - Intergenic
1064692459 10:17931920-17931942 TGGAGACCCAGGAGAACAGGTGG - Intergenic
1064824532 10:19381569-19381591 TGTAATCCCAGCACAACGGGAGG + Intronic
1064934522 10:20664904-20664926 TGCAGTCCCAGCTGCTCAGGAGG + Intergenic
1064968981 10:21044273-21044295 TGTAATCCCAGCAGCTCAGGAGG + Intronic
1065030601 10:21582237-21582259 TGCAGTCCCAGCTAAGCAGGAGG - Intronic
1065636167 10:27737065-27737087 TGCACTCCCAGAAGGACTAGCGG + Intronic
1065711484 10:28522286-28522308 TGCAATCCCAGCCGATCAAGGGG + Intergenic
1066092045 10:32032420-32032442 TTCTCACCCAGCAGAGCAGGGGG - Intronic
1067844610 10:49709856-49709878 TTCTCTCCCAGCAGAACGGTGGG + Exonic
1067874657 10:49993696-49993718 TGTACTCCCAGCTAATCAGGAGG + Intronic
1068692428 10:59930807-59930829 TGCAATCCCAGCTACACAGGAGG - Intergenic
1068735968 10:60413873-60413895 TGCAGTCCCAGCAACTCAGGAGG + Intronic
1068912699 10:62395611-62395633 TGCAATCCCAGCACTAAAGGAGG - Intronic
1069497808 10:68922669-68922691 TGTACTCCCAGCTGCTCAGGAGG + Intronic
1069733313 10:70633740-70633762 TGCAGTCCCAGCTGCTCAGGAGG - Intergenic
1070091270 10:73288017-73288039 TGTAGTCCCAGCAGCTCAGGAGG - Intronic
1070907245 10:80083961-80083983 TGCAGTCCCAGCTGCTCAGGAGG + Intronic
1072112962 10:92341144-92341166 TGCAATCCCAGCACTTCAGGAGG + Intronic
1072194839 10:93108489-93108511 TGTACTCCCAGCTGCTCAGGAGG - Intergenic
1072225781 10:93367604-93367626 TGGCTTCCAAGCAGAACAGGAGG - Intronic
1072235558 10:93450450-93450472 TGCAATCCCAGCTGTTCAGGAGG + Intronic
1072330159 10:94340723-94340745 TGCAATCCCAGCACTTCAGGAGG + Intronic
1072968462 10:99995303-99995325 TGTAATCCCAGCAGTTCAGGAGG - Intronic
1073725573 10:106226572-106226594 TGGCCTCCCAGCAAAACAGTTGG + Intergenic
1075243283 10:120798198-120798220 TGCAATCCCAGCACCTCAGGAGG - Intergenic
1076327000 10:129631991-129632013 TGCAATCCCAGCACTTCAGGAGG - Intronic
1076428363 10:130383430-130383452 CCCACTCCCAGCAGGACATGAGG - Intergenic
1076474789 10:130744321-130744343 TGCCCTCCCTGCAGATGAGGAGG + Intergenic
1076533134 10:131158926-131158948 GGCACTGCCAGCTGAACTGGTGG - Intronic
1076543038 10:131226331-131226353 TGGACTCCCAGCACTTCAGGAGG - Intronic
1076633555 10:131867938-131867960 TGCAATCCCAGCTGCTCAGGTGG + Intergenic
1076702074 10:132278637-132278659 TGTACTCCCAGCTGCTCAGGAGG + Intronic
1076866277 10:133167897-133167919 TCCACTCACAGCAGGGCAGGCGG - Intronic
1077006295 11:359062-359084 TGTACTCCCAGCTGCTCAGGAGG + Intergenic
1077076446 11:704529-704551 TGCACTCGCAGAAGACCAGCTGG + Intronic
1077306540 11:1871184-1871206 TGCACAGCACGCAGAACAGGAGG + Intronic
1077318860 11:1931944-1931966 TGCACACCCAGCCGGAGAGGGGG + Intronic
1077397172 11:2330604-2330626 AGCACTCCCAGCAAAGCAGGTGG + Intergenic
1078122296 11:8523048-8523070 TGCAATCCCGGCAGCTCAGGAGG - Intronic
1078247602 11:9590143-9590165 TGCAGTCCCAGCTACACAGGAGG - Intronic
1078258344 11:9680670-9680692 TGCAATCCCAGCACTTCAGGAGG - Intronic
1079245239 11:18747270-18747292 TGTAGTCCCAGCAACACAGGGGG - Intronic
1079416464 11:20241993-20242015 TGGACTCCCAGAAGGAAAGGAGG - Intergenic
1080008701 11:27436031-27436053 TGTACTCCCAGCAACTCAGGAGG - Intronic
1080477815 11:32612613-32612635 TGTACTCCCAGCTGCTCAGGAGG + Intronic
1081139198 11:39476521-39476543 TGCAGTCCCAGCTGCTCAGGAGG - Intergenic
1081788281 11:45764112-45764134 TGCAATCCCAGCACTTCAGGAGG + Intergenic
1081987078 11:47313434-47313456 TGTACTCCCAGCTGCTCAGGAGG - Intronic
1083098993 11:60283321-60283343 TGTAATCCCAGCAGTATAGGAGG - Intronic
1083239053 11:61372421-61372443 TGCAATCCCAGCAACTCAGGAGG - Intergenic
1083252942 11:61480096-61480118 TGCAATCCCAGCAACTCAGGAGG + Intronic
1083284503 11:61649561-61649583 TGCAATCCCAGCTAATCAGGGGG - Intergenic
1084737096 11:71112575-71112597 TGCACTCCCTGCAGAGCATGGGG - Intronic
1084764612 11:71300024-71300046 TGCAATCCCAGCAGTTCGGGAGG + Intergenic
1084764775 11:71301254-71301276 TGCAATCCCAGCAGTTCGGGAGG - Intergenic
1084976278 11:72800798-72800820 TGCAATCCCAGCACTTCAGGAGG - Intergenic
1084989411 11:72909291-72909313 TGCAATCCCAGCACCTCAGGAGG - Intronic
1085113419 11:73908908-73908930 TGTAATCCCAGCTAAACAGGAGG - Intronic
1085168405 11:74425593-74425615 TGTACTCCCAGCTGCTCAGGAGG - Intergenic
1085332245 11:75663233-75663255 TGTAATCCCAGCACATCAGGAGG - Intronic
1085609401 11:77933480-77933502 TGCAATCCCAGCACCTCAGGAGG - Intronic
1085678467 11:78548091-78548113 TGCAGTCCCAGCTACACAGGAGG + Intronic
1087819651 11:102697621-102697643 TGTAGTCCCAGCTGCACAGGAGG - Intronic
1088055600 11:105572590-105572612 TGCAATCCCAGCTAATCAGGAGG - Intergenic
1088605611 11:111528059-111528081 TGCAATCCCAGCACTTCAGGAGG + Intronic
1088871064 11:113890982-113891004 TGTAGTCCCAGCAACACAGGAGG - Intergenic
1089010698 11:115129444-115129466 TGTACTCCCAACACAAGAGGTGG + Intergenic
1089195289 11:116690841-116690863 TTCACTACCACGAGAACAGGAGG + Intergenic
1089537035 11:119167302-119167324 TGCAGTCCCAGCTACACAGGAGG - Intronic
1089607996 11:119652789-119652811 TCCACTCCCAGCAGAAATGAGGG + Intronic
1089669880 11:120047473-120047495 TGTACTCCCAGCTGCTCAGGAGG - Intergenic
1090569431 11:128030638-128030660 TGCACTCCCAGGTGAATGGGTGG + Intergenic
1091404141 12:198440-198462 TGCAGTCCCAGCTGCTCAGGAGG + Intronic
1091569199 12:1669816-1669838 TGTAGTCCCAGCTGATCAGGAGG - Intergenic
1092498638 12:9023810-9023832 TGTAATCCCAGCAGCCCAGGAGG - Intergenic
1092610804 12:10170611-10170633 TGCAATCCCAGCTGCTCAGGAGG - Exonic
1092795124 12:12103264-12103286 TGCAATCCCAGCTGCTCAGGAGG + Intronic
1093346857 12:18048182-18048204 TACACTCCCAGCAGAATATGAGG + Intergenic
1093603374 12:21058599-21058621 TGCAATCCCAGCACTTCAGGAGG - Intronic
1093657672 12:21715474-21715496 CTCACTACCAGCAGAGCAGGAGG - Intronic
1093871359 12:24295685-24295707 TGTAATCCCAGCTGATCAGGAGG - Intergenic
1094187818 12:27663716-27663738 TGTACTCCCAGCAACTCAGGAGG + Intronic
1094209295 12:27873588-27873610 TGCAATCCCAGCACCTCAGGAGG - Intergenic
1094341664 12:29418974-29418996 TGTAGTCCCAGCAAATCAGGAGG - Intronic
1095638617 12:44460446-44460468 AGCACTCCCAGATGAACAGTAGG - Intergenic
1097084663 12:56458485-56458507 TGTAGTCCCAGCAAATCAGGAGG + Intronic
1097228728 12:57495740-57495762 TGCAATCCCAGCACCTCAGGAGG + Intronic
1097254681 12:57664727-57664749 TGCAATCCCAGCACCTCAGGAGG - Intergenic
1097951474 12:65433906-65433928 AGTACTCCCTGCAGATCAGGTGG - Intronic
1099994860 12:89767604-89767626 TGGACACCCAGGAGAACAGATGG + Intergenic
1101012607 12:100466730-100466752 TGTAATCCCAGCAGTTCAGGAGG + Intergenic
1101408296 12:104448103-104448125 TGCAATCCCAGCACTTCAGGAGG - Intergenic
1102046784 12:109834396-109834418 TGTACTCCCAGCTGCTCAGGAGG - Intergenic
1102131320 12:110531312-110531334 TGCAATCCCAGCTGCACGGGAGG - Intronic
1102323175 12:111956769-111956791 TGCAATCCCAGCACTTCAGGAGG - Intronic
1102599201 12:114016231-114016253 TGCCTGCCCAGGAGAACAGGAGG + Intergenic
1102849214 12:116223580-116223602 TGTAGTCCCAGCAGCTCAGGAGG + Intronic
1103359662 12:120346265-120346287 TCGACTCCCAGCCGCACAGGGGG - Exonic
1103504723 12:121434372-121434394 TGTACTCCCAGCTACACAGGAGG + Intronic
1103595899 12:122024024-122024046 TGCCCTCCCTGCAGAGCAGCTGG - Intronic
1103786199 12:123435056-123435078 TGCAATCCCAGCTGCTCAGGAGG + Intronic
1103788934 12:123455403-123455425 TGTACTCCCAGCATCTCAGGAGG - Intergenic
1104098073 12:125579045-125579067 TGCAGTCCCAGAAGAAAAGGAGG - Intronic
1104528802 12:129549426-129549448 TTCACTACCATGAGAACAGGAGG - Intronic
1104700948 12:130904251-130904273 TGTAATCCCAGCAGTTCAGGAGG - Intergenic
1104714115 12:131005332-131005354 GGCACTCCCAGCAGATCATGCGG - Intronic
1104869988 12:131988126-131988148 TGCAATCCCAGCACTCCAGGAGG - Intronic
1105400095 13:20084132-20084154 TGCAGTCCCAGCAACTCAGGAGG - Intronic
1105787267 13:23761866-23761888 TGTAATCCCAGCACATCAGGAGG + Intronic
1106262962 13:28084474-28084496 TGTACTCCCAGCTACACAGGAGG - Intronic
1107014642 13:35698182-35698204 TGCACTCCCAGCTACTCAGGAGG + Intergenic
1107149153 13:37091673-37091695 TGCAATCCCAGCTGCTCAGGGGG - Intergenic
1108251517 13:48572632-48572654 TGTACTCCCAGCACTTCAGGGGG + Intergenic
1109082462 13:57922611-57922633 TGTACTCCCAGCTGCTCAGGAGG + Intergenic
1109198138 13:59401782-59401804 TGCAATCCCAGCACTTCAGGAGG - Intergenic
1109516636 13:63451405-63451427 TGCAGTCCCAGCTGCTCAGGAGG + Intergenic
1109524965 13:63564139-63564161 TGTAGTCCCAGCAACACAGGAGG - Intergenic
1110527942 13:76561260-76561282 TGCAATCCCAGCTGCTCAGGAGG - Intergenic
1111354568 13:87080712-87080734 TGCACACTCCGCAGAGCAGGTGG - Intergenic
1111583229 13:90251844-90251866 TGCAATCCCAGCTGCTCAGGAGG - Intergenic
1111758938 13:92437058-92437080 TGCAATCCCAGAACAGCAGGTGG + Intronic
1112014383 13:95319210-95319232 TGCACACCCAGCAGTTCAGGGGG + Intergenic
1113038889 13:106082932-106082954 TGCAATCCCAGCACTTCAGGAGG + Intergenic
1113462060 13:110489112-110489134 TGTAATCCCAGCTGCACAGGAGG + Intronic
1114787824 14:25621289-25621311 TGCAATCCCAGCTGCTCAGGAGG + Intergenic
1115754542 14:36518804-36518826 TGGACCCCCAGCCGAGCAGGGGG + Intronic
1115838763 14:37441979-37442001 TGCAATCCCAGCATATTAGGTGG - Intronic
1117476881 14:56104516-56104538 TGCAATCCCAGCAGTTCAGGAGG + Intergenic
1117595603 14:57324271-57324293 TGCAGTCCCAGCTACACAGGAGG - Intergenic
1118111232 14:62722155-62722177 TACATTCCCAGCAGAACATGAGG - Intronic
1118252257 14:64172809-64172831 TGTACTCCCAGCTGCTCAGGAGG + Intronic
1118298887 14:64596251-64596273 TGCAGTCCCAGCTGCTCAGGAGG - Intergenic
1118502095 14:66371377-66371399 TGCAGTCCCAGCTAATCAGGAGG + Intergenic
1118802302 14:69201802-69201824 TGCACTCCCAGCTACTCAGGAGG - Intronic
1119240512 14:73055823-73055845 TGTAATCCCAGCAGCTCAGGAGG - Intergenic
1119283428 14:73430510-73430532 TGCAGTCCCAGCCACACAGGAGG + Intronic
1121806763 14:96833801-96833823 TGCAGTCACAACAGAAAAGGAGG + Intronic
1122660268 14:103290436-103290458 TGCAGTCCCAGCATGACATGAGG - Intergenic
1122735317 14:103835995-103836017 TGCAATCCCAGCACTTCAGGAGG - Intronic
1124391353 15:29261254-29261276 TGTAATCCCAGCTGATCAGGAGG + Intronic
1125430650 15:39589891-39589913 TGCACTCGCAGCGGTACATGGGG - Exonic
1125727791 15:41876937-41876959 TGCACTCCCAGGAGGACGTGAGG - Exonic
1125962338 15:43841987-43842009 TGTAATCCCAGCAGCTCAGGAGG - Intronic
1126032846 15:44516959-44516981 TGCAATCCCAGCTTATCAGGAGG - Intronic
1126083676 15:44989744-44989766 TGCACTCCCAGCTACTCAGGAGG + Intergenic
1126237726 15:46405690-46405712 TGCAGTCCCAGCTGTTCAGGAGG - Intergenic
1128106801 15:65051343-65051365 GGCACTCCCAGTCTAACAGGTGG - Intronic
1128217589 15:65945150-65945172 TGCAATCCCAGCAGTTTAGGAGG - Intronic
1128290365 15:66473936-66473958 TGTAATCCCAGCACATCAGGAGG - Intronic
1128960685 15:72001296-72001318 TGTACTCCCAGCACATTAGGAGG + Intronic
1129037267 15:72658217-72658239 TGTAATCCCAGCAGTTCAGGAGG - Intronic
1129212620 15:74079008-74079030 TGTAATCCCAGCAGTTCAGGAGG + Intronic
1129397779 15:75262071-75262093 TGTAATCCCAGCAGTTCAGGAGG - Intronic
1129401390 15:75286352-75286374 TGTAATCCCAGCAGTTCAGGAGG - Intronic
1129916436 15:79277380-79277402 TGCAGTCCCAGCTGCTCAGGAGG + Intergenic
1130069723 15:80636246-80636268 TGCACACTCAGCAGGACTGGGGG + Intergenic
1130216815 15:81979431-81979453 TTCACTACCAGGAGAACAGCAGG - Intergenic
1131169258 15:90165295-90165317 TGTAGTCCCAGCAACACAGGAGG + Intronic
1131219179 15:90566965-90566987 TGCAATCCCAGCACTTCAGGAGG - Intronic
1131237273 15:90707466-90707488 TGTACTCCCAGCTAAACAAGAGG + Intergenic
1131255678 15:90860411-90860433 TGTAATCCCAGCACTACAGGAGG - Intergenic
1131376923 15:91932562-91932584 TGTAATCCCAGCAGCTCAGGAGG - Intronic
1131490592 15:92859100-92859122 TGCAATCCCAGCAGTTTAGGAGG - Intergenic
1131516089 15:93077827-93077849 TGTAATCCCAGCAGCTCAGGAGG - Intronic
1132298751 15:100763632-100763654 GGCACTTCCTGCAGAAGAGGAGG - Intergenic
1132582376 16:690863-690885 TGCATTCCCAGCACTTCAGGAGG - Intronic
1132647231 16:1004713-1004735 TGCAGTCCCAGCCAATCAGGAGG + Intergenic
1132859874 16:2064990-2065012 TGCAATCCCAGCTGCTCAGGAGG + Intronic
1132876465 16:2140991-2141013 TGTAATCCCAGCACTACAGGAGG + Intronic
1133274893 16:4632136-4632158 TGTAGTCCCAGCAACACAGGAGG - Intronic
1134174219 16:11992903-11992925 TGCAATCCCAGCACTTCAGGAGG + Intronic
1134620923 16:15688509-15688531 TGCAATCCCAGCTGCTCAGGAGG + Intronic
1134851821 16:17485057-17485079 TGTAATCCCAGCACAACAGGAGG + Intergenic
1135064570 16:19298704-19298726 TGAACTCCATCCAGAACAGGGGG - Exonic
1135108268 16:19670085-19670107 TGCAGTCCCAGCTGCTCAGGAGG - Intronic
1135225354 16:20651370-20651392 TGCAATCCCAGCACTTCAGGAGG + Intronic
1136078582 16:27836465-27836487 TGGAGTCCCAGAAGAAAAGGAGG - Intronic
1136424295 16:30158949-30158971 TGCAATCCCAGCACCTCAGGAGG - Intergenic
1137459410 16:48646391-48646413 TGCAGTCCCAGCTGCTCAGGAGG - Intergenic
1138053292 16:53805568-53805590 TGCAGTCCCAGCAACTCAGGAGG - Intronic
1138489780 16:57370070-57370092 TGCAGTCCCAGCTGCTCAGGAGG - Intergenic
1138585723 16:57969358-57969380 TGCAATCCCAGCACTTCAGGAGG + Intronic
1138747717 16:59383024-59383046 TGCAGTCCCAGCTGCTCAGGAGG - Intergenic
1139116221 16:63957140-63957162 TGCACTCCCATGAAATCAGGTGG - Intergenic
1139398807 16:66663382-66663404 TGCAGTCCCAGCTAATCAGGAGG + Intronic
1139474374 16:67195386-67195408 TGTAATCCCAGCACTACAGGAGG - Intronic
1139567858 16:67790819-67790841 TGTAATCCCAGCAGCTCAGGAGG - Intronic
1139683347 16:68582333-68582355 TGCAGTCCCAGCTGCTCAGGAGG + Intergenic
1139706106 16:68741799-68741821 TGCAATCCCAGCTGCTCAGGAGG - Intronic
1139969000 16:70762227-70762249 TGTACTCCCAGCTGCTCAGGAGG - Intronic
1140236982 16:73168510-73168532 TGCAATCCCAGCACTACGGGAGG - Intergenic
1140438534 16:74968597-74968619 TGCAGTCCCAGCTGCTCAGGAGG + Intronic
1140743625 16:77962624-77962646 TGTAATCCCAGCACATCAGGAGG + Intronic
1140967739 16:79983491-79983513 TGCAATCCCAGCTACACAGGAGG + Intergenic
1141120414 16:81350635-81350657 TGCAATCCCAGCAGCTCAGGAGG - Intronic
1141171464 16:81694322-81694344 CGTGCTCCCGGCAGAACAGGGGG + Intronic
1141581153 16:85000016-85000038 TGTACTCCCAGCTGCTCAGGAGG + Intronic
1141738633 16:85873684-85873706 TGTAATCCCAGCAGCTCAGGAGG - Intergenic
1142029050 16:87829404-87829426 CGCAGTCCCAGCTGAACGGGAGG - Intergenic
1142046470 16:87928283-87928305 TGCAGTCCCAGCTGCTCAGGAGG - Intronic
1142526357 17:544381-544403 TGCAATCCCAGCAGTTTAGGAGG + Intronic
1142619780 17:1157643-1157665 AACACGCCCAGCGGAACAGGGGG + Intronic
1143082400 17:4391457-4391479 TGTAGTCCCAGCAGATCATGAGG - Intergenic
1143597647 17:7924862-7924884 TGTACTCCCAGCTGTTCAGGAGG - Intronic
1143739750 17:8943649-8943671 TGCAGTCCCAGCTGTTCAGGAGG + Intronic
1144731594 17:17529249-17529271 TGCACACCTGGCAGGACAGGTGG - Intronic
1145053834 17:19685100-19685122 TGCAATCCCAGCACCTCAGGAGG - Intronic
1145091083 17:19986763-19986785 TGCAGTCCCAGCGGCTCAGGAGG - Intergenic
1145757900 17:27406188-27406210 TGTAATCCCAGCAGCTCAGGAGG - Intergenic
1145858928 17:28190361-28190383 TGCAGTCCCAGCACTTCAGGAGG + Intronic
1146232846 17:31129549-31129571 TGCAATCCCAGCAACTCAGGAGG - Intronic
1147126042 17:38369475-38369497 TTCACAAACAGCAGAACAGGAGG - Intronic
1147197266 17:38775501-38775523 TGTAATCCCAGCAGCTCAGGAGG - Intronic
1148057119 17:44806149-44806171 TGTAATCCCAGCAGCTCAGGAGG + Intronic
1148101918 17:45097405-45097427 GGGACTCTGAGCAGAACAGGTGG - Intronic
1148181125 17:45605669-45605691 TGCACTCCCAGCTACTCAGGAGG - Intergenic
1148267786 17:46240260-46240282 TGCACTCCCAGCTACTCAGGAGG + Intergenic
1149566518 17:57644326-57644348 GGGACTCACATCAGAACAGGGGG - Intronic
1149723429 17:58868206-58868228 TGCAGTCCCAGCAACTCAGGAGG + Intronic
1150095787 17:62373497-62373519 TGCAGTCCCAGCTGCTCAGGAGG + Intronic
1150409771 17:64933868-64933890 TGCAGTCCCAGCCACACAGGAGG + Intergenic
1150553477 17:66232371-66232393 TGTAATCCCAGCAGTTCAGGAGG + Intronic
1151175910 17:72287882-72287904 TGGATTCCCAGCAGTGCAGGTGG - Intergenic
1151316667 17:73326887-73326909 TGTAATCCCAGCACATCAGGAGG - Intergenic
1151871374 17:76839225-76839247 TGCAGTCCCAGCTGCTCAGGAGG - Intergenic
1152690096 17:81714064-81714086 TGCGAGCCCAGCAGAACAGAGGG - Intronic
1152822575 17:82444829-82444851 GGCACTCCCAGGAGAACCAGCGG - Intronic
1153732527 18:8029202-8029224 GGCACTCCAGGCAGGACAGGTGG - Intronic
1153732538 18:8029231-8029253 GGCACTCCAGGCAGGACAGGTGG - Intronic
1153972306 18:10237806-10237828 AGCATTCCCTGCAGACCAGGAGG + Intergenic
1154284335 18:13037675-13037697 TGCAATCCCAGCTACACAGGAGG - Intronic
1154374807 18:13800338-13800360 TGCACTGCCAGCAGAGTAGCTGG - Intergenic
1154391312 18:13938850-13938872 TCCACTCCCATCAGAACAGCAGG + Intergenic
1157989508 18:52477929-52477951 TGCAATCCCAGCTACACAGGAGG - Intronic
1159244728 18:65790745-65790767 TGTAATCCCAGCAGCTCAGGAGG + Intronic
1159283731 18:66321629-66321651 TGCAGTCCCAGCTGCTCAGGAGG + Intergenic
1159668572 18:71194914-71194936 TCCACTACAAGCAGAACAAGAGG - Intergenic
1159833950 18:73313273-73313295 GGCGTTCCCAGCAGAAGAGGAGG + Intergenic
1160702657 19:515614-515636 TGTAATCCCAGCAGCTCAGGAGG + Intronic
1160759842 19:778056-778078 TGTAATCCCAGCAGTTCAGGAGG + Intergenic
1160781668 19:880212-880234 TCCACACCCTGCAGAGCAGGAGG - Intronic
1161044451 19:2127644-2127666 TGCAATCCCAGCTGCACGGGAGG - Intronic
1162598318 19:11646698-11646720 TGCAATCCCAGCACTTCAGGAGG - Intergenic
1162930420 19:13954616-13954638 TGAACTCCCACCAGTACAGATGG - Exonic
1163493590 19:17631564-17631586 TCTGCTCCCAGCAGCACAGGAGG - Intronic
1163499960 19:17670360-17670382 TGTAATCCCAGCAGCTCAGGAGG - Intronic
1164256754 19:23534071-23534093 TGCAATCCCAGCACCTCAGGAGG + Intronic
1164260925 19:23568130-23568152 TGCAATCCCAGCACCCCAGGAGG - Intronic
1164405342 19:27939674-27939696 TGTAGTCCCAGCAGCTCAGGAGG - Intergenic
1164848753 19:31461498-31461520 TGCAGTCCCAACTGCACAGGAGG - Intergenic
1165082664 19:33318226-33318248 TGCAGTCCCAGCTGCTCAGGAGG + Intergenic
1165119602 19:33550712-33550734 TGTAATCCCAGCACTACAGGAGG + Intergenic
1165173455 19:33909538-33909560 TGTAATCCCAGCACACCAGGAGG + Intergenic
1165210527 19:34232048-34232070 TGCAATCCCAGCACTTCAGGAGG - Intergenic
1165549131 19:36568591-36568613 TGTAATCCCAGCTGCACAGGAGG - Intronic
1165675055 19:37715356-37715378 TGTAATCCCAGCACTACAGGAGG + Intronic
1165839419 19:38778971-38778993 TGCACTCCCAGCATGGGAGGAGG + Intergenic
1166025855 19:40084019-40084041 TGTAATCCCAGCTGCACAGGAGG - Intronic
1166962581 19:46507617-46507639 TGCAATCCCAGCTACACAGGGGG + Intronic
1167981716 19:53281647-53281669 GACTCTCCCAGCAGAGCAGGAGG + Intergenic
1167984376 19:53302015-53302037 GACTCTCCCAGCAGAGCAGGAGG - Intergenic
925316050 2:2924412-2924434 TGCACTCCCACCAGCAAAGAAGG + Intergenic
925930195 2:8701004-8701026 TGCAATCCCAGCACTTCAGGAGG + Intergenic
925935770 2:8757982-8758004 TGCACTCCCAGCTACTCAGGAGG - Intronic
926026295 2:9547943-9547965 TGCAGTCCCAGCTGCTCAGGAGG + Intronic
926699534 2:15794307-15794329 TGCAGTACCAGCAGAATGGGAGG + Intergenic
927772402 2:25874959-25874981 TGCACTCCCAGCTACTCAGGAGG + Intronic
927789176 2:25996806-25996828 TGCACTCCCAGCAGTGCATGAGG + Intergenic
928069143 2:28197107-28197129 TGCAATCCCAGCACTTCAGGAGG - Intronic
928120333 2:28579359-28579381 TCCACTCCCACCAGGACACGTGG + Intronic
929143232 2:38684683-38684705 TGCAATCCCAGCTAATCAGGAGG + Intronic
929152035 2:38756444-38756466 TGCAATCCCAGCACCTCAGGAGG + Intronic
929665544 2:43831292-43831314 TGCACTCCCAGCTGCTAAGGAGG - Intronic
930079755 2:47436108-47436130 TGCAATCCCAGCTACACAGGAGG - Intronic
930790376 2:55320851-55320873 TGCAATCCCAGCACTTCAGGAGG + Intronic
931866558 2:66418519-66418541 TGCAATCCCAGCTACACAGGAGG + Intergenic
932410387 2:71543601-71543623 TGCAATCCCAGCACCTCAGGAGG + Intronic
932482204 2:72050863-72050885 TACACACCCAGCAGAGGAGGAGG + Intergenic
932775843 2:74527936-74527958 TGCACTCCGTGTACAACAGGTGG - Exonic
933745594 2:85568751-85568773 TGTAATCCCAGCAGTTCAGGAGG + Intronic
934575433 2:95397605-95397627 TGCACGCCCAGCCCCACAGGCGG - Intergenic
935165021 2:100562820-100562842 TGCACTCCGAGCAGGACAGTAGG + Exonic
935194909 2:100807503-100807525 TGCACTCCCAGAGGCTCAGGAGG + Intergenic
936009286 2:108915032-108915054 TGTACTCCCAGCATCTCAGGAGG - Intronic
936378102 2:111959749-111959771 TGTAATCCCAGCACTACAGGAGG - Intronic
937066696 2:119023217-119023239 TGTACTCCCAGCTGCTCAGGAGG + Intergenic
937684384 2:124679688-124679710 TGCAGTCCCAGCTGCTCAGGAGG - Intronic
938318889 2:130348940-130348962 TGTAATCCCAGCAGCTCAGGAGG + Intergenic
940145944 2:150543581-150543603 TGCAGTCCCAGCTGCTCAGGAGG + Intergenic
941043161 2:160645683-160645705 TGCAATCCCAGCACTTCAGGAGG - Intergenic
941099066 2:161277354-161277376 TGCAGTCCCAGCTGTTCAGGAGG - Intergenic
941392792 2:164935560-164935582 TGCAGTCCCAGCTACACAGGAGG + Intronic
942029844 2:171948478-171948500 TGCAATCCCAGCACTTCAGGAGG - Intronic
942096049 2:172537428-172537450 TGCACTCCCGGCACCTCAGGAGG - Intergenic
942487460 2:176454626-176454648 TGCACTGCCAGGGGAACATGAGG + Intergenic
943054413 2:182958258-182958280 TGTAGTCCCAGCAGCTCAGGAGG - Intronic
943125942 2:183793091-183793113 TGCAATCCCAGCACCTCAGGAGG + Intergenic
943519036 2:188924487-188924509 TGCAGTCCCAGCTGCTCAGGAGG + Intergenic
943542504 2:189234617-189234639 TGTACTCTCAGAAGACCAGGAGG - Intergenic
944417761 2:199495904-199495926 TGCAGTCCCAGCTGCTCAGGAGG + Intergenic
944523573 2:200596077-200596099 TGGATTCCCAGAAGAACAGAGGG - Intronic
944679919 2:202067850-202067872 TGTAGTCCCAGCAGTACAGGGGG + Intergenic
944755737 2:202759955-202759977 TGCAATCCCAGCACTTCAGGAGG - Intronic
945403823 2:209422323-209422345 TGTAATCCCAGCAGCTCAGGAGG - Intergenic
945737090 2:213614041-213614063 TGTTCTCCCAACACAACAGGAGG - Intronic
946457412 2:219838799-219838821 TGTACTACCAGCAAACCAGGGGG - Intergenic
946647548 2:221854198-221854220 TGCACTCCCAGCTACTCAGGAGG - Intergenic
947502565 2:230682116-230682138 TGCAATCCCAGCACTTCAGGAGG + Intergenic
948207487 2:236169924-236169946 TGCCCACCCAGCAGACCTGGAGG + Intergenic
1169779369 20:9292955-9292977 TGTAATCCCAGCAGCTCAGGAGG + Intronic
1171221882 20:23405600-23405622 TGCAGTCCCAGCTACACAGGAGG + Intronic
1171485882 20:25485432-25485454 AGCACTGCCAGCAGAACGGGAGG + Intronic
1171995778 20:31730250-31730272 TGCAGTCCCAGCAACTCAGGAGG - Intergenic
1172886264 20:38232998-38233020 TGCAGTCCCAGCTGCTCAGGAGG + Intronic
1172963868 20:38818898-38818920 TGCAGTCCCAGCAACTCAGGAGG - Intronic
1173479739 20:43389619-43389641 TGTAATCCCAGCAGTTCAGGAGG + Intergenic
1173540500 20:43847580-43847602 TGCAGTCCCAGCTACACAGGAGG - Intergenic
1173871652 20:46345796-46345818 TGCAGTCCCAGCAACTCAGGAGG + Intergenic
1174224604 20:48986819-48986841 TGTAGTCCCAGCAGTTCAGGAGG - Intronic
1174791414 20:53481845-53481867 TGTACTCCCAGCACTTCAGGAGG + Intronic
1175180982 20:57147283-57147305 TTCACTCCCATGAGAGCAGGTGG + Intergenic
1175209421 20:57341313-57341335 TGAATTCCCAGAAGAACTGGTGG + Intronic
1175480609 20:59308149-59308171 TGCACTCCAAGCAAACCAGAAGG + Intronic
1176036529 20:63041675-63041697 TGTAATCCCAGCTGCACAGGAGG - Intergenic
1176086663 20:63298410-63298432 TGTACTCCCAGCTACACAGGAGG - Intronic
1176627922 21:9109942-9109964 TGCAATCCCAGCAGTTTAGGAGG + Intergenic
1176703844 21:10094123-10094145 TGCAATCCCAGCATTTCAGGAGG + Intergenic
1177218733 21:18162895-18162917 TGCAGTCCCAGCTGCTCAGGAGG - Intronic
1177815564 21:25972655-25972677 TGCAATCCCAGCAACTCAGGAGG - Intronic
1178150796 21:29791299-29791321 TGCATTCCCAGGAGAAGAGGAGG + Intronic
1178407129 21:32334178-32334200 TGCACTTCCCCCAGAACCGGAGG - Exonic
1179145845 21:38766658-38766680 TGTAATCCCAGCAGTTCAGGAGG + Intergenic
1179673953 21:42969149-42969171 TGCAATCCCAGCACTTCAGGAGG - Intergenic
1181172004 22:21015136-21015158 TGCAGCCGCAGCTGAACAGGAGG - Exonic
1181177302 22:21045064-21045086 TGCAGCCGCAGCTGAACAGGAGG + Intergenic
1182365216 22:29774230-29774252 TGTACTCCCAGCAACTCAGGAGG - Intergenic
1182590681 22:31377321-31377343 TGTACTCCCAGCCGCTCAGGAGG - Intergenic
1182629110 22:31670986-31671008 TGTAATCCCAGCAGTTCAGGAGG - Intergenic
1183599287 22:38830723-38830745 CCCACTGCCAGCAGAAGAGGGGG - Intronic
1183630779 22:39031446-39031468 TGCAGTCCCAGCTAATCAGGAGG + Intronic
1183634292 22:39051830-39051852 TGCAGTCCCAGCTAATCAGGAGG + Intronic
1183636981 22:39070145-39070167 TGCAGTCCCAGCTAATCAGGAGG + Intronic
1183983809 22:41558149-41558171 TGCCCTCCCAGCAGAAGCGCTGG - Intergenic
1184073006 22:42158008-42158030 TGCAGTCCCAGCTAAACGGGAGG - Intergenic
1184157219 22:42675875-42675897 TGTAGTCCCAGCAACACAGGAGG - Intergenic
1184225283 22:43126144-43126166 TGCACTCCCAGCTACTCAGGAGG - Intronic
1184483725 22:44763737-44763759 TGCACTTCCACCAGACAAGGCGG + Intronic
1185089831 22:48759968-48759990 TGCAACCCCAGCACAGCAGGAGG + Intronic
1185348326 22:50320338-50320360 TGCACTCCCAGCACTTCAGGAGG - Intronic
949723127 3:7013667-7013689 TGCAGTCCCAGCAACTCAGGAGG + Intronic
950389824 3:12687763-12687785 TGCAGTCCCAGCAACTCAGGAGG - Intergenic
950478354 3:13228144-13228166 GGCACTCCCAGCAGGGCTGGAGG - Intergenic
951617037 3:24558343-24558365 TGCAATCCCAGCACTTCAGGAGG - Intergenic
952489372 3:33851714-33851736 TGCAATCCCAGCACTTCAGGAGG - Intronic
952941623 3:38449512-38449534 TGTAATCCCAGCACATCAGGAGG - Intergenic
953004533 3:38965856-38965878 TGCAATCCCAGCACTTCAGGAGG + Intergenic
953376053 3:42429444-42429466 TGAACACCCAGGAGAACAGCGGG - Intergenic
953744713 3:45565480-45565502 GGCAGTCCCAGCAGAAGGGGTGG + Intronic
954523210 3:51248449-51248471 TGCAATCCCAGCACCTCAGGAGG - Intronic
955867294 3:63398594-63398616 TGTACTCCCAGCTGCTCAGGAGG + Intronic
957648855 3:82972069-82972091 GGCTCTTCCAGCAGAACAGATGG + Intergenic
957850782 3:85805060-85805082 TGTACTCCCAGCTAATCAGGAGG - Intronic
958604492 3:96339845-96339867 TTCACTACCAGGAGAACAGTAGG - Intergenic
959249784 3:103927081-103927103 TCCACTTCCAGCAGATGAGGTGG + Intergenic
961283702 3:125783136-125783158 TGTAGTCCCAGCAGCTCAGGAGG + Intergenic
961320955 3:126075064-126075086 TGCAGTCCCAGCTGCTCAGGAGG - Intronic
961786349 3:129349509-129349531 GGCACTCCCAGCAGGGCTGGAGG + Intergenic
961794892 3:129402424-129402446 TGCACTCCTGGCACAACAGCTGG - Intronic
962453246 3:135539453-135539475 TGCAATCCCAGCACTTCAGGAGG - Intergenic
962559974 3:136595553-136595575 TGCAGTCCCAGCTGCTCAGGAGG + Intronic
963181643 3:142362890-142362912 TGTACTCCCAGCTAATCAGGAGG - Intronic
963190953 3:142472757-142472779 TGCAGTCCCAGCTGCTCAGGAGG - Intronic
963237664 3:142971589-142971611 TGTAGTCCCAGCTGTACAGGAGG + Intronic
963426676 3:145137734-145137756 TGCACTCCCACCAGAATGGTGGG - Intergenic
963776496 3:149445483-149445505 TGCAATCCCAGCACCTCAGGAGG + Intergenic
964135902 3:153344561-153344583 GGCAAGACCAGCAGAACAGGTGG - Intergenic
964350197 3:155795332-155795354 TGTAATCCCAGCTGATCAGGAGG + Intronic
964940155 3:162149867-162149889 TGCACTCTCAGCAGTATATGAGG + Intergenic
965567736 3:170138566-170138588 TGTAGTCCCAGCAGCCCAGGAGG + Intronic
966117916 3:176487070-176487092 TGCAATCCCAGCACTTCAGGAGG + Intergenic
966236321 3:177705730-177705752 TGCACTCCCAGCTACTCAGGAGG - Intergenic
966956584 3:184886833-184886855 TGTACTCCCAGCACTTCAGGAGG - Intronic
967225492 3:187287266-187287288 TGTGCTCCCAGAATAACAGGGGG - Intronic
967837972 3:193980573-193980595 TCCCCTCCCAGCAAAACAAGAGG + Intergenic
968217390 3:196905019-196905041 TGTAATCCCAGCTGCACAGGAGG - Intronic
968499925 4:944979-945001 TGTAGTCCCAGCAACACAGGAGG + Intronic
968809738 4:2794451-2794473 TCCACTCCTGGCAGGACAGGAGG + Intronic
968866712 4:3217564-3217586 AGCAATCCCAGCAGAAAATGGGG + Intronic
968887713 4:3344145-3344167 TGCTCTTCCAGGAGAAAAGGTGG + Intronic
972310613 4:37878654-37878676 TGTAATCCCAGCTGCACAGGAGG + Intergenic
972597278 4:40541030-40541052 TGCAATCCCAGCACTACGGGAGG + Intronic
972927089 4:44022923-44022945 TGCTCACCAAGCAGAGCAGGAGG - Intergenic
973673292 4:53239100-53239122 TGCAATCCCAGCACCTCAGGAGG + Intronic
974769386 4:66390868-66390890 TGTAATCCCAGCAGTTCAGGAGG - Intergenic
974783394 4:66584719-66584741 TGTATTCCCAGCAGTTCAGGAGG + Intergenic
975089110 4:70379485-70379507 TGTAATCCCAGCAGCTCAGGAGG + Intronic
975544104 4:75544474-75544496 TGTAGTCCCAGCTGATCAGGAGG - Intronic
975588468 4:75975837-75975859 TGCAATACCTGCAGAAAAGGAGG + Exonic
975852231 4:78584292-78584314 TGCAGTCCCAGCTGCTCAGGAGG - Intronic
976175542 4:82348021-82348043 TGCAGTCCCAGCAACTCAGGAGG + Intergenic
977116506 4:93035368-93035390 TGCAATCCCAGCAGTACGGGAGG - Intronic
977932798 4:102767035-102767057 TGTAATCCCAGCTGCACAGGAGG + Intergenic
978014171 4:103722959-103722981 TGCAATCCCAGCACCTCAGGAGG - Intergenic
979243347 4:118469708-118469730 TGTACTCCCAGCAACTCAGGAGG + Intergenic
979654450 4:123175916-123175938 TGCACACCTTGCAGAACTGGGGG + Intronic
979752816 4:124300349-124300371 TGCAGTCCCAGCGGCTCAGGAGG + Intergenic
980062782 4:128150027-128150049 TGTACTCCCAGCTGTTCAGGAGG + Intronic
980122392 4:128741382-128741404 TGCAGTCCCAGCCAATCAGGAGG + Intergenic
981247537 4:142557499-142557521 TGGACTGCCAGCTGGACAGGTGG - Intronic
981519734 4:145649030-145649052 TGTAGTCCCAGCAGTTCAGGAGG + Intronic
981807401 4:148732572-148732594 TGCAGTCCCAGCTGCTCAGGAGG + Intergenic
982028586 4:151276934-151276956 TGCTCTCCCAGGACAGCAGGGGG + Intronic
982190827 4:152854032-152854054 TGTAATCCCAGCTGCACAGGAGG - Intronic
982625475 4:157760665-157760687 TTCACAACCAGCAGACCAGGAGG - Intergenic
982697811 4:158623378-158623400 TGTAATCCCAGCAAATCAGGAGG + Intronic
983823916 4:172233110-172233132 TGCAATCCCAGCACACCGGGTGG + Intronic
984966043 4:185141375-185141397 TGGAATCCCAGCAGCTCAGGAGG - Intergenic
985044159 4:185923412-185923434 TGCAGTCCCAGCTGCTCAGGAGG - Intronic
985567397 5:626304-626326 TGCTCTCCCACCAAGACAGGAGG - Intronic
985862665 5:2486707-2486729 TGTAATCCCAGCACTACAGGAGG + Intergenic
985871735 5:2562823-2562845 TGCAGTCAAAGCAGAAAAGGAGG + Intergenic
986040800 5:3992457-3992479 TGCAGTCCCAGCAAATCAGGAGG - Intergenic
986068695 5:4261087-4261109 AGCACTTCCAGCAGCTCAGGAGG - Intergenic
986987641 5:13517041-13517063 AGCTCTCCCAGCATAACAGCAGG - Intergenic
987344973 5:16971093-16971115 TGCAGTCCCAGCAAGTCAGGAGG - Intergenic
988147383 5:27328213-27328235 TGCAGTCCCAGCTGCTCAGGAGG + Intergenic
988454100 5:31372364-31372386 TGCACTCCCCCAAGAACTGGAGG - Intergenic
989230397 5:39079551-39079573 TGTAATCCCAGCAGTACGGGAGG + Intergenic
989717009 5:44476205-44476227 TGTAATCCCAGCTGCACAGGAGG + Intergenic
990138357 5:52674702-52674724 TGTAATCCCAGCAGTTCAGGAGG - Intergenic
990709530 5:58564898-58564920 TGCAATCCCAGCACCTCAGGAGG + Intergenic
991019758 5:61968132-61968154 TGCAGTCCCAGCTGCTCAGGAGG - Intergenic
992457452 5:76928859-76928881 TGCAGTCCCAGCTGCTCAGGAGG - Intergenic
992613910 5:78531881-78531903 TGTACTCCCAGCTACACAGGAGG - Intronic
992649233 5:78841206-78841228 TGTAGTCCCAGCAACACAGGAGG + Intronic
992764906 5:79989205-79989227 TGAACTCTCAGCAAAACAAGGGG - Exonic
994702841 5:103158805-103158827 TGTAGTCCCAGCAGCTCAGGAGG + Intronic
995183883 5:109252344-109252366 CCCACCCCCAGCAGAACAGAAGG - Intergenic
995499651 5:112790583-112790605 TGCAATCCCAGCACTTCAGGAGG - Intronic
995611614 5:113916731-113916753 TGTAATCCCAGCAACACAGGAGG - Intergenic
996735998 5:126759051-126759073 TGTAGTCCCAGCTGATCAGGAGG - Intergenic
997152541 5:131513904-131513926 TGCACTCCCAGCTACTCAGGAGG + Intronic
998310902 5:141130173-141130195 TGTAATCCCAGCAGTTCAGGAGG + Intronic
998865602 5:146497401-146497423 TGCAATCCCAGCACGTCAGGAGG - Intronic
998967259 5:147553919-147553941 TGCAGTCCCAGCTGCTCAGGAGG + Intergenic
999286019 5:150394793-150394815 TGTACTCCCAGCAACTCAGGAGG + Intronic
999405872 5:151306101-151306123 TGTAATCCCAGCAAATCAGGAGG + Intergenic
999645154 5:153710477-153710499 TGCAATCCCAGCACTTCAGGAGG - Intronic
1000330552 5:160201882-160201904 TGCAGTCCCAGCTGCTCAGGAGG - Intronic
1001383697 5:171320655-171320677 TGCAATCCCAGCACTACGGGGGG + Intergenic
1001588124 5:172847087-172847109 TGAAGTCCCAGCAGAAGATGGGG + Intronic
1002039992 5:176506067-176506089 TGCACTCCCAGCTACTCAGGAGG + Intronic
1002503460 5:179662755-179662777 TGCAGTCCCAGCTGCTCAGGAGG - Intergenic
1003217057 6:4123708-4123730 TGTACTCCCAGCACTTCAGGAGG + Intronic
1004075163 6:12338419-12338441 TGTAGTCCCAGCAGTTCAGGAGG + Intergenic
1004200501 6:13543294-13543316 TGTAATCCCAGCTGCACAGGAGG + Intergenic
1004512145 6:16291787-16291809 TGTACTCCCAGCAGCTCAGGAGG + Intronic
1004631660 6:17427211-17427233 TGTGTTCCCAGCAGAACAGAAGG + Intronic
1004692741 6:18006436-18006458 TGCAATCCCAGCTGCTCAGGAGG + Intergenic
1005043946 6:21624229-21624251 TGCAATCCCAGCACTTCAGGAGG - Intergenic
1005182758 6:23125277-23125299 TGCAGTCCCAGCAGTCTAGGAGG + Intergenic
1005860137 6:29894072-29894094 TGCAATCCCAGCTGCTCAGGAGG - Intergenic
1006707639 6:36035191-36035213 TGTAATCCCAGCAGAACTGCCGG - Intronic
1008657727 6:53633038-53633060 TGTACTCCCAGCTAATCAGGAGG - Intergenic
1010439563 6:75877521-75877543 TGCAATCCCAGCACTTCAGGAGG - Intronic
1011089875 6:83585405-83585427 TGCAGTCCCAGCTGCTCAGGAGG + Intronic
1011095596 6:83658485-83658507 TGCAGTCCCAGCTGCTCAGGAGG + Intronic
1011681373 6:89786670-89786692 TGTAATCCCAGCACATCAGGAGG + Intronic
1012165190 6:95940443-95940465 TGCAGTCCCAGCTGCTCAGGAGG + Intergenic
1013303911 6:108830530-108830552 TGCAGTCCCAGCAACTCAGGAGG + Intergenic
1013552270 6:111219405-111219427 TGCAGTCCCAGATGCACAGGAGG + Intronic
1014011471 6:116480838-116480860 TGCAATCCCAGCACATTAGGAGG - Intergenic
1014108352 6:117592243-117592265 TGCAATCCCAGCTGCTCAGGAGG + Intronic
1015689691 6:135908208-135908230 TGTAATCCCAGCAGCTCAGGAGG - Intronic
1015885638 6:137915426-137915448 TGCAATCCCAGCTACACAGGAGG - Intergenic
1016927814 6:149370393-149370415 AGCTCTCCTGGCAGAACAGGTGG - Intronic
1016968022 6:149736808-149736830 TGTACTCCCAGCAACTCAGGAGG - Intronic
1017667004 6:156729593-156729615 TGCAATCCCAGCACTTCAGGAGG + Intergenic
1019736822 7:2654271-2654293 TGCAATCCCAGCTGCACAGGAGG + Intronic
1019877833 7:3830615-3830637 TGCAGTCCCAGCTAATCAGGAGG - Intronic
1020057855 7:5130574-5130596 TGTACTCCCAGCTGCACGGGAGG - Intergenic
1020083502 7:5298533-5298555 TGCAATCCCAGCTATACAGGAGG + Intronic
1020152964 7:5697602-5697624 TGTAGTCCCAGCTGCACAGGAGG - Intronic
1020175478 7:5878623-5878645 TGCAGTCCCAGCTGCTCAGGAGG + Intergenic
1020290652 7:6719952-6719974 TGCCCTCCCAGCAGACACGGAGG + Intergenic
1020407251 7:7851507-7851529 TGCACTCCCACCAGAAGTGTGGG + Intronic
1021489320 7:21201479-21201501 TGCAGTCCCAGCTACACAGGAGG - Intergenic
1021808781 7:24382288-24382310 TCCTCACCCAGCAGACCAGGTGG - Intergenic
1022002067 7:26235591-26235613 TGCAGTCCCAGCTGCTCAGGAGG - Intergenic
1022426773 7:30276744-30276766 TGTAATCCCAGCACTACAGGAGG + Intergenic
1023166025 7:37344286-37344308 TGCAATCCCAGCACTTCAGGAGG - Intronic
1023592332 7:41793457-41793479 TGCAGTCCCAGCGGCTCAGGAGG + Intergenic
1023595643 7:41827000-41827022 TGCAGGCCCAGAAGAACTGGTGG - Intergenic
1023947920 7:44818384-44818406 TGCAGTCCCAGCTGCTCAGGAGG - Intronic
1024617222 7:51126204-51126226 TGCAATCCCAGCAGTATGGGAGG + Intronic
1025060443 7:55801661-55801683 TGCAATCCCAGCAGTTTAGGAGG + Intronic
1025084250 7:56009670-56009692 TGCAGAACCAGCCGAACAGGAGG - Intergenic
1026042914 7:66883668-66883690 TGCAGTCCCAGCAACTCAGGAGG - Intergenic
1026061031 7:67026327-67026349 TGTAATCCCAGCACCACAGGAGG - Intronic
1026373847 7:69730096-69730118 TGGACTCCCAGCTACACAGGCGG - Intronic
1026583174 7:71634630-71634652 TGTAGTCCCAGCTGCACAGGAGG + Intronic
1026717331 7:72801070-72801092 TGTAATCCCAGCACCACAGGAGG + Intronic
1027593985 7:80149995-80150017 TGCACTTCCATGAAAACAGGTGG - Intronic
1028796665 7:94910259-94910281 AGGGCTCCCAGCAGAGCAGGGGG + Exonic
1029115545 7:98234968-98234990 TGCAGTCCCAGCACTTCAGGAGG - Intronic
1029121669 7:98272281-98272303 TGCAATCCCAGCTGCTCAGGAGG - Intronic
1029685475 7:102144547-102144569 TGCAGTCCCAGCAACTCAGGAGG + Intronic
1029940640 7:104477245-104477267 TGCAATCCCAGCACTTCAGGAGG - Intronic
1030386337 7:108871997-108872019 TGTAGTCCTAGCAGATCAGGAGG - Intergenic
1031438596 7:121764255-121764277 TGTACTCCCAGCTAGACAGGAGG - Intergenic
1031449279 7:121894525-121894547 TGTAGTCCCAGCTAAACAGGAGG - Intronic
1031616915 7:123892379-123892401 TGCAATCCCAGCTGCTCAGGAGG + Intergenic
1032284698 7:130531471-130531493 TCAACACCCAGAAGAACAGGTGG + Intronic
1032409419 7:131683649-131683671 TGCACACCCAGCAGAGCACCTGG - Intergenic
1032456449 7:132076586-132076608 TGCACCACCAGCAGAGCTGGGGG + Intergenic
1032570264 7:132988655-132988677 TGCAATCCCAGCTGCTCAGGAGG + Intronic
1033185583 7:139225121-139225143 TGCAATCCCAGCACCTCAGGAGG - Intergenic
1033686600 7:143646408-143646430 TGTAGTCCCAGCAACACAGGAGG + Intronic
1033689134 7:143720899-143720921 TGTAGTCCCAGCAACACAGGAGG - Intronic
1033698010 7:143811207-143811229 TGTAGTCCCAGCAACACAGGAGG - Intergenic
1034177880 7:149114517-149114539 TGCAATCCCAGCAACTCAGGAGG - Intronic
1034877101 7:154734228-154734250 TGCAGTCCCAGCTGCTCAGGAGG - Intronic
1034922327 7:155094082-155094104 TGCAGTCCCAGCTGCTCAGGAGG + Intergenic
1035038216 7:155909017-155909039 TGCAATGCCAGCTGACCAGGTGG - Intergenic
1035181795 7:157094719-157094741 TGTACTCCCAGCAACTCAGGAGG - Intergenic
1035544718 8:471122-471144 TGCCAGCCCAGCAGAACAGCTGG - Intronic
1035604420 8:920265-920287 TGGGCTCCCAGCAGGACAGCAGG + Intergenic
1036136369 8:6165258-6165280 TGCAGTCCCAGCTGCTCAGGAGG + Intergenic
1036369947 8:8154321-8154343 TGGCCGCCCAGCAGGACAGGCGG - Intergenic
1036671069 8:10788441-10788463 TGCAATCCCAGCTGCTCAGGAGG + Intronic
1036880945 8:12511309-12511331 TGGCCGCCCAGCAGGACAGGCGG + Intergenic
1037262303 8:17022738-17022760 TGCAGTCCCAGCAGCTCAGGAGG - Intergenic
1037687428 8:21154928-21154950 TGTAGTCCCAGCTGCACAGGAGG - Intergenic
1037695809 8:21223064-21223086 TGTAATCCCAGCAGTTCAGGAGG + Intergenic
1038020397 8:23547998-23548020 CGCACTGCCAGCAGCACAGATGG + Intronic
1039001941 8:32991183-32991205 TGCAATCCCAGCACTTCAGGAGG - Intergenic
1039624496 8:39034147-39034169 TGTAATCCCAGCACATCAGGAGG - Intronic
1039960805 8:42246156-42246178 TGCAGTCCCAGCTGCTCAGGAGG - Intergenic
1040372422 8:46789717-46789739 TGCAACTCCAGCAAAACAGGAGG - Intergenic
1041141395 8:54823450-54823472 TGTAATCCCAGCTGCACAGGAGG - Intergenic
1041236836 8:55811637-55811659 TGTACTCCCAGCAACTCAGGAGG + Intronic
1041907485 8:63049636-63049658 TGTACTCCCAGCTGCTCAGGAGG + Intronic
1042252125 8:66766968-66766990 TGTAATCCCAGCAGCTCAGGAGG - Intronic
1042513512 8:69635746-69635768 TGTAGTCCCAGCACCACAGGCGG + Intronic
1043056083 8:75441365-75441387 TGCAGTCCCAGCTGCTCAGGAGG - Intronic
1043964562 8:86459290-86459312 TGCAATCCCAGCACTTCAGGAGG - Intronic
1044781270 8:95745730-95745752 TGTAATCCCAGCACATCAGGAGG + Intergenic
1044833661 8:96275275-96275297 TGCAGTCCCAGCTGCTCAGGAGG - Intronic
1045179925 8:99770035-99770057 TGTAGTCCCAGCTGATCAGGAGG + Intronic
1046658702 8:116925291-116925313 TGCAATCCCAGCACTTCAGGAGG + Intergenic
1046918242 8:119699953-119699975 TGCAATCCCAGCTAATCAGGAGG + Intergenic
1046949975 8:120010492-120010514 TGTAGTCCCAGCTGATCAGGAGG + Intronic
1047710829 8:127550671-127550693 TGCACTTCCAGAAGACCAGATGG + Intergenic
1047743215 8:127823934-127823956 TGTAATCCCAGCAGTTCAGGAGG + Intergenic
1048595634 8:135862779-135862801 TGCACTCCCAGCTACTCAGGAGG - Intergenic
1048678342 8:136810456-136810478 TGTACTCCCAGCTAATCAGGAGG + Intergenic
1049300923 8:141869108-141869130 TTCACTCCCAACAGACCAGCAGG - Intergenic
1049413931 8:142486760-142486782 TGTAATCCCAGCAGTTCAGGAGG + Intronic
1049666431 8:143845580-143845602 TGCACTCCCAGCTACTCAGGAGG - Intergenic
1049764725 8:144349491-144349513 TGCAATCCCAGCACTTCAGGAGG + Intergenic
1049764740 8:144349558-144349580 TGCAATCCCAGCACTTCAGGAGG + Intergenic
1049764755 8:144349625-144349647 TGCAATCCCAGCACGTCAGGAGG + Intergenic
1049872530 8:144992103-144992125 TGCAATCCCAGCACTTCAGGAGG + Intergenic
1050126163 9:2358244-2358266 TGCAGTCCCAGCAGGTTAGGAGG - Intergenic
1051895584 9:21984370-21984392 TGCACTCCAAGCAGTGGAGGTGG - Intronic
1052630275 9:31028818-31028840 TGTAATCCCAGCACTACAGGAGG + Intergenic
1053377723 9:37621969-37621991 GGCATTCTCAGCAGAACAGCTGG - Intronic
1053378814 9:37631723-37631745 TGCAGTCCCAGCTGCTCAGGAGG - Intronic
1053616219 9:39769377-39769399 TGCACTCCCAGCTACTCAGGAGG - Intergenic
1053874385 9:42528685-42528707 TGCACTCCCAGCTACTCAGGAGG - Intergenic
1053898227 9:42765903-42765925 TGCACTCCCAGCTACTCAGGAGG + Intergenic
1054237298 9:62573012-62573034 TGCACTCCCAGCTACTCAGGAGG + Intergenic
1054267950 9:62938070-62938092 TGCACTCCCAGCTACTCAGGAGG + Intergenic
1054551433 9:66607523-66607545 TGCACTCCCAGCTACTCAGGAGG + Intergenic
1054825889 9:69573036-69573058 TGTACTCCCAGCTGCTCAGGAGG + Intronic
1055066007 9:72119246-72119268 TGCAATCCCAGCACTTCAGGAGG + Intronic
1055470382 9:76604792-76604814 TGCAGTCCCAGCAACTCAGGAGG - Intergenic
1057323171 9:94032769-94032791 TGTAATCCCAGCACTACAGGAGG - Intronic
1057447760 9:95129867-95129889 TGCACACCCAGCAGAACAATCGG - Intronic
1058387943 9:104460775-104460797 TGTAGTCCCAGCAGCTCAGGAGG - Intergenic
1058489552 9:105481892-105481914 TGCAGTCCCAGCTGCTCAGGCGG - Intronic
1058754664 9:108073283-108073305 TGTAGTCCCAGCTGATCAGGAGG - Intergenic
1060143328 9:121229340-121229362 TGCAGTCCCAGCTGCTCAGGAGG - Intronic
1060728289 9:126020820-126020842 TGCAATCCCAGCACTTCAGGAGG - Intergenic
1060774428 9:126361790-126361812 TGTAATCCCAGCAGCTCAGGAGG + Intronic
1060983673 9:127807847-127807869 TGCAATCCCAGCATTTCAGGAGG + Intronic
1061348435 9:130044365-130044387 TGTAATCCCAGCACATCAGGAGG + Intergenic
1061508663 9:131047284-131047306 TGCAGTCCCAGCTACACAGGAGG - Intronic
1061569193 9:131465844-131465866 TGTAATCCCAGCAGCTCAGGAGG - Intronic
1062313541 9:135953436-135953458 TGTAGTCCCAGCAGCTCAGGAGG - Intronic
1062314298 9:135958527-135958549 TGCACACCCAGGAGCACAGCAGG + Intronic
1202788882 9_KI270719v1_random:64219-64241 TGCAATCCCAGCATTTCAGGAGG + Intergenic
1203750768 Un_GL000218v1:77626-77648 TGCAATCCCAGCAGTTTAGGAGG + Intergenic
1185476893 X:420695-420717 TGCAGTCCCAGCACTACGGGAGG + Intergenic
1186520279 X:10200147-10200169 TGCAGTCCCAGCTCCACAGGAGG - Intronic
1187432353 X:19236636-19236658 TGCAGTCCCAGCTGCTCAGGAGG + Intergenic
1187920502 X:24196717-24196739 TGCAGTCCCAGCTCCACAGGAGG - Intronic
1188913257 X:35877343-35877365 TGCAGTCCCAGCTGCTCAGGAGG - Intergenic
1189399791 X:40657007-40657029 TGTAATCCCAGCTGCACAGGAGG - Intronic
1189410765 X:40768925-40768947 TGTAATCCCAGCTAAACAGGAGG - Intergenic
1190637562 X:52451290-52451312 TGCAATCCCAGCTAATCAGGAGG + Intergenic
1190817920 X:53944898-53944920 TGCAGTCCCAGCTGCTCAGGAGG + Intronic
1192217126 X:69167803-69167825 TGCAGTCCCAGCAACTCAGGAGG - Intergenic
1192345277 X:70298147-70298169 TGCAGTCCCAGCTGCTCAGGAGG + Intronic
1192394309 X:70762910-70762932 TGTACTCCCAGCAACTCAGGAGG + Intronic
1192530352 X:71877484-71877506 TGCAATCCCAGCACCTCAGGAGG + Intergenic
1192663530 X:73067587-73067609 TGCAATCCCAGCACCTCAGGAGG - Intergenic
1192723908 X:73727995-73728017 TGCAGTCCCAGCAACTCAGGAGG + Intergenic
1192741678 X:73899393-73899415 TGCAGTCCCAGCTGCTCAGGAGG + Intergenic
1192937284 X:75873219-75873241 AGCAGTACCTGCAGAACAGGTGG - Intergenic
1193119272 X:77806526-77806548 TGTAATCCCAGCAAATCAGGAGG - Intergenic
1193326267 X:80181475-80181497 GCTACTCCCAGAAGAACAGGTGG - Intergenic
1194092091 X:89590562-89590584 TGTACTCCCAGCTGCTCAGGAGG - Intergenic
1194945202 X:100058649-100058671 TGCACTCACAGAAGATCAGAAGG - Intergenic
1195204580 X:102584113-102584135 TGTAATCCCAGCAGTATAGGAGG + Intergenic
1195262916 X:103151597-103151619 TGCAATCCCAGCACTTCAGGAGG - Intergenic
1195638297 X:107143469-107143491 TGCAATCCCAGCACTTCAGGAGG - Intronic
1196214749 X:113037400-113037422 TGCAATCCCAGCTACACAGGAGG - Intergenic
1196751305 X:119120045-119120067 TGCACTCCCAGCTACTCAGGAGG + Intronic
1197200529 X:123744843-123744865 TGCAATCCCAGCAGTTTAGGTGG + Intergenic
1198081363 X:133242985-133243007 TGCAGTCCCAGCTAATCAGGAGG - Intergenic
1198098417 X:133402779-133402801 TGTAGTCCCAGCTGCACAGGAGG + Intronic
1198995695 X:142571407-142571429 TGCAACTCCAGCAGAACGGGTGG + Intergenic
1199023823 X:142913769-142913791 TGTAATCCCAGCAGTTCAGGAGG - Intergenic
1200444721 Y:3246598-3246620 TGTACTCCCAGCTGCTCAGGAGG - Intergenic
1200975196 Y:9204530-9204552 AGAACTGCCAGCAGAGCAGGTGG - Intergenic
1201277108 Y:12309539-12309561 TGCACTCCCAGCAGTTGGGGAGG + Intergenic
1201514042 Y:14797550-14797572 TGCAATCCCAGCAGTATGGGAGG - Intronic
1201569042 Y:15394897-15394919 TGCTTTCCCAGCTGAACAGAAGG - Intergenic
1201895084 Y:18984492-18984514 TGTACTCCCAGCTGCTCAGGAGG - Intergenic
1202028661 Y:20551278-20551300 TGCAATCCCAGCACCCCAGGAGG - Intergenic
1202135953 Y:21661987-21662009 AGAACTGCCAGCAGAGCAGGTGG + Intergenic