ID: 900388687

View in Genome Browser
Species Human (GRCh38)
Location 1:2423559-2423581
Sequence GTTCTTAAGGAGATTATGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 305
Summary {0: 1, 1: 0, 2: 9, 3: 50, 4: 245}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900388677_900388687 1 Left 900388677 1:2423535-2423557 CCTCCCCTGGAGTTCTGGGCTGG 0: 1
1: 1
2: 2
3: 41
4: 333
Right 900388687 1:2423559-2423581 GTTCTTAAGGAGATTATGGAGGG 0: 1
1: 0
2: 9
3: 50
4: 245
900388672_900388687 13 Left 900388672 1:2423523-2423545 CCCTCAAATCCACCTCCCCTGGA 0: 1
1: 0
2: 0
3: 26
4: 257
Right 900388687 1:2423559-2423581 GTTCTTAAGGAGATTATGGAGGG 0: 1
1: 0
2: 9
3: 50
4: 245
900388681_900388687 -2 Left 900388681 1:2423538-2423560 CCCCTGGAGTTCTGGGCTGGGGT 0: 1
1: 1
2: 10
3: 62
4: 330
Right 900388687 1:2423559-2423581 GTTCTTAAGGAGATTATGGAGGG 0: 1
1: 0
2: 9
3: 50
4: 245
900388676_900388687 4 Left 900388676 1:2423532-2423554 CCACCTCCCCTGGAGTTCTGGGC 0: 1
1: 1
2: 3
3: 30
4: 370
Right 900388687 1:2423559-2423581 GTTCTTAAGGAGATTATGGAGGG 0: 1
1: 0
2: 9
3: 50
4: 245
900388683_900388687 -4 Left 900388683 1:2423540-2423562 CCTGGAGTTCTGGGCTGGGGTTC 0: 1
1: 1
2: 12
3: 99
4: 440
Right 900388687 1:2423559-2423581 GTTCTTAAGGAGATTATGGAGGG 0: 1
1: 0
2: 9
3: 50
4: 245
900388673_900388687 12 Left 900388673 1:2423524-2423546 CCTCAAATCCACCTCCCCTGGAG 0: 1
1: 0
2: 6
3: 30
4: 290
Right 900388687 1:2423559-2423581 GTTCTTAAGGAGATTATGGAGGG 0: 1
1: 0
2: 9
3: 50
4: 245
900388682_900388687 -3 Left 900388682 1:2423539-2423561 CCCTGGAGTTCTGGGCTGGGGTT 0: 1
1: 3
2: 27
3: 74
4: 458
Right 900388687 1:2423559-2423581 GTTCTTAAGGAGATTATGGAGGG 0: 1
1: 0
2: 9
3: 50
4: 245

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900388687 Original CRISPR GTTCTTAAGGAGATTATGGA GGG Intergenic
900388687 1:2423559-2423581 GTTCTTAAGGAGATTATGGAGGG + Intergenic
901729349 1:11267600-11267622 GTTTTTAAGGGGATTGTAGAGGG + Intergenic
904070601 1:27793608-27793630 GTTCTGAAGTAGATAAGGGAAGG - Exonic
904206622 1:28859595-28859617 TTTATGAAGGAGATTATGGATGG + Intronic
906693743 1:47810436-47810458 GGTCTGAAGGAGATGAGGGAGGG + Intronic
907604268 1:55801232-55801254 GTAGTTAAGGAGTTTAAGGAAGG + Intergenic
907643623 1:56218285-56218307 GACCTTGAGGAGATTATAGAGGG - Intergenic
907888284 1:58614244-58614266 GTTTTTAAGGAGATCCTGGAGGG - Intergenic
910814182 1:91272267-91272289 GTGGTTAAGTAGATTATGAAAGG + Intronic
913118386 1:115717445-115717467 GTTTTTAAGAGGATCATGGAAGG - Intronic
913446501 1:118955968-118955990 ATCTTCAAGGAGATTATGGATGG - Intronic
913480610 1:119285684-119285706 GGTTTTAAGGGGATTATGGAGGG - Intergenic
913667280 1:121059991-121060013 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914018970 1:143847134-143847156 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914657521 1:149755341-149755363 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
915487814 1:156234256-156234278 GTTGTTGAGGGGATTAGGGAGGG + Intronic
915657009 1:157369029-157369051 GTTTTTAAGGATATCGTGGAGGG + Intergenic
915671982 1:157497286-157497308 GTTTTTAAGGATATAGTGGAGGG - Intergenic
917090614 1:171349932-171349954 GATTTTAAGGGGATTGTGGAGGG + Intergenic
918241200 1:182622140-182622162 GTCCTCCAGGAGATTAAGGAGGG + Intergenic
918979482 1:191537118-191537140 GCTTTTAAGGGGATCATGGAGGG - Intergenic
919369930 1:196710188-196710210 GACCTTAAGGGGATCATGGAGGG - Intronic
921704905 1:218311504-218311526 GTTCTTTTGAAGAGTATGGAAGG - Intronic
922421373 1:225463018-225463040 ATTTTTAAGGGGATCATGGAGGG - Intergenic
924034552 1:239923172-239923194 GTTTTTAAGGGGATTATGGAAGG + Intergenic
924171717 1:241349285-241349307 TTTCTTAAGGAGACAATGGGTGG - Intronic
924328693 1:242921251-242921273 GTTTTTAAGGGAATTATAGAAGG + Intergenic
1063180708 10:3596481-3596503 GTTGTTAAGGAGCTTATGGTTGG + Intergenic
1064513898 10:16125179-16125201 GTTATTATGCAGTTTATGGATGG + Intergenic
1064984629 10:21197920-21197942 TTTCTTAAGGGAATCATGGAGGG - Intergenic
1065746264 10:28845299-28845321 GTTTTCAAGGGGATTATGGGGGG + Intergenic
1067151834 10:43742322-43742344 TTTCATAAGGACATAATGGATGG - Intergenic
1068001936 10:51345612-51345634 GTTCCAAATGAGATTATGTATGG - Intronic
1068146339 10:53075785-53075807 GTTTTTAAGAAAATTGTGGAGGG - Intergenic
1071361598 10:84851737-84851759 GTTTTTAAGGGGATCATGGAAGG - Intergenic
1071523750 10:86346528-86346550 CTTCTTAATGAGATTAGGCAGGG + Intronic
1074162936 10:110848915-110848937 GCTCTTGAGGAGAGTATTGATGG + Intergenic
1074619992 10:115108573-115108595 TTTCATAAGAAGATTATGGTGGG - Intronic
1075154929 10:119967362-119967384 GTTTTTAAGGAGATTGTGGAGGG + Intergenic
1077920410 11:6637794-6637816 CATCTTAAGGAGTTTATAGAGGG - Intronic
1078344531 11:10534541-10534563 GTTCTTAGGAAAATTATAGAAGG - Intronic
1079036059 11:17021140-17021162 GCTTTTAAGGGGATTGTGGAGGG - Intergenic
1081185074 11:40032475-40032497 GTTTTTAAGGATAGTTTGGAGGG + Intergenic
1082170722 11:49001818-49001840 ATTTTTAAGGGGATTGTGGAAGG - Intergenic
1082567568 11:54699616-54699638 GTTATTAAGCAAATTAGGGAGGG - Intergenic
1082612894 11:55323547-55323569 GTTGTTCAGGAAATTAAGGATGG + Intergenic
1084207274 11:67602973-67602995 TTTTTTAAGGAGATTGTGGAGGG + Exonic
1086695083 11:89834542-89834564 ATTTTTAAGGGGATTGTGGAAGG + Intergenic
1086711067 11:90009942-90009964 ATTTTTAAGGGGATTGTGGAAGG - Intergenic
1086862276 11:91939092-91939114 GCTCTTAAAGAGAGTATGCATGG - Intergenic
1087971956 11:104494935-104494957 GTTCTTAAGGATAATTTGGTAGG - Intergenic
1090978690 11:131697443-131697465 ATACTTGAGGAGATAATGGAGGG - Intronic
1091700634 12:2658283-2658305 ATTTTTAAGTAGATTTTGGAGGG - Intronic
1092275627 12:7058910-7058932 GTTCTTAAGGAGAATTTGGTGGG - Intronic
1092501720 12:9053968-9053990 GCTTTTAAGGGGATCATGGAGGG - Intergenic
1093195779 12:16128125-16128147 GTTCATAAGGTGAGTGTGGAGGG + Intergenic
1094285357 12:28786758-28786780 GTTTTTAAGTAGTTTATGCAAGG + Intergenic
1094417294 12:30230871-30230893 GTTTTTAAGAGGATCATGGAGGG + Intergenic
1096711791 12:53462922-53462944 CCTCTGAAGGAGATTCTGGATGG + Intronic
1097136096 12:56857072-56857094 GTTTTTAAGGAGAGTTTGGTGGG + Intergenic
1098667789 12:73185808-73185830 TTCCTTAAGGAGATTATGCAAGG + Intergenic
1099291248 12:80778804-80778826 CTTCTTAAGGAGATTATTATGGG - Intergenic
1099799553 12:87440485-87440507 GTTTTTAAGGATAATTTGGAGGG - Intergenic
1100409404 12:94300028-94300050 GTTGAAAAGGAGATAATGGAAGG + Intronic
1101263666 12:103061412-103061434 GTCCTTAAGGATATTAAAGATGG - Intergenic
1102740762 12:115205574-115205596 GTTTTTAAGGATAATTTGGAGGG - Intergenic
1103087128 12:118070139-118070161 TTTCCTAAGGAGATTCTGGGTGG - Intronic
1103243080 12:119431269-119431291 GTTTTTAAGGATAATTTGGAGGG + Intronic
1104197378 12:126554030-126554052 GTTTTTAAGGATATTTTGGTGGG + Intergenic
1105398004 13:20059152-20059174 GTTGTTGAGGAGAGTATGGTAGG + Intronic
1106461346 13:29973143-29973165 GTTCTTAAGGATAATTTGGTGGG - Intergenic
1106704296 13:32264566-32264588 GTTCTTTAGGAGAGGAAGGAAGG - Intronic
1109690505 13:65881829-65881851 GTTCTTAAGGATAATTTGGGTGG + Intergenic
1111102107 13:83601837-83601859 GTTTTTAAGGGGATCATGGTGGG - Intergenic
1114958049 14:27848338-27848360 GTTTTTAAGGGGATTGTGGCGGG + Intergenic
1115469081 14:33749076-33749098 GTTCTTAGAGAGACTATGGATGG + Intronic
1116233511 14:42248292-42248314 GTCTTTAAGGAGATTATGGAGGG + Intergenic
1116822249 14:49636780-49636802 TTTCTGAAGGAGAGTATAGATGG - Intergenic
1117789420 14:59323681-59323703 GTTCTTAAGGAGAAAAAGGGTGG + Intronic
1118678106 14:68210454-68210476 GATCTTAAAGATATTAGGGATGG + Intronic
1119298320 14:73551255-73551277 GTTTTTAAAGGGATCATGGAGGG - Intronic
1119302616 14:73583442-73583464 GTTTTTAAAGGGATCATGGAGGG - Intergenic
1120369136 14:83609608-83609630 GTTTCTAAGGAGATTCTGGTAGG + Intergenic
1120725643 14:87936950-87936972 GTTCTTCATGATATCATGGATGG + Intronic
1121183972 14:91950562-91950584 TTTATTAAGGATATTTTGGAGGG - Intergenic
1202841219 14_GL000009v2_random:123636-123658 GTTTTTAACGAAATTATGTAGGG + Intergenic
1202910610 14_GL000194v1_random:113866-113888 GTTTTTAACGAAATTATGTAGGG + Intergenic
1123926798 15:25121350-25121372 GTTCTTAATGTGAGTATTGATGG + Intergenic
1124198014 15:27650221-27650243 GTTTTTAAGGGGATCATGGAGGG + Intergenic
1125044711 15:35232097-35232119 GCTCAAAATGAGATTATGGAGGG + Intronic
1127292603 15:57583564-57583586 GCTTTTAAGGGGATCATGGAGGG + Intergenic
1128230652 15:66032670-66032692 GTGCTTGAGAAGATTACGGAAGG + Intronic
1128994101 15:72284290-72284312 TTTCTGAAGGAGATTAAGAAGGG - Intronic
1130026511 15:80275466-80275488 GTTTATAAGGAGATCATGGAAGG - Intergenic
1130741586 15:86606285-86606307 GTTTCTAAGGAGATTGTGGAAGG - Intronic
1133653534 16:7835977-7835999 GTTTTTAGGAAGATTTTGGAGGG + Intergenic
1133849865 16:9492637-9492659 GTTTTTAAGGGGATCATGGAGGG + Intergenic
1135120988 16:19766524-19766546 GTTCTTAAGGAGAACAAGGGTGG + Intronic
1135164493 16:20126656-20126678 ATTTTTTAGGAGATCATGGAAGG + Intergenic
1135815394 16:25627927-25627949 GTTCTGATGGAGACCATGGAAGG - Intergenic
1136179743 16:28542859-28542881 GCTTTTAAGGGGATTATGGAGGG + Intergenic
1137044242 16:35641454-35641476 GTCCCTATGGGGATTATGGAAGG + Intergenic
1137507639 16:49068286-49068308 GTTTTTAAGGGGATGGTGGAGGG + Intergenic
1138937810 16:61751366-61751388 TTTTTTAAGGAGAATATGGAAGG - Intronic
1139975201 16:70804434-70804456 GTTTTTAAGGGGATCCTGGAGGG + Intergenic
1143267538 17:5651428-5651450 GCTTTTAAGGGGATCATGGAGGG - Intergenic
1144131386 17:12250573-12250595 GTTATTAAGGCTATGATGGATGG + Intergenic
1144297984 17:13897395-13897417 GTTCTTAAGAAGATAATGAAGGG - Intergenic
1144321632 17:14128704-14128726 GAACTTAAGTACATTATGGATGG + Intronic
1148359585 17:47000758-47000780 GTTCTCAAGGTGACTTTGGAAGG - Intronic
1148972311 17:51494502-51494524 GCTTTTAAGGGGATTATGGAAGG + Intergenic
1149723612 17:58869814-58869836 GTTCTGAAGCAGATTGTGAATGG - Intronic
1150260348 17:63784836-63784858 GTTCCTAAGGAAATAATTGAAGG + Intronic
1155030511 18:21979711-21979733 ATTCTTAAAGACATTATGTAGGG + Intergenic
1155074867 18:22345881-22345903 GTTCTCAAGGACTTTCTGGATGG + Intergenic
1155329776 18:24703375-24703397 GTCTCTAAGGAGATCATGGAGGG - Intergenic
1155603886 18:27581611-27581633 GCTTTTAAGGAGATCATGGAGGG - Intergenic
1155851056 18:30774566-30774588 GTTTTTGAGGGGATCATGGAGGG - Intergenic
1156816279 18:41315449-41315471 GTTTTTAAGAATATTTTGGAAGG - Intergenic
1158872632 18:61703147-61703169 GTTTTTAAGGGGATTCTGGAGGG - Intergenic
1165302079 19:34976672-34976694 GATTTTAAGGGGATCATGGAAGG - Intergenic
1166025088 19:40075719-40075741 GTTCTTATGGCGATTAAGCAGGG + Exonic
1168639217 19:58019735-58019757 GTTCATATGGAGATTCTGGGAGG - Intergenic
929419994 2:41780838-41780860 GTTTTTAAGGGGATCATGGAGGG - Intergenic
929659749 2:43772169-43772191 GTTCTTAAGGTAAGAATGGAAGG - Intergenic
930117313 2:47729610-47729632 GTTTTTAAGGGGATCATGGAGGG + Intronic
930626712 2:53706922-53706944 GTTCCTAAAGACAATATGGAAGG - Intronic
930660158 2:54045246-54045268 GTTTTTAAGGGGATCGTGGAGGG - Intronic
932841297 2:75085283-75085305 GTTTTTTAGGAGATCATGGAGGG - Intronic
933073256 2:77889281-77889303 GTTTTTAAGGATAATTTGGAGGG - Intergenic
933308535 2:80632119-80632141 GTACAAATGGAGATTATGGATGG - Intronic
933611362 2:84439387-84439409 GGTCTTAAGGTGAGCATGGAAGG - Intronic
934479252 2:94619706-94619728 GTTTTTAAGGGGATTGTGGCGGG - Intergenic
935142845 2:100369149-100369171 ATTTTTAAGGGGATTATGAAGGG + Intergenic
937118302 2:119425099-119425121 GTTCTTTGGGAGAGTAAGGATGG - Intergenic
937493293 2:122392387-122392409 GCTTTGAAGGGGATTATGGAGGG + Intergenic
937816491 2:126256511-126256533 GCTTTTAAGGGGATCATGGAGGG - Intergenic
938251054 2:129816027-129816049 GTTTTTAAGGGGAATATGGAGGG + Intergenic
938722775 2:134080992-134081014 GTAATTCAGGAGACTATGGAAGG + Intergenic
940158176 2:150681404-150681426 GTTTTTAAGAGGATCATGGAGGG + Intergenic
940520646 2:154742165-154742187 AATCTTAAGGACATTATGGTAGG - Intronic
941657860 2:168163775-168163797 ATTCTTAAAGAGGTTTTGGAAGG - Exonic
942738110 2:179139808-179139830 GTTTTTAAGGGGATCATGTAGGG - Intronic
943570818 2:189572819-189572841 GTTCTCAATGAGATTCTTGATGG - Intronic
943948578 2:194099341-194099363 GGTCTTCAGGAGAAAATGGAGGG - Intergenic
944749212 2:202690860-202690882 ATTATTAAGGAGGTTATGGGAGG - Intronic
944966903 2:204945250-204945272 GTTCCTAAGGGGATCATGGAGGG + Intronic
947308851 2:228778282-228778304 GTTTTTAAGGGGATCATGGAAGG - Intergenic
949013039 2:241692761-241692783 GTTTTTAAGGGGATCATGGAAGG - Intergenic
1168918343 20:1509978-1510000 GTGCTTAAGAAGATTATGGGTGG + Intergenic
1169720270 20:8668283-8668305 TCTCTTATGGAGATTCTGGAAGG + Intronic
1174972516 20:55292303-55292325 GTGATTATGGAGATTATCGATGG - Intergenic
1175578829 20:60082959-60082981 ATATGTAAGGAGATTATGGAAGG + Intergenic
1176629966 21:9128563-9128585 GTTTTTAACGAAATTATGTAGGG + Intergenic
1177100150 21:16891141-16891163 TTTCATAAGGATATTATGCAAGG - Intergenic
1179461900 21:41541603-41541625 ATTCTTCAGAACATTATGGACGG + Intergenic
1180559818 22:16607043-16607065 GTTATAAAGGACATTAAGGATGG + Intergenic
1180576748 22:16783236-16783258 GTACTTAAGGAGAATCTGAAAGG - Intergenic
1181827072 22:25525683-25525705 TTTTTTAAGGGGATCATGGAGGG + Intergenic
1182832754 22:33316849-33316871 GTTTCTAAGGAGTTTATGGTTGG - Intronic
1183003492 22:34880758-34880780 TTTGTAAAGGAGATTTTGGAGGG + Intergenic
1183024597 22:35055121-35055143 GTTCATAAGGAGATGATCTATGG + Intergenic
1183283510 22:36947561-36947583 GTTTTTAAGGGGATTATAGAGGG - Intergenic
949651864 3:6168961-6168983 ATTCTTAAGGAGATTATGGTAGG - Intergenic
950963709 3:17131419-17131441 GTTCTTAAGGAGAGTCTGATGGG - Intergenic
951394643 3:22150854-22150876 GTTCCTCAGGAGATTATTTAAGG + Intronic
951951628 3:28204679-28204701 TTTCTTCAGGAGCTTTTGGAAGG - Intergenic
952693133 3:36233598-36233620 GCTTTTAAGGGGATGATGGAGGG - Intergenic
956077430 3:65520338-65520360 GTTCTTAACCATATTATTGAAGG - Intronic
956796301 3:72721876-72721898 GATCTTAAGGAGAATAAGGGAGG - Intergenic
957316160 3:78579284-78579306 GTCCTTAAGGAAATTGGGGAAGG + Intergenic
959132939 3:102380515-102380537 CTTCTTAAGGAGATTCTGTTGGG + Intronic
959140206 3:102476872-102476894 TTACTCAAGGAGATTATGGGTGG + Intronic
959309346 3:104713241-104713263 GTTGTTGAGGAGATTTTGGGGGG - Intergenic
962064063 3:131960814-131960836 GGTTTTAAGGGGATTATGGAGGG - Intronic
962095490 3:132288312-132288334 GTTTTTAAGGGGATCATGGAGGG + Intergenic
962976038 3:140446665-140446687 GTTCTTGAGCAGGTTATTGAAGG - Intronic
965302976 3:167026812-167026834 GCTCTCAAGGAGATTATGGATGG - Intergenic
967760890 3:193225331-193225353 GTTTTTAAGGATAATATGGTGGG - Intergenic
968939173 4:3629156-3629178 GTTTTTAAGGGGATCATGGAAGG - Intergenic
970944060 4:21669393-21669415 GTTATTAAGAAAATTATGGCTGG - Intronic
972178408 4:36435969-36435991 CAGCTTAAGGAGATTTTGGACGG + Intergenic
972747859 4:41957721-41957743 GATTCTAAGGAGATTAAGGAAGG - Exonic
972844745 4:42974178-42974200 GTTTTTAAGTGGATCATGGAGGG + Intronic
973746687 4:53970328-53970350 CATCTTAAGGAGATTTTGGGTGG + Intronic
973759381 4:54102252-54102274 GTTCTGAAAGAGAGTAGGGATGG - Exonic
974480538 4:62437581-62437603 GTTTTTAAGGGGATTATGGAGGG + Intergenic
974482377 4:62462170-62462192 GTTCTTATGTAGATTAAGGAGGG + Intergenic
974991434 4:69095255-69095277 GGTTTTAAGGAGATCATAGATGG + Intronic
975021581 4:69497334-69497356 GTTTTTAAGGGGTTAATGGAGGG - Intronic
975094957 4:70447035-70447057 TTTCTTTATGATATTATGGAAGG + Intronic
976333110 4:83854597-83854619 GTTCTTAAGGATGTTAGGAAGGG + Intergenic
976665805 4:87589807-87589829 ATTTTTAAAGAGATTGTGGAAGG - Intergenic
977059483 4:92239545-92239567 GTTTATAAGGGGATCATGGAAGG - Intergenic
980465963 4:133181967-133181989 TTTCTTAAGTAGGTTATTGATGG + Intronic
980771074 4:137373999-137374021 GATTTTAAGGAAATAATGGAGGG + Intergenic
982539198 4:156646058-156646080 ATCCTTAAGGGGATTCTGGAAGG - Intergenic
982706844 4:158719633-158719655 GTACTTAAGGAGATCATTGCTGG - Intronic
982834254 4:160103750-160103772 GTTCTAAGGCAGATTATGGAGGG + Intergenic
983233136 4:165149841-165149863 ATTCTGAAGGTGATTATGAAAGG - Intronic
983263286 4:165480191-165480213 GTTCTTAAAAAGATTAGAGATGG + Intronic
983451564 4:167918212-167918234 GTTTTTAAGGGGATCATGGAGGG + Intergenic
983552093 4:169027923-169027945 GGTCTTAAGGACATTATGCTGGG + Intergenic
983800042 4:171916860-171916882 GTTCTTTTGGAGATTCTGAAAGG - Intronic
988060727 5:26165149-26165171 GTTCTTATTGATATTATGAAAGG + Intergenic
988638818 5:33018177-33018199 GTTCAAAAGAAGAATATGGAAGG + Intergenic
989575628 5:42985494-42985516 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
989700002 5:44252627-44252649 GTTTTTAAGGGGATCATTGAGGG + Intergenic
989797317 5:45491795-45491817 GGTCTTGAGGAAATTATGCAGGG + Intronic
989802409 5:45559399-45559421 GTTCTTAATGACATCTTGGATGG - Intronic
990726352 5:58759215-58759237 GTCCTGAGGGAGATTATAGAAGG + Intronic
991964433 5:72077188-72077210 ATTCGTAATGAGAATATGGATGG - Intergenic
994148432 5:96420718-96420740 GTTCTGAGGGAGAATAAGGAAGG + Intronic
995494743 5:112729382-112729404 GTTGATAAGGTGATCATGGAAGG + Intronic
996276185 5:121668725-121668747 GTTTTTAAGGGGATCGTGGAGGG + Intergenic
999021931 5:148175579-148175601 TTTATTAGGGAGACTATGGAAGG - Intergenic
1000091640 5:157934681-157934703 GTTTTTAAGGAGAATTTGGTGGG + Intergenic
1000415122 5:160976316-160976338 AGCCTTAAGGAGATTCTGGAAGG - Intergenic
1000654496 5:163859925-163859947 GTTCCTAAGGAGCTGATGTATGG + Intergenic
1000928213 5:167219527-167219549 GTTCTTATGAAAATTAGGGAGGG + Intergenic
1002304618 5:178275869-178275891 GTGTTTAAGGGGATCATGGAGGG - Intronic
1003234378 6:4282559-4282581 GGTGTTGAGGAGATTATGGGAGG - Intergenic
1004153234 6:13141350-13141372 GTTCTTTAGGACATCATGAATGG - Intronic
1005995619 6:30929466-30929488 TTTCATATGGAGATAATGGAGGG + Intergenic
1006154143 6:32005264-32005286 GTTCTTCAGGCGATTCAGGAAGG + Intergenic
1006160450 6:32037999-32038021 GTTCTTCAGGCGATTCAGGAAGG + Intergenic
1008043336 6:46826085-46826107 GATCTAAAGGAGTTTATGGTTGG + Intronic
1008122267 6:47632156-47632178 CTTCTTAAGGAGTTTCTGGTAGG + Intergenic
1010201107 6:73282836-73282858 GTTTTTAAGGATAATATGGTGGG - Intronic
1011388651 6:86825768-86825790 GATCTTAGGGAGCTTACGGATGG + Intergenic
1011969836 6:93209484-93209506 TTTCAAAAGGAGATCATGGAAGG - Intergenic
1012569810 6:100710227-100710249 ATTCTTAAAGAGCTCATGGATGG + Intronic
1013095546 6:106941406-106941428 GACTTTAAGGAGATTTTGGAGGG + Intergenic
1013566142 6:111365771-111365793 GTAGTCAAGGAGATTAGGGAAGG + Intronic
1015010190 6:128336699-128336721 GTTCTTAGGGAGATACTTGATGG - Intronic
1017348055 6:153407260-153407282 GTTTTTAAGCAAATTATGGGAGG - Intergenic
1017358695 6:153541317-153541339 GTTTTTAAGGGGATCATGGAGGG - Intergenic
1017358936 6:153543202-153543224 GGTTTTAAGGGGATCATGGAGGG - Intergenic
1019553194 7:1614167-1614189 GTTTTTAAGGGGATCATGGAGGG - Intergenic
1019553666 7:1617788-1617810 GTCTTTAAAGAGATAATGGAGGG + Intergenic
1021224743 7:18013923-18013945 GTTTTTAAGGGAATCATGGAGGG + Intergenic
1022374920 7:29804349-29804371 GTTCCTACGGACATTAGGGAGGG - Intergenic
1023273938 7:38497777-38497799 ATTCTTAAGGAGAGCAAGGATGG + Intronic
1023970728 7:44988828-44988850 GTTTTTAAGGATAATTTGGAGGG + Intergenic
1024943660 7:54787362-54787384 GATATTAAGGAAATTATAGATGG - Intergenic
1026604821 7:71806812-71806834 GTTTTTAAGGGGATTGTGGAGGG - Intronic
1027194681 7:76021611-76021633 GTTTTTAAGGGGATTGGGGAGGG - Intronic
1027250916 7:76398132-76398154 GTTCCTCAGGAGATCAGGGAAGG - Intronic
1028930738 7:96410080-96410102 CTTCTTAAGGTTCTTATGGAAGG - Intergenic
1029900544 7:104034763-104034785 GTTTTTAAGGGGATCATGGAAGG - Intergenic
1031595268 7:123642713-123642735 GTACTTCAGGTGATTATGAAGGG - Intergenic
1033180561 7:139173609-139173631 CTTTTTAAGGAGATGGTGGATGG - Intronic
1033767731 7:144512737-144512759 GTACTTCAGGAAATTATGGGGGG + Intronic
1033951992 7:146796368-146796390 GTTTTTAAGGGGATTGTGGAGGG + Intronic
1034143405 7:148845264-148845286 GTTCTTAAAGGGAATAAGGATGG - Intronic
1034617428 7:152430828-152430850 GTTATAAAGGACATTAAGGATGG - Intronic
1035820344 8:2584551-2584573 TTTCCTATGGAGATTATGGCAGG + Intergenic
1037267589 8:17083075-17083097 GTTCTTAAGGATAATTTGGTGGG + Intronic
1037874866 8:22538356-22538378 CTACTTAAGGAGATTAGAGAGGG + Intronic
1038525881 8:28272885-28272907 GTTTTTAGGGGGATCATGGAGGG + Intergenic
1039258577 8:35745952-35745974 CTTCTTAAGGAAATCATAGATGG - Intronic
1040936911 8:52791003-52791025 GTTTTTAAGGAAATCATGGAGGG + Intergenic
1040985572 8:53290630-53290652 GTTTTTAAGGAGATCATGAAGGG + Intergenic
1041936763 8:63340612-63340634 GTTTTTAAGGGGATCATGGAGGG + Intergenic
1042255963 8:66804048-66804070 GTTTTAAAGGAGATCATGTATGG - Intronic
1042258061 8:66826939-66826961 GTTCTTAAGAAGTTTCTGAACGG - Intronic
1044912817 8:97079620-97079642 GTCCTTAAGGAGTTAATGGAGGG + Intronic
1045797192 8:106060056-106060078 GTTTTTAATGGGATCATGGAGGG - Intergenic
1046470138 8:114661912-114661934 GTTTTTAAGGGGATCATGGAGGG - Intergenic
1048028440 8:130608370-130608392 GGTCTGATGGAGAATATGGACGG + Intergenic
1048893825 8:138970878-138970900 GTTTTTAAGGGGACCATGGAGGG + Intergenic
1049699428 8:144002480-144002502 CTTCTGAAGAAGATTCTGGATGG + Intronic
1049864109 8:144922504-144922526 GTTTTTAAGGGGATCATGGAGGG + Intergenic
1050685166 9:8160235-8160257 GTTCCTAAGATGATTATTGATGG - Intergenic
1052240162 9:26261957-26261979 GTTTTTAAGGAGATCATGGAGGG + Intergenic
1052477827 9:28983482-28983504 GTTCTTAAGTATAAAATGGAAGG + Intergenic
1052732625 9:32307470-32307492 ATTTTTAAGGGGATTGTGGAGGG - Intergenic
1052918520 9:33943290-33943312 TTTCTTATGGAGATGATGGAAGG + Intronic
1053678577 9:40463859-40463881 GTTTTTAAGGGGATTGTGGCGGG + Intergenic
1053900632 9:42792691-42792713 GTTTTTAAGGATAATATGGCAGG + Intergenic
1053928562 9:43092213-43092235 GTTTTTAAGGGGATTGTGGCGGG + Intergenic
1054285147 9:63161083-63161105 GTTTTTAAGGGGATTGTGGCGGG - Intergenic
1054291655 9:63299397-63299419 GTTTTTAAGGGGATTGTGGCGGG + Intergenic
1054389671 9:64603940-64603962 GTTTTTAAGGGGATTGTGGCGGG + Intergenic
1054506041 9:65912436-65912458 GTTTTTAAGGGGATTGTGGCGGG - Intergenic
1056415253 9:86369141-86369163 GTTTTTAAGGAGATTTTGGAGGG + Intergenic
1056579287 9:87878724-87878746 GTTTTTAAGGAGATTGTGGAGGG - Intergenic
1058185981 9:101855411-101855433 GTTATCTAGGAGATTATAGAGGG - Intergenic
1061863968 9:133482582-133482604 GCTTTTAAGGGGATCATGGAGGG + Intergenic
1203752801 Un_GL000218v1:96248-96270 GTTTTTAACGAAATTATGTAGGG + Intergenic
1186189295 X:7053303-7053325 GTTCCCAAAGAGATAATGGAAGG + Intronic
1186225632 X:7396134-7396156 GCTTTTAAGGGGATTGTGGAGGG + Intergenic
1187473387 X:19588908-19588930 TTTCTGAAGGTGATCATGGAAGG + Intronic
1188286292 X:28328898-28328920 GTTTTTAAGGATAATTTGGAGGG + Intergenic
1189906281 X:45763356-45763378 GTTCCTAAAGGGATTTTGGAAGG + Intergenic
1189933674 X:46041741-46041763 GTTTTTAAGAGGATCATGGAGGG + Intergenic
1192324308 X:70119204-70119226 GTTTCTAAGGGGATCATGGAGGG + Intergenic
1195390587 X:104358071-104358093 GTTTTTAAGCGGATTGTGGAGGG + Intergenic
1195527685 X:105910678-105910700 GTTTTTAAGGGGATTGTAGAGGG + Intronic
1196614680 X:117754462-117754484 GTTATTAAGAAGATAATTGAGGG - Intergenic
1197557758 X:127976802-127976824 GTTTCTAAGCAGCTTATGGATGG + Intergenic
1197957228 X:131964708-131964730 CTGCTTAAGGAGATTTTGGGCGG - Intergenic
1199619102 X:149683400-149683422 GTTTTTAAGAGGATCATGGAGGG + Intergenic
1201166442 Y:11213818-11213840 GTTTTTAACGAAATTATGTAGGG + Intergenic
1201667519 Y:16475187-16475209 GTTCTTGAGGGTATTGTGGAGGG + Intergenic