ID: 900386223

View in Genome Browser
Species Human (GRCh38)
Location 1:2412267-2412289
Sequence CCGGGTCCCAGGTTGTGGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 203}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900386208_900386223 20 Left 900386208 1:2412224-2412246 CCCGCACATCCCTGAATGGCCGC 0: 1
1: 0
2: 1
3: 9
4: 110
Right 900386223 1:2412267-2412289 CCGGGTCCCAGGTTGTGGGACGG 0: 1
1: 0
2: 0
3: 18
4: 203
900386214_900386223 10 Left 900386214 1:2412234-2412256 CCTGAATGGCCGCAGGGCAGGCG 0: 1
1: 0
2: 1
3: 7
4: 89
Right 900386223 1:2412267-2412289 CCGGGTCCCAGGTTGTGGGACGG 0: 1
1: 0
2: 0
3: 18
4: 203
900386216_900386223 1 Left 900386216 1:2412243-2412265 CCGCAGGGCAGGCGAAGGAGACT 0: 1
1: 0
2: 0
3: 19
4: 215
Right 900386223 1:2412267-2412289 CCGGGTCCCAGGTTGTGGGACGG 0: 1
1: 0
2: 0
3: 18
4: 203
900386207_900386223 21 Left 900386207 1:2412223-2412245 CCCCGCACATCCCTGAATGGCCG 0: 1
1: 0
2: 0
3: 3
4: 56
Right 900386223 1:2412267-2412289 CCGGGTCCCAGGTTGTGGGACGG 0: 1
1: 0
2: 0
3: 18
4: 203
900386213_900386223 11 Left 900386213 1:2412233-2412255 CCCTGAATGGCCGCAGGGCAGGC 0: 1
1: 0
2: 1
3: 11
4: 127
Right 900386223 1:2412267-2412289 CCGGGTCCCAGGTTGTGGGACGG 0: 1
1: 0
2: 0
3: 18
4: 203
900386209_900386223 19 Left 900386209 1:2412225-2412247 CCGCACATCCCTGAATGGCCGCA 0: 1
1: 0
2: 1
3: 11
4: 131
Right 900386223 1:2412267-2412289 CCGGGTCCCAGGTTGTGGGACGG 0: 1
1: 0
2: 0
3: 18
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900386223 Original CRISPR CCGGGTCCCAGGTTGTGGGA CGG Intronic
900207644 1:1438406-1438428 CCGGGTCTGAGGGTGGGGGATGG + Intronic
900386223 1:2412267-2412289 CCGGGTCCCAGGTTGTGGGACGG + Intronic
901662053 1:10804650-10804672 CCAGGTCCCTGGATGTGGGTGGG + Intergenic
902503425 1:16925045-16925067 GGGGGTCCCAGGGTGTGGGGCGG + Intronic
903295341 1:22339854-22339876 GGGGGTTTCAGGTTGTGGGAAGG - Intergenic
904415955 1:30361377-30361399 CCAGGGCCCAGGTTCTGGGTGGG + Intergenic
906296655 1:44652878-44652900 CTGAGTCCAAGCTTGTGGGAGGG - Intronic
907273521 1:53304474-53304496 TCTGGTCCCATGTTCTGGGAAGG + Intronic
908179957 1:61593785-61593807 TCAGGGCCCAGGCTGTGGGAGGG - Intergenic
908686303 1:66723798-66723820 CTGGGTCATAGGTTCTGGGAAGG - Intronic
913582847 1:120244290-120244312 TCGGGTGCCACATTGTGGGAGGG + Intergenic
913625325 1:120654070-120654092 TCGGGTGCCACATTGTGGGAGGG - Intergenic
914564778 1:148855786-148855808 TCGGGTGCCACATTGTGGGAGGG + Intronic
914608048 1:149274456-149274478 TCGGGTGCCACATTGTGGGAGGG - Intergenic
915690986 1:157690475-157690497 CCGGGGCCCAGGCTGTGGTGGGG - Exonic
915942238 1:160125675-160125697 CAGGGCCCCAGGGTCTGGGAGGG + Intronic
1064022947 10:11823821-11823843 AGGGGTCCCGGGTTGGGGGACGG - Intronic
1064902382 10:20309361-20309383 CTGGGTCCCAGGATGTGGAGAGG + Intergenic
1067138384 10:43632239-43632261 TGGGGTCCCAGGTAGTTGGAAGG + Intergenic
1070768969 10:79071243-79071265 CCGGTTCCCAGGTTGCAGCAGGG - Intronic
1071565365 10:86668794-86668816 TCGGGTGCCAGGCTGTGGCAGGG - Intronic
1074086369 10:110210984-110211006 CCGGGTCCCTGGTTTCTGGAAGG + Intronic
1074121789 10:110498570-110498592 CCCGGTCCCAGGGTGTAGGAGGG - Intronic
1075617958 10:123905221-123905243 CCGGCTCCCAGGCTGTGTGGCGG - Intronic
1075679275 10:124320968-124320990 CCGGGTCCCTGCTTGTCTGAAGG + Intergenic
1076797539 10:132805577-132805599 TCGGGTCCCAGGTGGTGGAGGGG - Intergenic
1077549730 11:3194670-3194692 CCTGGTCCCAGGATGTGGGTGGG + Intergenic
1081014516 11:37859330-37859352 ACGGGTGTCAGGTTGGGGGATGG - Intergenic
1081487528 11:43543372-43543394 CTTGGTCCCAGGATGTGGGCCGG - Intergenic
1083621695 11:64052465-64052487 CCTGGGCCAAGCTTGTGGGAAGG + Intronic
1085255275 11:75169207-75169229 CTGGGGCCGAGGTTGTGGGCAGG - Exonic
1085393582 11:76194837-76194859 CCGGGTCCCTGAGGGTGGGAGGG + Exonic
1085455333 11:76662208-76662230 CCGGGCCCCTGGAGGTGGGAAGG + Intronic
1085854212 11:80157875-80157897 TGGGGTCCCAAGTTGTGGGTGGG - Intergenic
1091740981 12:2960020-2960042 ACCGGTCCCAGGGTGCGGGAAGG - Exonic
1091796785 12:3301867-3301889 CTGGGTCTCAGGTTGTTGTATGG + Intergenic
1092094244 12:5828266-5828288 CCGGGCTCCAGGCTGGGGGAGGG - Intronic
1095734882 12:45545895-45545917 TGGGGTCTCAGGGTGTGGGAAGG - Intergenic
1097169388 12:57104425-57104447 CGGGGTCCCAGATTGGGGCAGGG + Intronic
1103627031 12:122227124-122227146 CAGGGTGCCAGGTGGTGGGTGGG + Intronic
1105719608 13:23100828-23100850 ACGGTACCCAGGCTGTGGGATGG + Intergenic
1108609608 13:52071216-52071238 AGGGGTCCCAGGTTGGGGGTGGG + Intronic
1108619485 13:52167192-52167214 CCTGGTCCCAGGTAGTGGCATGG + Intergenic
1108640232 13:52376647-52376669 CCTGGTCCCAGGTAGTGGCATGG + Intergenic
1109889976 13:68598671-68598693 CAAAGTCCCAGGTTCTGGGAAGG + Intergenic
1111951205 13:94711116-94711138 CCGGGCCCCCGGTCGCGGGAGGG + Exonic
1112973202 13:105285884-105285906 ATGGTTCCCAGGTTGAGGGAAGG + Intergenic
1113670151 13:112170753-112170775 CTCAGTCCCAGGTTGGGGGATGG - Intergenic
1113770072 13:112902500-112902522 CCAGGTAGCAGGCTGTGGGAGGG + Intronic
1114282276 14:21204130-21204152 CCCGTCCCCAGGTTGAGGGAGGG - Intergenic
1114530708 14:23393990-23394012 CCCAGTCCCTGGTTGTGAGATGG + Intronic
1114542999 14:23477125-23477147 CTTGGGCCCAGGTTGTGGGCTGG + Intronic
1115566530 14:34629832-34629854 CTGGGTCCCCGGGTGTGGTACGG - Intronic
1115650729 14:35401333-35401355 CCTGGGCCCAGTGTGTGGGAGGG - Intergenic
1122580900 14:102771021-102771043 CAGGGTCACAGGCTGCGGGACGG - Intergenic
1122783424 14:104153344-104153366 CCGGGTCCCAGCTGGTGTGATGG + Intronic
1122882055 14:104694672-104694694 CCAGGGCCCAGGGTGGGGGACGG - Intronic
1123684434 15:22786943-22786965 CCCGGGCCCAGGTTGGGGGAAGG + Intronic
1125579828 15:40777134-40777156 CCGGGTCCTGGATTGTGTGAGGG + Intronic
1127846986 15:62878511-62878533 CAGGGTCCCAGGTTGGGAGAAGG + Intergenic
1128452173 15:67811977-67811999 CCAAGTCCCAGGGTGAGGGAGGG + Intergenic
1129229247 15:74187648-74187670 CTGGAGCCCAGGTTGCGGGATGG + Intronic
1131827491 15:96332567-96332589 CCGGGACCCAGGACGAGGGAAGG - Intronic
1132238674 15:100240650-100240672 CTGGGTGGCAGATTGTGGGAAGG - Intronic
1132603724 16:785029-785051 CAGGAGCCCAGGTTGTGGCATGG + Exonic
1132607798 16:800779-800801 CCAGGGCCCAGGTGGCGGGAGGG - Intergenic
1133997820 16:10761774-10761796 CCGCGCCCCCGGTTGTGGGAGGG - Exonic
1135412620 16:22246617-22246639 CCCAGTACCAGGTTGTGTGATGG - Intronic
1136933385 16:34437425-34437447 CAGGGTCTCAGGATGTGGCAGGG + Intergenic
1136971187 16:34974389-34974411 CAGGGTCTCAGGATGTGGCAGGG - Intergenic
1137314085 16:47298872-47298894 CAGTGTCCCAGGTGGTGGGTTGG + Intronic
1139544755 16:67645028-67645050 CCGGGAGCGGGGTTGTGGGAGGG - Exonic
1142145320 16:88490651-88490673 CCGGCTGCCCTGTTGTGGGAAGG - Intronic
1142944484 17:3412842-3412864 CAGGGTGCAAGGTTGTGGCAGGG - Intergenic
1143159345 17:4858978-4859000 CCGGGTGCCTGGTGTTGGGAGGG - Intronic
1143482914 17:7237880-7237902 CCGGGCCTCCGGTTGGGGGAAGG - Intronic
1144850621 17:18242257-18242279 CCAGGTCCCATGCTGTGGGCTGG - Exonic
1147000486 17:37358964-37358986 CCCGGTCACAGGTTCTGGGCCGG + Intronic
1147142287 17:38466489-38466511 CCGGCTGCCAGGCTCTGGGAAGG - Exonic
1147644494 17:42025724-42025746 CAGGGTCCCATATTGTGGGGTGG + Intronic
1148142619 17:45339184-45339206 CCGGAGCCCAGGGTGTTGGAGGG + Intergenic
1148736673 17:49869147-49869169 CCGAGGCCCAGTTTCTGGGAGGG - Intergenic
1148908432 17:50926556-50926578 CTGGGCCCCAGGATGTGGGCTGG + Intergenic
1149506025 17:57194699-57194721 CCTTTTCCCAGGTTGAGGGATGG - Intergenic
1150245594 17:63672415-63672437 CCTGGTTCCAGGTGCTGGGAAGG + Intronic
1150833265 17:68542039-68542061 CTGGGGGCCAGGTTGAGGGACGG + Exonic
1151134995 17:71937935-71937957 ACGGGTTCCATGTTGGGGGAGGG + Intergenic
1152039207 17:77892271-77892293 GAGGGTCCCAGGCTGGGGGAAGG + Intergenic
1152283078 17:79396730-79396752 TCGGGCCCCAGGCTGTGGGCAGG + Intronic
1153940177 18:9970147-9970169 CCCGGGCCCAGGGAGTGGGAGGG + Intergenic
1155211643 18:23607167-23607189 CAGGGTCCCATGTGGTGAGAAGG - Intronic
1155219561 18:23671901-23671923 CAGGGCCCCAGGGTGTTGGAGGG - Intergenic
1160437227 18:78860927-78860949 CTGGGTCCCAGGATGATGGACGG + Intergenic
1160792033 19:927457-927479 CCGGGTCGCCGGGTGGGGGAGGG - Intronic
1160978949 19:1807628-1807650 CCGGGTGCCAGGGTAGGGGATGG - Intronic
1161048561 19:2150398-2150420 CTAGGTCACAGGTTGGGGGAAGG + Intronic
1161469082 19:4447507-4447529 CCGGGGCCCAGGCTGGGGGTGGG - Intronic
1161571998 19:5035822-5035844 CCGGGTCCCATGCTGTGGAGGGG + Intronic
1161975844 19:7607506-7607528 CCAGGCCCCAGGGTGGGGGAAGG - Intronic
1162677081 19:12307222-12307244 CCGGGTTCCAGGGTGGGGAAAGG - Intergenic
1162811121 19:13164729-13164751 CCAGGTCCCGCCTTGTGGGAAGG + Intergenic
1163154703 19:15433351-15433373 GCGGGTGCCAGGTTGGGGGCGGG - Intronic
1163666759 19:18607057-18607079 CCGGGTCCCAGACTGGGGGTGGG - Intronic
1163726130 19:18924180-18924202 CCAGCTCTCAGGTTCTGGGAAGG - Intronic
1164591092 19:29507368-29507390 CCCTGTCTGAGGTTGTGGGATGG + Intergenic
1164616328 19:29668890-29668912 GAGGGTCCCAGGTTGGGCGAGGG - Intronic
1164634414 19:29781917-29781939 CCGAGCACCAGGATGTGGGAAGG + Intergenic
1165081535 19:33309901-33309923 CCAAGCCCCAGGATGTGGGAAGG - Intergenic
1165744557 19:38222853-38222875 CCGGGACCCAGGCTGGGGGAAGG + Intronic
1166333793 19:42093361-42093383 CCGTGTCCCAGGAAGAGGGAGGG + Intronic
1166750460 19:45161969-45161991 CGGGGTCCCAGGTCGCAGGAAGG - Intronic
1167217289 19:48173064-48173086 CCAGGTCCCATGCTGTGGGCTGG + Intronic
1167625617 19:50586491-50586513 CTGGGGCCCAGGTTGAGAGAAGG - Intergenic
1168059397 19:53882765-53882787 CCGACTCCCAGGTTCTAGGATGG + Intronic
926195486 2:10761300-10761322 CTGGTTCCCAGCTTGTGGGATGG + Intronic
926621165 2:15048465-15048487 TCCGGTCCCAGGAAGTGGGATGG + Intergenic
927106347 2:19830640-19830662 CAGGGGACCAGGTTTTGGGAAGG + Intergenic
928385680 2:30865912-30865934 CAGGGTCTCTGGCTGTGGGAGGG - Intergenic
929777432 2:44937934-44937956 CCGGCTCCCAGGATGTCGGGAGG - Intergenic
931429168 2:62195983-62196005 CCGCGCCCCAAGTTTTGGGAGGG - Intergenic
932814719 2:74852554-74852576 CAGAGACCCAGCTTGTGGGATGG + Intronic
933694405 2:85206478-85206500 CCAAGTCCCAGGCTCTGGGATGG + Intronic
934655123 2:96113314-96113336 CTGGGTGCCAGGTTTTGGGGTGG + Exonic
937868229 2:126769700-126769722 ATGGGTCCCGGGTAGTGGGAGGG - Intergenic
938255695 2:129858384-129858406 TGGGGTCCCAGGTGGAGGGAAGG + Intergenic
939100538 2:137890414-137890436 CAGGGTGCCATTTTGTGGGAGGG - Intergenic
940742341 2:157523098-157523120 CCTGGTCCCAGCTACTGGGAAGG + Intergenic
946346724 2:219117022-219117044 ATGGAGCCCAGGTTGTGGGATGG - Intronic
948503469 2:238411424-238411446 CCGGTTCCCTGGATCTGGGAAGG + Intergenic
948874456 2:240819553-240819575 CCGGTTCCCGGGGTGGGGGAGGG - Intronic
1169917375 20:10697013-10697035 CCTGGGTCCAGCTTGTGGGAGGG + Intergenic
1171206486 20:23285619-23285641 CCTGGTCCCAGGATCTGTGAGGG + Intergenic
1173581449 20:44149570-44149592 CAGGGTCACAGGCAGTGGGATGG - Intronic
1174104800 20:48154583-48154605 CCTGCTCCCATGGTGTGGGAGGG + Intergenic
1175199630 20:57268182-57268204 ACAGGCCCCAGGCTGTGGGATGG + Intergenic
1175278758 20:57788670-57788692 CCGGATCACAGGCTGTGGGCAGG + Intergenic
1175905575 20:62377888-62377910 CCGGGTGCCAGGTTCTTGGCAGG + Intergenic
1178370394 21:32022210-32022232 CAGGGTTCCAGGATGAGGGAGGG - Intronic
1179397707 21:41056561-41056583 CCGGCCCCCAGGGTCTGGGAAGG - Intergenic
1180842895 22:18967553-18967575 CCGAGCCCCAGGTTGGGGGTGGG + Intergenic
1181514995 22:23405227-23405249 CCGAGCCCCAGGTTGGGGGTGGG - Intergenic
1181590576 22:23882661-23882683 CCGGGGCCCAGGGTGTGCGGCGG - Intronic
1183293168 22:37015176-37015198 CTGGGTCCCACTTTGTGGGTGGG - Intronic
1184216367 22:43070026-43070048 CCGGGACCCAAGTGGTGTGAGGG + Intronic
1184249461 22:43251919-43251941 CCGGGACCCTGCTTGTGGCAAGG - Intronic
1184458351 22:44623998-44624020 GGGGGTCCCAGGCTATGGGATGG + Intergenic
1184532432 22:45064790-45064812 CCCAGCCCCAGGTGGTGGGAAGG - Intergenic
950415399 3:12866387-12866409 CCAGGACCCAGGTTTTGTGAAGG + Intronic
950417026 3:12874674-12874696 CCAGGACCCAGGTTTTGTGAAGG + Intergenic
950550131 3:13661308-13661330 CCGGGGCCGGGGTGGTGGGAGGG + Intergenic
953879418 3:46683911-46683933 CAGAGTCCCAGGGTGTGGGCAGG + Intronic
954293688 3:49662723-49662745 CCTGGTCCGTGGTTGCGGGAGGG + Intronic
954304735 3:49719617-49719639 CCGGTTCCCAGGTTGTGAGGCGG + Exonic
954395982 3:50293570-50293592 TGGGGTCCCAGGGTGGGGGACGG - Intronic
956747110 3:72318905-72318927 CCTGGTCGCAGGGTGTGGGACGG - Intergenic
959357345 3:105349110-105349132 CTGTGTCCCAGAGTGTGGGAAGG - Intergenic
962181490 3:133210459-133210481 CTGACTCCCAGGTTATGGGATGG - Intronic
966735095 3:183181440-183181462 CCTAGTCCCAGGAGGTGGGAGGG + Intronic
967948505 3:194822855-194822877 ACAGGTTCCAGGTTGGGGGAAGG - Intergenic
968622682 4:1610848-1610870 CCGGGGCCCGGGTTGGGGGCAGG - Intergenic
971346142 4:25813540-25813562 ACGGCTCCCAGGGTTTGGGATGG + Intronic
973584137 4:52374277-52374299 GTGGGTCCCATGTTGTGTGAGGG - Intergenic
978580816 4:110229506-110229528 ACAGTTCCCATGTTGTGGGAAGG - Intergenic
979536207 4:121823488-121823510 CCGGGTCCGCGGTTGTTGGACGG + Exonic
985811726 5:2094951-2094973 CCGGGTCCCAGCTAGTGGAGCGG - Intergenic
987263704 5:16229400-16229422 CAGGTTCCCAGGTTCTGGGTGGG + Intergenic
993467737 5:88268957-88268979 GTGGGTGCCAGGTTGTGGGCTGG + Intronic
998176368 5:139904404-139904426 CGGGGTCCCAGGCGGTGGGACGG + Intronic
1001203569 5:169741423-169741445 CTTGGTCCCAGGTTGTGGGGTGG + Intronic
1002529101 5:179833259-179833281 CGTGGTCCCAGGTGGCGGGAGGG - Intronic
1009538882 6:64925737-64925759 CAGGTTCCCAGGTGGTGGGTTGG + Intronic
1013543021 6:111130666-111130688 CCAAGGCCCAGGTGGTGGGAGGG - Intronic
1015272028 6:131346213-131346235 CAGGACCCCAAGTTGTGGGAAGG - Intergenic
1016825706 6:148386719-148386741 CAGGGTCCCCGGTTGTGATAGGG + Intronic
1016999098 6:149983297-149983319 CGGGGAACAAGGTTGTGGGAAGG + Intergenic
1018091212 6:160348208-160348230 CCGGGCCACAGGTCGCGGGAGGG - Intergenic
1022690626 7:32648919-32648941 GTGTGTCCCAGGTTGGGGGAGGG - Intergenic
1022918183 7:34982761-34982783 GTGTGTCCCAGGTTGGGGGAGGG - Intronic
1023204476 7:37733257-37733279 TTGGGTCCTAGGTTTTGGGATGG + Intronic
1023849897 7:44144781-44144803 CCTGGGCCCAGGCTCTGGGAAGG - Exonic
1025112390 7:56229769-56229791 CCGGGTCCCATGGAGTTGGAGGG - Intergenic
1026613172 7:71878924-71878946 CCCTGACCCAGGTTGTGGGAAGG - Intronic
1029124068 7:98285379-98285401 CCAGGTCACAGGTGGTAGGAGGG - Intronic
1029544072 7:101201222-101201244 CTGGGTCCCAGGTGCTGGAAGGG + Intergenic
1031406777 7:121396113-121396135 CCGGGGCTCAGGTTCGGGGAGGG - Intronic
1041719959 8:60966592-60966614 CTGGGTCCCAGGGAGTTGGAGGG + Intergenic
1046791427 8:118326357-118326379 CAGGGTCCCAAGTTAGGGGAAGG + Intronic
1047007140 8:120632202-120632224 ACGGGGTCCAGGTTGTTGGATGG - Intronic
1048308132 8:133297486-133297508 TCGGGGCCCGGGTTGTGGGTCGG + Exonic
1049324991 8:142017126-142017148 CCGGGTCCCATGTGGCAGGAGGG + Intergenic
1049385624 8:142341618-142341640 CCGGGTGGGAGGTGGTGGGATGG - Intronic
1049763095 8:144339585-144339607 CCAGGCCCCATGTTGTGGAAAGG + Intergenic
1053206264 9:36188934-36188956 TCGGGTCCCTGGTTGCAGGATGG - Intergenic
1055629830 9:78212257-78212279 CCTGGCCCCAGGTCGGGGGATGG - Intergenic
1056491548 9:87112797-87112819 CCCGGTTCCAGATGGTGGGAAGG + Intergenic
1056577532 9:87867944-87867966 CTGGGTCCTAGGTTCTGGAAAGG - Intergenic
1056771499 9:89481064-89481086 GTGTGTCCCAGGTTCTGGGATGG - Intronic
1057263742 9:93600622-93600644 CCATCTCGCAGGTTGTGGGATGG + Intronic
1059161309 9:112037852-112037874 CTGTGCCCCAGTTTGTGGGAGGG - Intergenic
1060270082 9:122133911-122133933 CCGGGTCTCAGGAGGTGGGGAGG - Intergenic
1061893374 9:133634417-133634439 CTGGGGCCCGCGTTGTGGGAAGG - Intergenic
1062065335 9:134523675-134523697 CCAGATCCCAGGTGATGGGAGGG - Intergenic
1062065366 9:134523805-134523827 CCGGATCCCAGGGGATGGGAGGG - Intergenic
1062065387 9:134523875-134523897 CGGGATCCCAGGTGATGGGAGGG - Intergenic
1062065421 9:134524005-134524027 CCGGATCCCAGGGGATGGGAGGG - Intergenic
1062065452 9:134524125-134524147 CCGGATCCCAGGGGATGGGAGGG - Intergenic
1062065468 9:134524185-134524207 CCGGATCCCAGGTGATGGGAGGG - Intergenic
1062065481 9:134524245-134524267 CCGGATCCCAGGGGATGGGAGGG - Intergenic
1062065502 9:134524315-134524337 CCGGATCCCAGGGGATGGGAGGG - Intergenic
1062065523 9:134524385-134524407 CCGGATCCCAGGGGATGGGAGGG - Intergenic
1062065573 9:134524575-134524597 CCGGATCCCAGGGGATGGGAGGG - Intergenic
1062065594 9:134524645-134524667 CCGGATCCCAGGGGATGGGAGGG - Intergenic
1062065642 9:134524835-134524857 CCGGATCCCAGGGGATGGGAGGG - Intergenic
1062435504 9:136545152-136545174 CCGGCTCTCAGTTTGGGGGAGGG - Intronic
1062540677 9:137040425-137040447 CTGGTCCCCAGGCTGTGGGAAGG + Exonic
1062656389 9:137606154-137606176 CCGGGAGCCAGGGTGCGGGAAGG - Intronic
1186450957 X:9673272-9673294 CTGGGTGCCAGGTGGTGGGGAGG - Intronic
1187039778 X:15581237-15581259 CCAGGTCCCAAGCTGTGGGATGG + Exonic
1190220262 X:48508534-48508556 GCCGGTCCCAGGAGGTGGGAGGG + Intergenic
1191717347 X:64202888-64202910 CCGGATGCCAGGCTGTGGAATGG - Intronic
1195240054 X:102942224-102942246 CAGCTTCCCAGGTTGTGGGTGGG - Intergenic
1200240418 X:154490388-154490410 GCGGGTCGCCGGCTGTGGGACGG - Exonic