ID: 900386224

View in Genome Browser
Species Human (GRCh38)
Location 1:2412268-2412290
Sequence CGGGTCCCAGGTTGTGGGAC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 125}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900386207_900386224 22 Left 900386207 1:2412223-2412245 CCCCGCACATCCCTGAATGGCCG 0: 1
1: 0
2: 0
3: 3
4: 56
Right 900386224 1:2412268-2412290 CGGGTCCCAGGTTGTGGGACGGG 0: 1
1: 0
2: 1
3: 13
4: 125
900386209_900386224 20 Left 900386209 1:2412225-2412247 CCGCACATCCCTGAATGGCCGCA 0: 1
1: 0
2: 1
3: 11
4: 131
Right 900386224 1:2412268-2412290 CGGGTCCCAGGTTGTGGGACGGG 0: 1
1: 0
2: 1
3: 13
4: 125
900386214_900386224 11 Left 900386214 1:2412234-2412256 CCTGAATGGCCGCAGGGCAGGCG 0: 1
1: 0
2: 1
3: 7
4: 89
Right 900386224 1:2412268-2412290 CGGGTCCCAGGTTGTGGGACGGG 0: 1
1: 0
2: 1
3: 13
4: 125
900386213_900386224 12 Left 900386213 1:2412233-2412255 CCCTGAATGGCCGCAGGGCAGGC 0: 1
1: 0
2: 1
3: 11
4: 127
Right 900386224 1:2412268-2412290 CGGGTCCCAGGTTGTGGGACGGG 0: 1
1: 0
2: 1
3: 13
4: 125
900386208_900386224 21 Left 900386208 1:2412224-2412246 CCCGCACATCCCTGAATGGCCGC 0: 1
1: 0
2: 1
3: 9
4: 110
Right 900386224 1:2412268-2412290 CGGGTCCCAGGTTGTGGGACGGG 0: 1
1: 0
2: 1
3: 13
4: 125
900386216_900386224 2 Left 900386216 1:2412243-2412265 CCGCAGGGCAGGCGAAGGAGACT 0: 1
1: 0
2: 0
3: 19
4: 215
Right 900386224 1:2412268-2412290 CGGGTCCCAGGTTGTGGGACGGG 0: 1
1: 0
2: 1
3: 13
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900386224 Original CRISPR CGGGTCCCAGGTTGTGGGAC GGG Intronic
900111232 1:1006431-1006453 CTGGTCCCAGGTGGAGAGACAGG + Intergenic
900386224 1:2412268-2412290 CGGGTCCCAGGTTGTGGGACGGG + Intronic
900401441 1:2474483-2474505 TGGGACCCACGTTGTGGGGCTGG + Intronic
901728661 1:11262304-11262326 CGGTGCCCAGGTCGTGGGGCCGG + Intronic
902503426 1:16925046-16925068 GGGGTCCCAGGGTGTGGGGCGGG + Intronic
902985254 1:20150691-20150713 CAGGTCACAGGTGGTGGGGCTGG + Intergenic
903295340 1:22339853-22339875 GGGGTTTCAGGTTGTGGGAAGGG - Intergenic
903464993 1:23545827-23545849 GGGGTCCTGGGATGTGGGACTGG + Intergenic
903649008 1:24911818-24911840 CGGGACCCAGGCTGTGGGTCAGG + Intronic
906717324 1:47979861-47979883 GGGTTCCCAGCTTCTGGGACAGG - Intronic
908179956 1:61593784-61593806 CAGGGCCCAGGCTGTGGGAGGGG - Intergenic
910795579 1:91094473-91094495 CAGGTCCCAGGGAGTGGTACAGG + Intergenic
915556902 1:156665760-156665782 AGGGTCCCAGGTTTTTGGCCTGG - Intergenic
924816553 1:247447033-247447055 CTGGACCCAGGCTGAGGGACAGG + Intronic
1064059991 10:12129509-12129531 CGGGTCCCGGGTCCTGGGACCGG + Intergenic
1075085016 10:119409121-119409143 CGAGGCCCAGGTTGGGGGTCAGG - Intronic
1075105643 10:119538464-119538486 GGGGACCCAGGCTTTGGGACAGG + Intronic
1075617957 10:123905220-123905242 CGGCTCCCAGGCTGTGTGGCGGG - Intronic
1076835763 10:133020332-133020354 CGGGTCCTTGGGTGTTGGACTGG - Intergenic
1077089954 11:773853-773875 TGGGGCCCAGGATGTGGGGCTGG + Intronic
1077126838 11:943452-943474 CGAGGCCCAGGGTGTGGCACCGG + Intronic
1077549731 11:3194671-3194693 CTGGTCCCAGGATGTGGGTGGGG + Intergenic
1081487527 11:43543371-43543393 TTGGTCCCAGGATGTGGGCCGGG - Intergenic
1095734881 12:45545894-45545916 GGGGTCTCAGGGTGTGGGAAGGG - Intergenic
1102731018 12:115109835-115109857 GGGGACCCAGGCTGTGGGAGTGG - Intergenic
1104859563 12:131917245-131917267 CGGCTCGGAGGCTGTGGGACGGG + Intronic
1104859574 12:131917277-131917299 CGGCTCGGAGGCTGTGGGACGGG + Intronic
1108609609 13:52071217-52071239 GGGGTCCCAGGTTGGGGGTGGGG + Intronic
1111973183 13:94938437-94938459 CGGGGCACAGGTTGAGGGTCGGG + Intergenic
1112425124 13:99291055-99291077 CAGGCCACAGGTTCTGGGACCGG + Intronic
1115398955 14:32938029-32938051 CGGGTCCCGGGACTTGGGACCGG - Intronic
1115566529 14:34629831-34629853 TGGGTCCCCGGGTGTGGTACGGG - Intronic
1122959576 14:105088277-105088299 CGGCTCCCAGGGCCTGGGACCGG - Intergenic
1124846992 15:33300981-33301003 GGGGTCCCAGGATTTGGCACTGG - Intergenic
1127753395 15:62067846-62067868 CGGGTCCCAGTCTGTGCGGCCGG - Exonic
1127846987 15:62878512-62878534 AGGGTCCCAGGTTGGGAGAAGGG + Intergenic
1132676452 16:1123191-1123213 CAGGTCCCAGGCTGTGGGGCAGG + Intergenic
1133969257 16:10555560-10555582 CTGCTTCCAGGTTGTAGGACAGG - Intronic
1134809755 16:17157410-17157432 CGGGGGCCAGGTTGGGGAACGGG + Intronic
1136297605 16:29312596-29312618 CGGGCCCCATCTTGGGGGACTGG + Intergenic
1142251294 16:88993225-88993247 AGGGTCCCAGCTGGTGGGCCTGG - Intergenic
1148605663 17:48927272-48927294 CCGATCCCAGGGTGTGGGAGTGG + Exonic
1148741906 17:49897832-49897854 GGGGTTCCAGGAGGTGGGACAGG - Intergenic
1151462697 17:74264179-74264201 CGCGTCCCATGTTGGGGGAGTGG + Intergenic
1151756630 17:76079019-76079041 CGGGTTCCAGGTGGTGGAAATGG + Intronic
1151884415 17:76915241-76915263 AGGGTCCCAGGAGGAGGGACAGG + Intronic
1152039208 17:77892272-77892294 AGGGTCCCAGGCTGGGGGAAGGG + Intergenic
1152092601 17:78255425-78255447 CAGGTGCCAGGCTGGGGGACAGG + Intergenic
1160198344 18:76776066-76776088 GTGGTCCCACGTTGTGGGGCCGG - Intergenic
1160568679 18:79801961-79801983 GGGGTCCCAGGTGGTGGGTCAGG + Intergenic
1161992789 19:7694507-7694529 CAGATCCCAGGCTGTGGGGCTGG + Intronic
1162737442 19:12754476-12754498 GGGGGCCCAGGTTGTGGGAGAGG - Intronic
1162917370 19:13881617-13881639 CGGCTCCCAGGGTCTGGGAATGG + Intergenic
1163154702 19:15433350-15433372 CGGGTGCCAGGTTGGGGGCGGGG - Intronic
1163264083 19:16207850-16207872 CTGGACCCAGGTTATGGGGCAGG - Intronic
1164616327 19:29668889-29668911 AGGGTCCCAGGTTGGGCGAGGGG - Intronic
1165744558 19:38222854-38222876 CGGGACCCAGGCTGGGGGAAGGG + Intronic
1166147190 19:40845859-40845881 AGGGTCCCGGGATCTGGGACAGG + Intronic
1168176697 19:54632142-54632164 CGAGTCGCAGGTGGTGGTACAGG + Exonic
926216236 2:10907262-10907284 CGGGGACCAGGTGCTGGGACAGG - Intergenic
928228887 2:29478817-29478839 TGTGTCCCAGCTTGTGGGAATGG + Intronic
931124239 2:59256050-59256072 TGAGTGCCAGGTTGTAGGACTGG + Intergenic
932180622 2:69643425-69643447 GGGGTCCCGGGTTCTGGGGCCGG - Intronic
932770750 2:74499618-74499640 CGGGTCCGAGGCTGGGGGCCCGG - Exonic
932777048 2:74534586-74534608 CTCGTCCCAGGTTGTGGATCTGG + Exonic
936009897 2:108918892-108918914 GGGGTCCCAGACTGTGGCACTGG + Intronic
944843606 2:203646690-203646712 CGGGTCCAAGGTTCTGGGCCTGG + Intergenic
946346723 2:219117021-219117043 TGGAGCCCAGGTTGTGGGATGGG - Intronic
948283903 2:236769440-236769462 CTGGGCCCAGGTTGGGGCACAGG + Intergenic
1169476136 20:5932815-5932837 AGGGTCCAAGGTGGTGGCACTGG + Intergenic
1173853970 20:46237840-46237862 TGGCTCCCAGGTTGTTGGAATGG - Intronic
1175547251 20:59786269-59786291 TGGGTCCCAGTCTGTGGGGCTGG + Intronic
1175752631 20:61509576-61509598 AGGGTACCAGGGTGGGGGACAGG + Intronic
1176157174 20:63627617-63627639 CGGGGTGCTGGTTGTGGGACTGG - Intergenic
1178532837 21:33389645-33389667 CAGGTCCCTGGGTGTTGGACTGG + Intergenic
1179063224 21:37999962-37999984 CAAGTCCCAGGTATTGGGACAGG - Intronic
1179984044 21:44911510-44911532 CGGGTGCCAGGCTGTGTGCCAGG + Intronic
1181438809 22:22925234-22925256 CGGGTCCCGGGATGGGGGCCTGG - Intergenic
1181590575 22:23882660-23882682 CGGGGCCCAGGGTGTGCGGCGGG - Intronic
1181918343 22:26298906-26298928 TGGCTCCCAGGATGTGGGTCAGG + Intronic
1182517645 22:30868130-30868152 CGGGTGCCAGGCTGTGGGTGAGG - Intronic
1185060889 22:48606178-48606200 GGGGTCCCAGGGTTTGGTACAGG - Intronic
950430404 3:12947651-12947673 TGGGCCCCTGGTGGTGGGACAGG + Intronic
951118277 3:18891637-18891659 GGGGTACCAGGCTGTGGGAGAGG + Intergenic
951166679 3:19490575-19490597 CAGGCCCCAGGGTGTGGCACCGG + Intronic
951907259 3:27717545-27717567 TTGGTCCCAGGTTGCTGGACAGG + Exonic
953975882 3:47381328-47381350 CGGGCGCCGGGGTGTGGGACAGG - Intronic
956747109 3:72318904-72318926 CTGGTCGCAGGGTGTGGGACGGG - Intergenic
956756127 3:72388695-72388717 TGTGTCCCAGCTTGTGTGACAGG - Intronic
967295292 3:187958456-187958478 AGGCTGCCAGGTGGTGGGACTGG - Intergenic
968804679 4:2764357-2764379 CGGGGCGCGGGTTGCGGGACGGG - Intergenic
971346143 4:25813541-25813563 CGGCTCCCAGGGTTTGGGATGGG + Intronic
979439350 4:120733274-120733296 GGAGTCCCAGGTGCTGGGACAGG - Intronic
979536208 4:121823489-121823511 CGGGTCCGCGGTTGTTGGACGGG + Exonic
985485516 5:146279-146301 AGGGTCACAGGGTGTGGGAAAGG - Intronic
985766260 5:1781307-1781329 CAGGTCCCAGGGTGTAGGCCAGG - Intergenic
985811725 5:2094950-2094972 CGGGTCCCAGCTAGTGGAGCGGG - Intergenic
990403955 5:55469012-55469034 GGGGTCCCAAGGGGTGGGACAGG + Intronic
993467738 5:88268958-88268980 TGGGTGCCAGGTTGTGGGCTGGG + Intronic
994201262 5:96978818-96978840 AGGGTCCCAGGTTGTGGGGCAGG + Intronic
1001203570 5:169741424-169741446 TTGGTCCCAGGTTGTGGGGTGGG + Intronic
1002493268 5:179594812-179594834 CAGGTGCAAGGATGTGGGACAGG + Intronic
1002779969 6:358409-358431 CTGGTGCCAGGCTGTGGGAGAGG - Intergenic
1002898227 6:1391189-1391211 GGGGTCCCTGTTTGTGGGAGTGG - Intronic
1006300266 6:33190356-33190378 TGGGTCCCAGGTGGTGGGGTTGG - Intronic
1006460502 6:34155030-34155052 CGTGTCCCCGGGCGTGGGACGGG - Intronic
1006789073 6:36686795-36686817 AGGGTCCCATGTGGTGGCACAGG + Exonic
1007836122 6:44674989-44675011 TGGGTCACAGGGTGAGGGACCGG + Intergenic
1016287353 6:142487950-142487972 GGGTTCCCAGGTTGTGTGTCTGG + Intergenic
1016758355 6:147711281-147711303 CAGCTCGTAGGTTGTGGGACTGG + Intronic
1019176414 6:170161458-170161480 CGGGTCCCTGGATGTGTGAGAGG + Intergenic
1019518425 7:1449847-1449869 CAGGTCCCATGTGGTGGGAGTGG + Intronic
1019590555 7:1828314-1828336 CGGGACCCGAGTTGAGGGACAGG + Intronic
1020087477 7:5319002-5319024 CGGTTCCCAGGATGAGGGACAGG + Intronic
1022690625 7:32648918-32648940 TGTGTCCCAGGTTGGGGGAGGGG - Intergenic
1022918182 7:34982760-34982782 TGTGTCCCAGGTTGGGGGAGGGG - Intronic
1022952378 7:35351134-35351156 CAGGTCCCAGGAGGAGGGACGGG + Intergenic
1023204477 7:37733258-37733280 TGGGTCCTAGGTTTTGGGATGGG + Intronic
1025206833 7:56998162-56998184 TGGTTCCCAGGATGAGGGACAGG - Intergenic
1025665107 7:63578765-63578787 TGGTTCCCAGGATGAGGGACAGG + Intergenic
1026613170 7:71878923-71878945 CCTGACCCAGGTTGTGGGAAGGG - Intronic
1031786956 7:126045301-126045323 CAGGTCCCAGTTTGTGGCCCCGG - Intergenic
1032441600 7:131946418-131946440 CGGGGGCCAGGTTGTGGGAAAGG + Intergenic
1033128649 7:138726524-138726546 AGGGACCCAGGTTGTAGGAGAGG + Intronic
1034514453 7:151563919-151563941 AGTGTGCCAGGTTCTGGGACAGG + Intronic
1039441471 8:37598253-37598275 AGGATCCCTGGTTGTGTGACTGG + Intergenic
1045272123 8:100670890-100670912 CCGGTCCTAGGCTCTGGGACTGG - Intergenic
1045902042 8:107293584-107293606 AGGGTTGCAGGTTGTGGAACAGG - Intronic
1053455036 9:38227176-38227198 AGGGTGCCAGGTTGTGGGTGTGG + Intergenic
1054805969 9:69396049-69396071 AGGGTACCAGGCTGTGGGCCAGG + Intergenic
1059490369 9:114661496-114661518 CGGGTCCCAGGATGCAGCACCGG + Intergenic
1060229950 9:121819018-121819040 CGTGTCCGAGTTTGGGGGACTGG + Intergenic
1060660382 9:125401971-125401993 GGGTTCCCAGGTTGGGGGTCAGG + Intergenic
1060971132 9:127738769-127738791 CAGGTTCCAGCTTGTGGGACAGG + Exonic
1061720808 9:132550147-132550169 GGGTTCCCAGGTTGTAGGACTGG - Intronic
1062065467 9:134524184-134524206 CGGATCCCAGGTGATGGGAGGGG - Intergenic
1062278809 9:135742964-135742986 TGGGTCCCAGGTGCTGGGGCTGG + Intronic
1187484956 X:19694533-19694555 AGGGTCCCAGGCTTTGGCACTGG + Intronic
1192358730 X:70425500-70425522 CGGGTCCCAGGGTGGGGAGCAGG - Intronic
1195196771 X:102504735-102504757 AGGGGCCCTGGTTGTGGGGCAGG + Intergenic