ID: 900385178

View in Genome Browser
Species Human (GRCh38)
Location 1:2407321-2407343
Sequence CTGTGTCACCAGCAGGAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 408
Summary {0: 1, 1: 0, 2: 3, 3: 49, 4: 355}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900385178_900385183 3 Left 900385178 1:2407321-2407343 CCACCCTCCTGCTGGTGACACAG 0: 1
1: 0
2: 3
3: 49
4: 355
Right 900385183 1:2407347-2407369 GCTTCTGACCGTGCCACTGAAGG 0: 1
1: 0
2: 0
3: 6
4: 91
900385178_900385187 21 Left 900385178 1:2407321-2407343 CCACCCTCCTGCTGGTGACACAG 0: 1
1: 0
2: 3
3: 49
4: 355
Right 900385187 1:2407365-2407387 GAAGGACAGCTGGCTGCCCTCGG 0: 1
1: 0
2: 4
3: 31
4: 287
900385178_900385185 11 Left 900385178 1:2407321-2407343 CCACCCTCCTGCTGGTGACACAG 0: 1
1: 0
2: 3
3: 49
4: 355
Right 900385185 1:2407355-2407377 CCGTGCCACTGAAGGACAGCTGG 0: 1
1: 0
2: 0
3: 12
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900385178 Original CRISPR CTGTGTCACCAGCAGGAGGG TGG (reversed) Intronic
900385178 1:2407321-2407343 CTGTGTCACCAGCAGGAGGGTGG - Intronic
900391282 1:2435061-2435083 CTTTGTCAGCAGCAGGAGGCAGG + Intronic
901089637 1:6632745-6632767 CTGCATCACCAGCAGGAAGGCGG - Intronic
901371743 1:8804693-8804715 CATTCTCACCAGCAGGAAGGAGG - Intronic
901429392 1:9203710-9203732 CTGTGTCCCAAGCAGGATGCGGG - Intergenic
901512091 1:9722505-9722527 CTGTGCCACCGGCCGGTGGGAGG - Intronic
901739039 1:11330366-11330388 CTGTGACTACAGCAGAAGGGAGG + Intergenic
902962677 1:19976025-19976047 CTGTGTCTCCACCAGGCTGGAGG - Intronic
903649520 1:24914346-24914368 CTGTCTACCCAGCAGCAGGGTGG + Intronic
905106437 1:35565971-35565993 CTGGCTCCCCTGCAGGAGGGAGG + Exonic
905732921 1:40308412-40308434 CCCTGGCACCAGCAGGAGGGAGG + Intronic
906105682 1:43290737-43290759 CTGAGTGAACAGCAGGAAGGGGG + Intergenic
907309098 1:53529240-53529262 CTGGGTCACCTGCAGGAGCCTGG + Intronic
908067270 1:60420461-60420483 GTGTCTCAGCAGCAGGAAGGTGG + Intergenic
908596092 1:65690252-65690274 CTGTGTCTCCAACAGGAGGTGGG - Intergenic
909722729 1:78795457-78795479 CTGTGGCCCCAGCACTAGGGAGG - Intergenic
910667303 1:89739266-89739288 GTGTGTCATCTGCTGGAGGGTGG - Intronic
910875510 1:91874405-91874427 CTGGGTCACCAGCATAAGAGTGG + Intronic
911299381 1:96153642-96153664 ATGTGTCTCCAGCAGGGGTGAGG + Intergenic
912190976 1:107339989-107340011 CTGTGGCAACAGCAGGGAGGAGG + Intronic
913322568 1:117599472-117599494 GTCTATCACCAGCAGGAGGGTGG + Intergenic
914379357 1:147102670-147102692 CTGCGTCCTCAGGAGGAGGGAGG - Intergenic
915488727 1:156239890-156239912 CTGGGGAACCAGCAGGAGGGGGG - Intronic
916107672 1:161442785-161442807 TTGTGTCACCAGCAGGTGAGAGG - Intergenic
916109256 1:161450203-161450225 TTGTGTCACCAGCAGGTGAGAGG - Intergenic
916110842 1:161457584-161457606 TTGTGTCACCAGCAGGTGAGAGG - Intergenic
916112429 1:161464994-161465016 TTGTGTCACCAGCAGGTGAGAGG - Intergenic
916114014 1:161472375-161472397 TTGTGTCACCAGCAGGTGAGAGG - Intergenic
916578061 1:166084715-166084737 CTGTGACACCTGCAGCTGGGAGG + Intronic
916830013 1:168481271-168481293 CTGGCTCACCTGCAGAAGGGTGG + Intergenic
917564373 1:176196927-176196949 GAGTGAAACCAGCAGGAGGGAGG + Intronic
917568986 1:176244265-176244287 CTGTGGCTCTAGCAGGATGGAGG - Intergenic
919664923 1:200282753-200282775 CTTTCTCAGCAGCAGGAGGGAGG + Intergenic
919991498 1:202710665-202710687 CTGCTTCCCCAGCAGGAAGGCGG + Intergenic
920077562 1:203348238-203348260 CCCTGCCAGCAGCAGGAGGGAGG + Exonic
920365757 1:205447631-205447653 CTGAGTGACAAGCAGGACGGGGG + Intronic
920565138 1:206967094-206967116 GCAGGTCACCAGCAGGAGGGCGG - Exonic
921039589 1:211416840-211416862 CAGGGTCCCCAGCAGGAAGGTGG - Intergenic
922059792 1:222077400-222077422 ATGTGGCAGCAGCAGGAGGTTGG - Intergenic
924129330 1:240889400-240889422 ATGGGACACCAGCAGCAGGGTGG + Intronic
1062854160 10:771292-771314 CTGTCACACCCGCAGGAGTGAGG + Intergenic
1063145326 10:3290550-3290572 CTGTGTCAACACCAGCAGGCAGG - Intergenic
1065041805 10:21705259-21705281 CTGTGGCAGTAGCAGCAGGGTGG + Intronic
1065629233 10:27660403-27660425 CTGTCGCCCCAGCTGGAGGGCGG - Intergenic
1065944899 10:30597344-30597366 CAGTGTAACCAGCAGGAGTTGGG + Intergenic
1067029651 10:42871613-42871635 CGGTGTCTCCAGCAGCAGGGAGG + Intergenic
1067029943 10:42873206-42873228 AGGACTCACCAGCAGGAGGGAGG - Intergenic
1067051892 10:43026395-43026417 CTGTGTCACTGGAAGGAGGAAGG + Intergenic
1067455984 10:46419565-46419587 TTGTGTCACAGGCAGCAGGGGGG - Intergenic
1067631216 10:47965074-47965096 TTGTGTCACAGGCAGCAGGGGGG + Intergenic
1067696072 10:48536488-48536510 CTGAGTAACTAGCAGGTGGGGGG - Intronic
1069710347 10:70483798-70483820 CTCTGTGACCAGCAGGAAAGGGG - Intronic
1069716188 10:70522933-70522955 GTGTGTGGCCAGCAGGAGGAAGG + Intronic
1070757352 10:79001641-79001663 CAGTGTCCCCAGCAGGCAGGAGG + Intergenic
1070766714 10:79061006-79061028 CTGTGTCCACAGGAGGAAGGGGG + Intergenic
1071560624 10:86644591-86644613 CTGTGTCCCCAGCAGGGGACAGG - Intergenic
1072957120 10:99897036-99897058 CTGTGTCACCCGCATTAGGATGG - Intronic
1073329094 10:102659342-102659364 CTCTGTGACAAGCAGCAGGGAGG - Intergenic
1073420479 10:103420216-103420238 CTGTGTGACCATCTGGAGGAAGG + Intronic
1074833016 10:117263160-117263182 CTGTGTCAGCACCAGCAGGAGGG + Intronic
1075925432 10:126248052-126248074 CTGTGCCACCAGCAGGTGCAGGG - Intronic
1076066812 10:127455268-127455290 CAGTGTCACTAGCTGGAGAGGGG + Intergenic
1076361863 10:129895224-129895246 CTGCCTCACCAGCAGGAGTTTGG + Intronic
1076666988 10:132098859-132098881 CTGTCTCTCCAGGAGGAAGGAGG - Intergenic
1077375461 11:2203459-2203481 CTCTGTCAGCTGCAGGCGGGTGG + Intergenic
1077991262 11:7414423-7414445 TTCTGCCACCAGCAGGAGGCTGG + Intronic
1080393655 11:31871010-31871032 CTGTGTGGCCAGGAGGAGAGAGG + Intronic
1080443789 11:32318599-32318621 CTGAGTCAACAGCTGGAGGTAGG + Intergenic
1081164185 11:39786964-39786986 CTGTGGCACCAGCTGCAGTGGGG - Intergenic
1081380380 11:42407510-42407532 CAGCGCCACCAGCAGGAGAGTGG + Intergenic
1081664245 11:44907202-44907224 GTGGGTCACCAGCAGGTGGGTGG - Intronic
1081880300 11:46444489-46444511 CTGTCTGATCAGAAGGAGGGTGG - Intronic
1082723199 11:56704855-56704877 GTGAGTCTCCAGCACGAGGGTGG + Intergenic
1083181119 11:60986307-60986329 CAGTCTCACCAGCAGGAAGGTGG + Intronic
1083441409 11:62678956-62678978 GTGTGTGACGAGAAGGAGGGCGG + Exonic
1083882501 11:65555456-65555478 CAGTGTCTCCACCAGGAGGGAGG + Intronic
1084554105 11:69865554-69865576 CTGGGACACCAGCAGGGGAGGGG - Intergenic
1084741205 11:71140601-71140623 GGGTAGCACCAGCAGGAGGGTGG + Intronic
1085119404 11:73957555-73957577 CTGCGGCACCTGGAGGAGGGAGG - Intronic
1085296509 11:75434605-75434627 CTGAATTGCCAGCAGGAGGGTGG - Intergenic
1085353303 11:75814834-75814856 CGGTGTCACGTGCAGGAGGCGGG - Intergenic
1085842071 11:80023587-80023609 GTGTGTCATCAGGAGGAGGATGG - Intergenic
1087125972 11:94626069-94626091 CTGTGCAAGCAACAGGAGGGGGG - Intergenic
1087907532 11:103716521-103716543 AGGGGTCACCAGCAGGAGTGGGG - Intergenic
1088662237 11:112059322-112059344 ATGTGTCAGCAGCAGTAGGTTGG - Intronic
1089079882 11:115766725-115766747 CTGAGTCAGCAGATGGAGGGTGG - Intergenic
1089295763 11:117466670-117466692 CTGTCTCAACAAAAGGAGGGTGG + Intronic
1089608080 11:119653416-119653438 CAGTGTCCCCTGCAGGAGGGTGG + Intronic
1090477541 11:127037212-127037234 CTGTGACACAGGCAGGAGGCTGG - Intergenic
1091623193 12:2105436-2105458 CTGTGTCTGTAGCAGGATGGGGG + Intronic
1092285638 12:7127945-7127967 CAGTGTCACAGGCTGGAGGGTGG + Intronic
1092670212 12:10853735-10853757 CTGTGTCAGCAGCCACAGGGAGG - Intronic
1094440173 12:30466553-30466575 CTGTGTCTCCAGAAATAGGGAGG + Intergenic
1096589693 12:52649359-52649381 CAGTGTCTCAAGCAGGAGAGAGG - Intronic
1097670701 12:62534038-62534060 CTGTGTGACCAGTTGGAGTGAGG - Intronic
1098928764 12:76384543-76384565 CTATGTGACTACCAGGAGGGTGG - Intronic
1100953263 12:99876917-99876939 TAGTGTAACCAGCAGAAGGGTGG - Intronic
1102455884 12:113070514-113070536 CTGAGGGACCAGCAGGAGGAAGG + Intronic
1103188138 12:118979628-118979650 CTGAGTCACTTGCAGGAGAGAGG - Intergenic
1104110784 12:125702262-125702284 CTGTGTCCCCACCAGGTGGAGGG + Intergenic
1104803552 12:131570822-131570844 CTGTGGCTCCAGGAGGAGAGGGG - Intergenic
1105707977 13:22980596-22980618 CTGTGTCTCCTGGAGGAGGCTGG + Intergenic
1105847799 13:24308268-24308290 GGGTGTCCCCAGCAGGAGGTCGG + Intronic
1106229930 13:27813956-27813978 GTGTGTCAGGGGCAGGAGGGTGG - Intergenic
1110851049 13:80245387-80245409 CTCTGTCACCAACAGGATGAAGG + Intergenic
1110899313 13:80800617-80800639 CTCTGTCACCAGGATGAGGATGG + Intergenic
1111555206 13:89871836-89871858 CTTTGTCACCAGGACGAGGATGG - Intergenic
1111916402 13:94365095-94365117 CTATGTCACCTGCAGCTGGGAGG + Intronic
1113729023 13:112626404-112626426 CTGTGTGACTAGCAGGAGGAGGG - Intergenic
1113988741 13:114341286-114341308 GAGTGTCACCAGCATGAGAGGGG - Intergenic
1114051482 14:18922050-18922072 CTCAGTCACCAGCAGGAGGAGGG - Intergenic
1114111079 14:19479874-19479896 CTCAGTCACCAGCAGGAGGAGGG + Intergenic
1114631764 14:24163866-24163888 CTGTGTCCGCAGGAGGAGGAGGG + Exonic
1115085741 14:29512993-29513015 CTGTGAAAGCAGCTGGAGGGAGG - Intergenic
1116659110 14:47685068-47685090 GTGTGTCAGCAGCAGGTAGGGGG - Intergenic
1118753557 14:68822899-68822921 CTGTGACAGCAGCAGGGGGTGGG - Intergenic
1119265666 14:73262138-73262160 CTGTGGCACCAGCCGGGGGCAGG + Intronic
1121534568 14:94682291-94682313 CGCTGTCACCAGGAGGAGAGGGG + Intergenic
1122863104 14:104591377-104591399 CTGTGTCCCCAGCAGAAGGTGGG - Intronic
1128443034 15:67731259-67731281 CTGTGTCACCAGCAGGAAGAGGG - Intronic
1128895118 15:71366036-71366058 CTGGGACACAAGTAGGAGGGAGG - Intronic
1129195771 15:73965333-73965355 TTGTGCCACCAGCAAGGGGGAGG + Intergenic
1129795603 15:78374014-78374036 CTGTGTCAACATGAGGAGGGAGG - Intergenic
1130876075 15:88015650-88015672 CTGTCTCCCCAGCTGGAGTGTGG + Intronic
1131265234 15:90911627-90911649 CAGGGCCACAAGCAGGAGGGTGG - Intronic
1131841386 15:96441482-96441504 GTGTGACACGTGCAGGAGGGAGG + Intergenic
1132797443 16:1732166-1732188 CTGAGTCTCCAGCAGCGGGGAGG + Intronic
1133878880 16:9762241-9762263 CTGAGTCATCACCAGAAGGGAGG + Exonic
1133909089 16:10048745-10048767 CTGTGGCACCAGCCCAAGGGAGG - Intronic
1135398252 16:22147476-22147498 CTGGGGCATCAGGAGGAGGGAGG + Intronic
1135401888 16:22171773-22171795 CTTTGACAGCCGCAGGAGGGAGG - Intronic
1135690651 16:24534761-24534783 CTTTGTCAGCAACAGGAAGGAGG + Intergenic
1136519441 16:30786666-30786688 CTGTATCAGCAGCGGGACGGGGG - Intronic
1137265574 16:46866526-46866548 GAGTGTCACCAGCAAGATGGTGG + Intergenic
1139924440 16:70478465-70478487 CTCTGGCCCCAGCATGAGGGAGG + Intronic
1140388196 16:74561148-74561170 CTCTGACACCAGCAGGAGGAAGG - Intronic
1141096381 16:81165895-81165917 CAGTTTTCCCAGCAGGAGGGTGG + Intergenic
1141146193 16:81531778-81531800 CCATGTCACCACCAGGAAGGGGG + Intronic
1141422193 16:83924572-83924594 CTGTCTGAGCAGCAGGAGTGAGG - Exonic
1141698980 16:85633816-85633838 CGGTGTCAGCAGCAGCAGGCAGG - Intronic
1141797668 16:86286061-86286083 CTGGGTCACCAGGTTGAGGGTGG - Intergenic
1141883869 16:86878693-86878715 CTGTGTCCCAAGCAGGAGGCAGG - Intergenic
1142107785 16:88315602-88315624 CTGTGACCCCAGAAGGAGGGTGG + Intergenic
1142129439 16:88426003-88426025 CTCTGTCCCCAGCACGAGGTTGG - Intergenic
1142205208 16:88779677-88779699 CTGTGTGTGCAGCATGAGGGAGG + Intronic
1142960287 17:3548235-3548257 CTGTGTCACATTCAGGAGGGAGG + Intronic
1143306503 17:5951724-5951746 TTGTTTCTCCAGCAGTAGGGAGG - Intronic
1143405577 17:6675202-6675224 CTGGGTTACCAGCAGGAGTCAGG + Intergenic
1144137756 17:12314618-12314640 CAGTGGCAGCAGCAGGAGGGTGG + Intergenic
1144634249 17:16893972-16893994 CAGCGCCAGCAGCAGGAGGGCGG - Intergenic
1144677884 17:17173469-17173491 CTGGTTCACCTGCAGGAGGACGG + Intronic
1144744217 17:17602663-17602685 CTGTGCCCCAAGCTGGAGGGCGG - Intergenic
1145168363 17:20633867-20633889 CAGCGCCAGCAGCAGGAGGGCGG - Intergenic
1145193197 17:20866283-20866305 CTCAGGCACCAGCAGGAGGAGGG + Intronic
1145298819 17:21614804-21614826 CTCAGGCACCAGCAGGAGGAGGG - Intergenic
1145351462 17:22088489-22088511 CTCTGGCACCAGCAGGAGGAGGG + Intergenic
1145403620 17:22568288-22568310 CTCGGGCACCAGCAGGAGGAGGG + Intergenic
1145723300 17:27091542-27091564 CTCAGGCACCAGCAGGAGGAGGG - Intergenic
1147335464 17:39724793-39724815 CTGTGTCACCAGCTGCACCGTGG - Exonic
1147718059 17:42521385-42521407 CTGGCTCACCACCAGGAGGTGGG - Exonic
1147878598 17:43639360-43639382 TTGAGTTTCCAGCAGGAGGGTGG + Intergenic
1148803973 17:50254541-50254563 CTTTGTCACCAGCTGGAGTGTGG - Intergenic
1148846862 17:50534548-50534570 CTGAGTCACTAGCAAGGGGGAGG + Intronic
1149601787 17:57898197-57898219 CTGCATCCCCAGCAGGAGGCAGG - Intronic
1151342565 17:73481247-73481269 CTGTGTCCCTCGGAGGAGGGGGG + Intronic
1151989073 17:77562602-77562624 CGATGTCACCAGCAGCAGGTTGG - Intergenic
1151996437 17:77612216-77612238 CAGTGTTTCCAGAAGGAGGGCGG + Intergenic
1152039702 17:77894781-77894803 CTGCGCCAGGAGCAGGAGGGAGG + Intergenic
1152089566 17:78239248-78239270 CTGAGTCCCCAGCAGGTGGGAGG + Exonic
1152318907 17:79597047-79597069 ACGTGTGGCCAGCAGGAGGGAGG - Intergenic
1152351425 17:79785871-79785893 CTGGGACACAGGCAGGAGGGAGG - Exonic
1152383834 17:79957012-79957034 CTGTGGCCACAGCAGCAGGGAGG + Intronic
1152610606 17:81313481-81313503 CTGTGGCCTCTGCAGGAGGGAGG - Exonic
1152811372 17:82384285-82384307 CTGTGTCCCCGGCTGGGGGGTGG + Intergenic
1153819068 18:8817313-8817335 CTGTGTCATCATCAGGGAGGTGG + Intronic
1153979389 18:10296420-10296442 CGGTGTCAGCAGCAGGAGAAAGG - Intergenic
1155019412 18:21881289-21881311 CTGTGTCACAGGCTGGAGCGCGG - Intergenic
1155209095 18:23586001-23586023 ATGTGGCACCAGAAGAAGGGAGG - Intronic
1155784898 18:29884015-29884037 CTGTGTCAGCAGCATGTGGCTGG + Intergenic
1157401864 18:47395453-47395475 CTGTGTTCCCAGCAGGAGGAAGG + Intergenic
1157776934 18:50403202-50403224 CTCTCTCAGCAGGAGGAGGGGGG - Intergenic
1158403204 18:57139585-57139607 CTGTGTCACCAACAGCAGGCGGG + Intergenic
1160684087 19:425381-425403 CTGTGGCACCTGCAGACGGGCGG - Intronic
1160891500 19:1381005-1381027 CTGTGTGACCAACAGAATGGCGG - Intergenic
1161003769 19:1924423-1924445 CTGTGGCCCTGGCAGGAGGGGGG - Exonic
1161267180 19:3369752-3369774 CGGTGGCGCCAGCGGGAGGGAGG - Intronic
1161619435 19:5290563-5290585 CTGTGTCACCCGCACGAGGCGGG + Intronic
1161854960 19:6759022-6759044 CTGTGTGACCAGCATGAGGAGGG + Intronic
1161957151 19:7502556-7502578 CAGTTTCAGCATCAGGAGGGTGG + Intronic
1162556695 19:11391148-11391170 CATTCCCACCAGCAGGAGGGAGG + Intronic
1162836284 19:13320303-13320325 GTGTGGCTCCAGCAGGAGTGGGG - Intronic
1162916011 19:13874802-13874824 CAGAGTCACCGGCAGGAGGATGG - Intronic
1163023193 19:14494921-14494943 CAGTGTGGCCAGCAGGAGGAGGG + Intronic
1163370730 19:16899843-16899865 CTGAGACACCAGCAGGCGGCAGG - Intronic
1163393681 19:17046169-17046191 CTGGGACCCCAGCAGGTGGGGGG - Intergenic
1163621549 19:18363796-18363818 CTGTGTCCCCAGATGCAGGGAGG - Exonic
1164399043 19:27890333-27890355 CTGTGTCCCCAGCAGGAATGAGG + Intergenic
1165272772 19:34724775-34724797 CTCTCTCAGCAGGAGGAGGGGGG - Intergenic
1165870428 19:38968447-38968469 CTGTCTCCCAAGCTGGAGGGTGG - Intronic
1166256069 19:41605755-41605777 CCCTGCCACCACCAGGAGGGTGG + Intronic
1166541831 19:43610843-43610865 CTGGGGACCCAGCAGGAGGGTGG - Intronic
1166785051 19:45362675-45362697 CTGTGTCCCCAGCATGAAGCAGG + Intronic
1166841230 19:45698524-45698546 CTGTGGGAGCAGCAGGGGGGTGG - Intronic
1166858428 19:45795128-45795150 CTGTGTCCCCAGCACAGGGGTGG + Intergenic
1166881900 19:45934942-45934964 CTGTGTGTCCGGCAGGGGGGAGG - Exonic
1167056322 19:47113200-47113222 CCGTGTCACGTGCAGGAGAGGGG + Intronic
1168241393 19:55090887-55090909 CTGTGTTCCCAGCCAGAGGGAGG - Intergenic
1168309397 19:55452898-55452920 CGGGGTCCCCAGCAGGTGGGGGG - Intergenic
925018931 2:553581-553603 CTGTGTTCCCAGGAGGAGGTCGG + Intergenic
925018979 2:553711-553733 CTGTGCCCCCAGGAGGAGGTGGG + Intergenic
925018993 2:553742-553764 CTGTGCCCCCAGGAGGAGGTGGG + Intergenic
925019004 2:553772-553794 CTGTGCCCCCAGGAGGAGGTGGG + Intergenic
925182625 2:1827000-1827022 CTGGGGCACCAGCAGGGGTGGGG - Intronic
925261221 2:2530193-2530215 CTGTGGCACCTGCCAGAGGGAGG - Intergenic
925824282 2:7832303-7832325 CTGTGTTACCAGAAGGAGCATGG + Intergenic
925852028 2:8091137-8091159 CTGTGTAGCCAGAATGAGGGAGG - Intergenic
925896523 2:8476539-8476561 CTGTGCCAACAGCAGGAATGAGG + Intergenic
926806059 2:16712297-16712319 TTGTGTCTCCAGGAGGTGGGTGG + Intergenic
926816287 2:16800992-16801014 CTGTGTCTCCAGCATGGAGGAGG - Intergenic
929054690 2:37865841-37865863 CTGGGGCCCCAGCTGGAGGGAGG + Intergenic
929591033 2:43146356-43146378 CTGTGTCTCCACCAGGTGGTGGG + Intergenic
929792009 2:45030140-45030162 CTTTGTCACCTATAGGAGGGTGG + Intergenic
929828943 2:45332073-45332095 CTGTAACACCAGGAGGAGGAAGG + Intergenic
929920920 2:46171072-46171094 CTGTGTCTCCAGCTGGAAGTGGG - Intronic
931251691 2:60536683-60536705 CGGTGTTGCCAGCAGGGGGGTGG - Intronic
932343716 2:70982347-70982369 CTGGCTCCTCAGCAGGAGGGTGG + Intronic
932729648 2:74209671-74209693 CTGTAATCCCAGCAGGAGGGAGG - Intronic
932892971 2:75611933-75611955 CTGTCCCAGCAGCAGTAGGGAGG - Intergenic
935147955 2:100409060-100409082 GCGCGTCACCTGCAGGAGGGAGG - Intronic
937159070 2:119742952-119742974 ATGTGTCACCATCATGATGGTGG + Intergenic
937587039 2:123565218-123565240 CTGTAGCACCAGCACTAGGGGGG + Intergenic
938291017 2:130150578-130150600 CTGGGGCACAAGGAGGAGGGAGG - Intergenic
938465527 2:131522378-131522400 CTGGGGCACAAGGAGGAGGGAGG + Intergenic
939623029 2:144444478-144444500 GTGTGTCACCAGCTGGGGGTCGG + Intronic
940362732 2:152813474-152813496 CAGTGGCAGCTGCAGGAGGGAGG + Intergenic
944382787 2:199130974-199130996 CTTTGCCACCAGCATGTGGGTGG - Intergenic
944490856 2:200256436-200256458 CTGTGTCACATGGAGGAGGTGGG - Intergenic
946416985 2:219544632-219544654 CTGGGTCCCCACCAGGATGGGGG - Intronic
947991278 2:234489435-234489457 TTCTGTCATCAGCATGAGGGTGG + Intergenic
948317499 2:237039569-237039591 CTCTGTCCCAGGCAGGAGGGAGG + Intergenic
1169235164 20:3924803-3924825 CTGTGGTACAAGCAGGAGGATGG - Intronic
1169268272 20:4180871-4180893 CTGTCTCCCCAGCTGGAGTGAGG + Intronic
1170263021 20:14433063-14433085 GTGTGTCACCATCAGCAGGTAGG + Intronic
1171412212 20:24955268-24955290 CAGTGTTACCATCAGGAAGGAGG - Intronic
1172027039 20:31955579-31955601 TTGTGTGAGCAGCAGCAGGGAGG - Intergenic
1172390018 20:34559765-34559787 CTGGTTCACCAGCAGGAAGAAGG - Exonic
1172599877 20:36176263-36176285 CTGTGTCACCACCATGGGGCAGG - Intronic
1172730394 20:37082211-37082233 CTGTATCATCACCAGCAGGGGGG - Intronic
1173289087 20:41698702-41698724 CTGTGTCACCAGCAGAATGCAGG + Intergenic
1174393603 20:50233049-50233071 CTCTGTCCCCTGCAGGAGGCAGG - Intergenic
1174457950 20:50662716-50662738 CCGTGTCACCAGCCAGAGAGTGG - Intronic
1174558352 20:51412561-51412583 CTGTAACCACAGCAGGAGGGAGG + Intronic
1175051945 20:56163943-56163965 CTGTGTCACCAGATGGTGGAGGG - Intergenic
1175786822 20:61717195-61717217 CTGTGACAGCAGCAGCAGTGGGG - Intronic
1176089435 20:63312403-63312425 CTCTGTCTGCAGCAGGTGGGAGG - Exonic
1176145556 20:63563846-63563868 CGGGGCCACCAGCAGCAGGGCGG - Exonic
1176179400 20:63742321-63742343 CTGTGTCTCCCGCAGGAGGCAGG + Exonic
1176233775 20:64044905-64044927 CTGACTCAGCAGGAGGAGGGTGG + Intronic
1176293134 21:5056624-5056646 CTGTGTCCCCTGCAGGAACGTGG - Intergenic
1176365854 21:6032381-6032403 CTAAGTCACGAGCAGGAGGCAGG + Intergenic
1178785464 21:35649348-35649370 CTGAGTCACCACCTGGAGGAGGG + Intronic
1178884600 21:36475380-36475402 CTGCGGCTACAGCAGGAGGGTGG - Intronic
1179166200 21:38937118-38937140 CTGTGGCACCAGCCTGATGGGGG - Intergenic
1179757662 21:43506164-43506186 CTAAGTCACGAGCAGGAGGCAGG - Intergenic
1179864126 21:44207026-44207048 CTGTGTCCCCTGCAGGAACGTGG + Intergenic
1180228870 21:46414455-46414477 CTGTGTGTCCAGGAGGAGGAGGG - Intronic
1180228949 21:46414761-46414783 CTGTGTGTCCAGGAGGAGGGTGG - Intronic
1180228973 21:46414857-46414879 CTGTGTGTCCAGCAGGAGGAGGG - Intronic
1180469955 22:15644426-15644448 CTCAGTCACCAGCAGGAGGAGGG - Intergenic
1181275368 22:21684681-21684703 CTGTGTCCCCAGCACGTGTGTGG + Intronic
1181622621 22:24101390-24101412 TTGTGTCACCTGCATTAGGGTGG + Intronic
1181683110 22:24509571-24509593 CCTTGTCACTAGGAGGAGGGGGG + Intronic
1181684093 22:24516579-24516601 CAGTGTCCCCAGCAGGACAGGGG + Intronic
1184345528 22:43910355-43910377 CTGCTTCACCACCAGGAGGCTGG + Intergenic
1184669470 22:46005298-46005320 CAATGTCACCATCAGAAGGGTGG - Intergenic
1184677445 22:46051385-46051407 CTGTCCCATGAGCAGGAGGGTGG + Exonic
1184751520 22:46489062-46489084 CTGGGTGACCAGCAGGAAGGTGG - Intronic
1185182941 22:49373437-49373459 CTGTGGCAGCAGCATGAGGCTGG - Intergenic
1185330593 22:50250552-50250574 CAGGGTCACCAGCAGGAGCAGGG + Intronic
1185342247 22:50296865-50296887 CAGTGACACCAGCAGGGGGGCGG + Intronic
949894612 3:8759972-8759994 CTGTCTCACCTGGAGGAGGCGGG - Intronic
950491135 3:13305743-13305765 CTCTGCCCTCAGCAGGAGGGAGG - Intergenic
951462037 3:22961621-22961643 CTGTGTCAGCAACATGAGCGTGG - Intergenic
952493795 3:33898197-33898219 CTTTCCCACCAGCAGGAAGGAGG + Intergenic
953176164 3:40554504-40554526 CTGTCTCCCCAGCTGGAGTGTGG + Intronic
953576982 3:44120758-44120780 CTGTGTGAGCAGCAGCAGGAAGG - Intergenic
953876465 3:46669617-46669639 CTGTGACACCCCCAGGAAGGGGG - Exonic
953956437 3:47235477-47235499 CTATGTCTCCAGGAGGATGGGGG - Intronic
954608888 3:51933893-51933915 CTGTGTCACCAGGTGGCAGGAGG - Intronic
955369179 3:58336283-58336305 CTGAGTCACCAGAAGGATGAAGG + Intronic
955509154 3:59662100-59662122 ATGTGTGATGAGCAGGAGGGAGG + Intergenic
959950670 3:112176258-112176280 CTGTGTCACTCCCAGGTGGGTGG + Intronic
962350723 3:134653736-134653758 TTGTGTGAGCAGCTGGAGGGAGG - Intronic
962423569 3:135249458-135249480 CTGGGTGACCAGCTGGAGGGAGG - Exonic
962695701 3:137945230-137945252 ATGTGTGACCAACAGGATGGAGG + Intergenic
963781998 3:149495694-149495716 CTGTGTGACTAGCAGCAGAGGGG - Intronic
963931939 3:151012564-151012586 CTTTGTCACCAGCCTAAGGGAGG - Intergenic
964507313 3:157413564-157413586 CTGTGTCACCTGAAGAAGGAGGG - Intronic
968689443 4:1983189-1983211 CTGGGTCAGCAGCAGGGCGGCGG + Exonic
968905040 4:3447081-3447103 CTCTGTGCCCAGCAGGAGTGAGG + Intronic
969060656 4:4431730-4431752 GTGGGTCATCAGGAGGAGGGAGG - Intronic
969234222 4:5853938-5853960 CTGGGTCACCAGCAGGCGAATGG - Intronic
969497611 4:7535027-7535049 GTGTGTCAGCAGGAGGAGGAGGG - Intronic
969883684 4:10196638-10196660 CTCTGTCAGCAGAAGGTGGGGGG + Intergenic
970408099 4:15782867-15782889 CTGTGTGACAGGCAGGAGAGGGG - Intronic
970427986 4:15963094-15963116 CAAGGTCACCAGCAGGAGGCAGG + Exonic
971418782 4:26456860-26456882 CGTTGTCACCAGCTCGAGGGAGG + Intergenic
973321569 4:48816101-48816123 CTGTGTGACTAGCAGGAAGAAGG - Intronic
973386296 4:49516351-49516373 CAGTGTCACCGCCAGGAAGGAGG - Intergenic
981594020 4:146398905-146398927 CTGTGTAAGCAGCAGGAGAACGG + Intronic
984592755 4:181635141-181635163 CTGCATCAGCAGCAGAAGGGAGG + Intergenic
985668787 5:1195874-1195896 CTGTGTCCCCAGGGGGTGGGAGG - Intergenic
985702827 5:1383808-1383830 GGGTGTCACCAACAGGAGGTGGG + Intergenic
985843485 5:2327154-2327176 TTCAGTCAGCAGCAGGAGGGTGG + Intergenic
985915665 5:2917274-2917296 CCGTGGCACCAGCAGGGGAGAGG + Intergenic
990330212 5:54718581-54718603 GTGTGTGAACATCAGGAGGGGGG - Intergenic
993748476 5:91633025-91633047 CTGTGTCAACAGAAGGAAAGTGG + Intergenic
994747254 5:103693634-103693656 CTCTATCACCACCAGGAAGGAGG - Intergenic
997634883 5:135398184-135398206 CTGTGGCCCCTGCAGGAGTGGGG + Intronic
997655775 5:135553214-135553236 CTGAGTCACTAGGAGGTGGGTGG + Intergenic
997749501 5:136330732-136330754 CTAAGTCACCAGCAGGTGTGTGG + Intronic
998172462 5:139880726-139880748 ATATGGCAGCAGCAGGAGGGAGG + Intronic
998443170 5:142178965-142178987 CTCAGGCACCAGCAGGAGAGGGG - Intergenic
999209766 5:149877745-149877767 CTGTGACACCACCAGTATGGTGG + Intronic
999498038 5:152119442-152119464 CTGTGTCAGGAGCAGGTGGAGGG + Intergenic
1000464234 5:161555394-161555416 CTGCTTCACCAGCAGGAGTAAGG - Intronic
1001328063 5:170744030-170744052 TTGTGTGAACAGCAGGGGGGAGG - Intergenic
1002755512 6:156063-156085 GAGTGTCTCCAGCAGGAGAGGGG + Intergenic
1002802126 6:533669-533691 TTGTCTCACCAGCAGGCAGGAGG + Intronic
1003504095 6:6725546-6725568 CTGGGTCACCAGAGGCAGGGAGG + Intergenic
1004993105 6:21161087-21161109 GGGTGTCACCAGCAACAGGGTGG - Intronic
1005726611 6:28655378-28655400 CTGAGTCTCCTGCAGGAGGCTGG + Intergenic
1007337391 6:41163331-41163353 GGCTGGCACCAGCAGGAGGGTGG - Intergenic
1009403690 6:63287434-63287456 CTGTAATACCAGCAGGAGTGAGG + Intronic
1011626530 6:89287698-89287720 CTGAGTCCCCAGCTAGAGGGAGG + Intronic
1012645347 6:101672147-101672169 TTGTGTCATCAGTGGGAGGGAGG - Intronic
1014558231 6:122859193-122859215 CAGTGTCAGCAGCAAGGGGGAGG - Intergenic
1014952796 6:127578075-127578097 CTGTGTCATCAGCAGGGAGTGGG - Intronic
1015281991 6:131443636-131443658 CTGTCTCTCCAGGAGGAGAGTGG - Intergenic
1015414262 6:132930881-132930903 CTGTCTGAGCAGCAGGAGGGAGG + Intergenic
1015928719 6:138335197-138335219 CTGTGGCCACAGCAGGTGGGCGG + Intronic
1016166061 6:140945122-140945144 CTGTGAAAGCAGCAGGAGGAAGG + Intergenic
1016997316 6:149969769-149969791 CTTTCTCCACAGCAGGAGGGTGG + Intronic
1018197915 6:161370994-161371016 CTTACTCACCAGCAGGAGGCGGG - Intronic
1018733424 6:166669881-166669903 CTATCACACCTGCAGGAGGGTGG - Intronic
1018951730 6:168382775-168382797 CTGTGTCCACAGCTGGATGGGGG - Intergenic
1018956499 6:168413619-168413641 CTGCTTGTCCAGCAGGAGGGAGG + Intergenic
1019660186 7:2219775-2219797 CTGGAGCACCAGGAGGAGGGTGG - Intronic
1019702530 7:2480845-2480867 CTGTGTGCCACGCAGGAGGGCGG - Intergenic
1019783369 7:2958056-2958078 CTGTGACACCAGCCGGAGCTTGG - Intronic
1020180033 7:5915104-5915126 CCGTGACAGCAGGAGGAGGGAGG + Intronic
1020264170 7:6549333-6549355 CTGAGTCACCTGCAGGAAGTAGG - Intronic
1020302901 7:6809778-6809800 CCGTGACAGCAGGAGGAGGGAGG - Intronic
1020573122 7:9890891-9890913 CTGGGTCACCTGGAGGTGGGTGG - Intergenic
1021970873 7:25964805-25964827 CTGCCTCACCAGCAGCAAGGCGG + Intergenic
1022200484 7:28112110-28112132 ATCTGTCACCAGCAGGGGAGAGG - Intronic
1022247592 7:28575568-28575590 CGCTGTCTCCAGCAGGAAGGAGG - Intronic
1022471988 7:30687744-30687766 CTGTGCCACCTGCTGGAGGGAGG + Intronic
1023847208 7:44129082-44129104 GTGTGTTGGCAGCAGGAGGGAGG + Intergenic
1024017203 7:45327966-45327988 CTGTGTCACCACACTGAGGGAGG - Intergenic
1024061324 7:45700694-45700716 CTGTGTCACTTGCAGGAGGGAGG + Intronic
1024921657 7:54563509-54563531 CAGTGTCCCCAGCAGGAGGAAGG + Intronic
1031024352 7:116663878-116663900 CAAGGTCACCATCAGGAGGGAGG + Intergenic
1031535887 7:122932402-122932424 CTGTCCCCCCAGCAGCAGGGTGG + Intergenic
1033344903 7:140519090-140519112 CTGTGCCTCCTGCAGGACGGAGG - Intronic
1034262030 7:149763257-149763279 GTGTGTGCCCAGCAGGAAGGAGG - Intergenic
1035112184 7:156492341-156492363 TTGTGTCCCCAGCAGGACGCAGG + Intergenic
1035306320 7:157935172-157935194 CTTTTTCACCAGGTGGAGGGTGG + Intronic
1035710510 8:1709882-1709904 TTGTGTTTCCAGCAGGTGGGGGG + Intergenic
1037606363 8:20441006-20441028 CTGTGCCCCCAGCACGTGGGAGG - Intergenic
1037842548 8:22255682-22255704 CTCTGCCACAATCAGGAGGGTGG + Intergenic
1037916047 8:22774056-22774078 CTGTGAAACCAGCAGGAGGGAGG - Intronic
1038214737 8:25551149-25551171 CTGTGACAGCAGTAGGAGGTGGG - Intergenic
1038670015 8:29575346-29575368 CTGAAACACCAGCAGGAGGAAGG - Intergenic
1039100960 8:33941650-33941672 CTGTGTCCCCAGAATGAGTGGGG - Intergenic
1039971761 8:42326460-42326482 CAGTGGCACCGGGAGGAGGGTGG - Intronic
1042815576 8:72874729-72874751 TTGTGTCAGGAGCAGGAGGAGGG + Intronic
1045519026 8:102887098-102887120 CTGTGGCAGCAGCTGGAGGAAGG - Intronic
1046932491 8:119855620-119855642 CTGTGCCAGCAGCTGGAGGATGG - Exonic
1047624774 8:126645448-126645470 CAGTTTCTCCAGCAGGAGTGTGG + Intergenic
1048169167 8:132088933-132088955 CTGTTTTAAAAGCAGGAGGGAGG - Intronic
1049098116 8:140560692-140560714 CTGTGACAGCAGCAGGCTGGGGG + Intronic
1049613591 8:143567063-143567085 CTCTGTCACCATCAGGGTGGTGG + Exonic
1049681099 8:143918640-143918662 CTGTGCCTCCAGCAGCAGGCGGG + Exonic
1049698105 8:143993476-143993498 CTGTGTCTCCATCAGCAGGGAGG - Intronic
1051680051 9:19597939-19597961 CTATGTAAACAGCAGGAGGCAGG + Intronic
1056450915 9:86716013-86716035 CTGTGTCTCCAGCAGGACTGTGG - Intergenic
1056574319 9:87843338-87843360 CTGTGGCCCCAGGAGGTGGGTGG - Intergenic
1056731061 9:89167104-89167126 CTGGGGGTCCAGCAGGAGGGAGG + Intronic
1056810221 9:89758061-89758083 CAGTGTCACCAGCAAGGGTGTGG - Intergenic
1058743637 9:107968446-107968468 CTGTGTGTCCAGTTGGAGGGAGG + Intergenic
1059210567 9:112511088-112511110 CTGTTTCCTCAGCAAGAGGGAGG + Intronic
1060727499 9:126016175-126016197 CTGTGTCAACCTCAGTAGGGTGG - Intergenic
1060947561 9:127579144-127579166 CTGAGTCACCAGCTGGTGAGGGG - Intergenic
1060994430 9:127868101-127868123 CTGAGTCACCAGGTGGAGTGGGG + Intronic
1061513253 9:131073449-131073471 CAGTGTCACCAGCATGGGGAGGG + Intronic
1062020172 9:134315680-134315702 CTGAGTCCCCAGAAGAAGGGAGG - Intergenic
1062023662 9:134330640-134330662 CTTTGTTACCTGCAGGATGGAGG + Intronic
1062098723 9:134716766-134716788 CTGTGTCTCCAACATGGGGGTGG - Intronic
1062580199 9:137226009-137226031 CTGTGGCAGCGGCAGAAGGGGGG - Exonic
1186457075 X:9718132-9718154 CTGGGTCACCAGCAGTGGGTAGG + Exonic
1187240174 X:17505769-17505791 CTGTCTCTCCAGCAGGGGTGAGG + Intronic
1189240201 X:39518994-39519016 CTGTGTCACGGGCAGGAGGTCGG - Intergenic
1190327163 X:49213694-49213716 CTGAGTCTCCAGGAGTAGGGAGG + Intronic
1190512982 X:51192942-51192964 CTGTGTTACCAATAGGAGTGGGG - Intergenic
1194564961 X:95474127-95474149 CAGTGTCAACTGCAGGAGAGAGG - Intergenic
1195940005 X:110160064-110160086 TTGTGTCACCAGCTGTAGGCAGG - Intronic
1199988323 X:152968583-152968605 CTGGGCCAGCAGCAGGATGGTGG + Intronic