ID: 900389860

View in Genome Browser
Species Human (GRCh38)
Location 1:2429123-2429145
Sequence CTGGGGATTGGGTGCGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 471
Summary {0: 1, 1: 0, 2: 5, 3: 37, 4: 428}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900389850_900389860 -6 Left 900389850 1:2429106-2429128 CCAAGGGGCCCTCCTTCCTGGGG 0: 1
1: 0
2: 5
3: 54
4: 359
Right 900389860 1:2429123-2429145 CTGGGGATTGGGTGCGAGGAGGG 0: 1
1: 0
2: 5
3: 37
4: 428
900389841_900389860 25 Left 900389841 1:2429075-2429097 CCTGGGGTGTGCAGGGTGAGGGG 0: 1
1: 0
2: 3
3: 60
4: 579
Right 900389860 1:2429123-2429145 CTGGGGATTGGGTGCGAGGAGGG 0: 1
1: 0
2: 5
3: 37
4: 428

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900389860 Original CRISPR CTGGGGATTGGGTGCGAGGA GGG Intronic
900389860 1:2429123-2429145 CTGGGGATTGGGTGCGAGGAGGG + Intronic
900401678 1:2475332-2475354 CTGGGCAGTGGGTGGGAAGAAGG + Intronic
900636797 1:3669837-3669859 GTGGGGATTTGCTGTGAGGAGGG + Intronic
900643229 1:3697188-3697210 CTGAGCAGTGGGTGCGAGGTGGG - Intronic
900651502 1:3732307-3732329 CTGGGGACAGGTTGCGGGGAGGG - Intronic
900662302 1:3790798-3790820 CTGGGGAATGGCTGTGGGGATGG + Intronic
901891843 1:12273561-12273583 CAGGGGATGGGGAGCGAGAAGGG - Intronic
902299797 1:15493804-15493826 CTGGGGATTTGGGGTGAGCAGGG - Intronic
902568771 1:17333164-17333186 CTAGGGAGTGGGTGGGAGGCAGG + Intronic
902774252 1:18664445-18664467 CTGGGGAAGGGGAGGGAGGAGGG + Intronic
902844720 1:19100860-19100882 TCGGGGAAGGGGTGCGAGGAGGG + Intronic
904616085 1:31750709-31750731 CTGGGGATGGGGTGCCATGGGGG - Intronic
905189851 1:36224871-36224893 ATGGGGACTGGGTGGGGGGAAGG - Intronic
905330484 1:37192050-37192072 CTGGGGAATGGGTGGGATGGGGG - Intergenic
905347339 1:37319866-37319888 CTGGGGATTGGGAATGAGGAAGG + Intergenic
905393252 1:37651389-37651411 CTGGGGATTGGAGGGGTGGAGGG - Intergenic
905972591 1:42153261-42153283 AAGGGGGTTGGGGGCGAGGAGGG - Intergenic
906350161 1:45052125-45052147 TTGGGGGTGGGGTGCGAGGGGGG - Intronic
906545311 1:46616078-46616100 CTGGGAAATGGGGGCTAGGACGG - Intronic
906791907 1:48666232-48666254 CTGGAGATTTGGTGACAGGAGGG - Intronic
907458706 1:54592626-54592648 CTTGGGAGTGGGTGCGTGGGTGG + Intronic
907695312 1:56720760-56720782 CTGGGGATAGGGTGCGGGGAGGG - Intronic
907898002 1:58710851-58710873 ATGGGGATGGGCTGCGAGTAGGG - Intergenic
908286722 1:62612376-62612398 CAGGGGGTTGGGTGCAAGGGAGG + Intronic
908359037 1:63349600-63349622 GTGGGGATGGGGTTCAAGGATGG - Intergenic
910478536 1:87634228-87634250 CTGGGGAATGGGTGGGGGGAGGG + Intergenic
911666062 1:100554016-100554038 CTGGGGAAAGGGTGGGAGGGGGG - Intergenic
912956518 1:114157432-114157454 CTGGGGACTTGGAGGGAGGAGGG - Intergenic
915310488 1:155003836-155003858 CTTGGGATGGGGTGGGAGGAGGG - Intronic
915343244 1:155187521-155187543 CTGGGGCTGGGGTGCCAGGCTGG - Exonic
915481764 1:156191338-156191360 CTGGAGATTGAGGGAGAGGATGG - Intergenic
915589929 1:156864876-156864898 CCGGGGAATGATTGCGAGGAGGG + Intronic
915913877 1:159929981-159930003 ATGGGGATGGGGTACCAGGAGGG + Intronic
916058101 1:161081798-161081820 CTGGGGTGGGGGTGGGAGGAGGG - Intronic
916226396 1:162493952-162493974 TTGGGGATGGGATGGGAGGAGGG + Intergenic
919802054 1:201359983-201360005 CTGGGGCTGGGCTGCTAGGAGGG - Intronic
920181623 1:204135273-204135295 CCAGGGATTGGATGGGAGGAGGG + Intronic
921284275 1:213594957-213594979 CTGGGGGTTGGGAGAGAGGTGGG + Intergenic
922213095 1:223500300-223500322 CTGGGGATTGGGGGGAATGATGG + Intergenic
922762784 1:228142795-228142817 ATGGGGTTTGGGGCCGAGGAGGG + Intronic
924719052 1:246605923-246605945 CTTGGGACTGGGTCTGAGGAGGG + Intronic
924722247 1:246635050-246635072 CTTGGGACTGGGTCTGAGGAGGG + Intronic
924944701 1:248838451-248838473 CTGGGGCGGGGGAGCGAGGAAGG - Exonic
1062788947 10:289203-289225 CTGGGGACAGGGTGCGGGCAGGG + Intronic
1062976900 10:1690768-1690790 CTGGGGAGGGGGTGACAGGAAGG - Intronic
1063439403 10:6060256-6060278 CAGGGGAAAGGGTGCGAGGTGGG + Intronic
1063751656 10:8955485-8955507 TTGGGGGTTGGGTGCGGGGAGGG + Intergenic
1064367633 10:14722197-14722219 TTAGGGATTGTGTGGGAGGAAGG - Intronic
1064996254 10:21299448-21299470 CTGGGGAGTGGGTTGAAGGAGGG - Intergenic
1067972954 10:50992245-50992267 CTGGAGCGTGGGGGCGAGGAGGG + Intronic
1069415246 10:68194490-68194512 CTGGGGGTTGGCTGCCATGATGG - Exonic
1069557341 10:69406921-69406943 CTGGGGGCTGAGTGTGAGGACGG + Intronic
1069789670 10:71011591-71011613 CTGGGGAGGGTGTGGGAGGATGG + Intergenic
1069863037 10:71483113-71483135 CTGGGGCCTGGGTGCCAGTAAGG + Intronic
1069903322 10:71718348-71718370 GTGGGGAATGGGTGGGAGGTGGG - Intronic
1070126430 10:73625855-73625877 CTGGGGAGGGGGTGCGGGGAAGG - Intronic
1071527047 10:86365066-86365088 CTGGGGGCTGGGTAGGAGGAGGG + Intronic
1071563522 10:86660157-86660179 CTGGTCCTAGGGTGCGAGGATGG - Intronic
1071643662 10:87341759-87341781 CTGGGGATTTGGGGAGACGATGG + Intergenic
1072719193 10:97770537-97770559 CTGAGGGGTGGGTGGGAGGAGGG + Intronic
1073068910 10:100781230-100781252 CTGGGAACTGGATGAGAGGAAGG - Exonic
1073139809 10:101239633-101239655 CTGGAGAATGGGGGCGGGGAGGG - Intergenic
1074735285 10:116424973-116424995 CACGGGATGGGGTGGGAGGATGG - Intergenic
1074886372 10:117696813-117696835 CTGGGGATTGGGTGGGACAGGGG + Intergenic
1075455425 10:122581932-122581954 CTGTGGGTTGCGTGGGAGGAAGG + Intronic
1075457548 10:122594635-122594657 CTGTGGGTTGCGTGGGAGGAAGG + Intronic
1075458629 10:122601130-122601152 CTGTGGGTTGCGTGGGAGGAAGG + Intronic
1075459260 10:122605189-122605211 CTGTGGGTTGCGTGGGAGGAAGG + Intronic
1075459892 10:122609248-122609270 CTGTGGGTTGCGTGGGAGGAAGG + Intronic
1075460524 10:122613307-122613329 CTGTGGGTTGCGTGGGAGGAAGG + Intronic
1075461155 10:122617367-122617389 CTGTGGGTTGGGTGGGAGGAAGG + Intronic
1075638155 10:124044485-124044507 CTGGGGTTGGGGGGCGAGGGCGG - Intronic
1076746659 10:132517969-132517991 CTGGGGACAGGGTGCAAGGCTGG - Intergenic
1077468670 11:2746609-2746631 CTGGGCTGTGGGTGTGAGGAGGG + Intronic
1077557017 11:3230780-3230802 CGGGGCCTTGGGTGCTAGGATGG - Intronic
1077610192 11:3639217-3639239 CTGGGTCTTGGGTGGGAAGAGGG - Intronic
1078314407 11:10280828-10280850 CTGGGGATTGGGGGTGGGGGAGG + Intronic
1078708034 11:13764213-13764235 CTGGGGAGTGGGGCAGAGGATGG - Intergenic
1080506823 11:32923268-32923290 CTGGGGACTTGGTGGTAGGATGG + Intronic
1082693902 11:56336813-56336835 CTGGGGAATGGATGAGAGAAAGG + Intergenic
1083490022 11:63009217-63009239 CTGGGGATTGGGATGAAGGAGGG + Intronic
1083663980 11:64265008-64265030 CTGGGGGTGGGGTTTGAGGACGG - Exonic
1083994530 11:66265585-66265607 CTGTGGGCTGGGTGCCAGGATGG + Intronic
1084389115 11:68863484-68863506 CTGGGGAGGGGGTGGCAGGAGGG - Intergenic
1084432234 11:69117514-69117536 CTGGGGAAGGGGAGCGAGAAGGG + Intergenic
1084677128 11:70642033-70642055 CGGGGGACTGGGTACCAGGATGG + Intronic
1085256231 11:75175120-75175142 CTGGGGATGGGGAGTGGGGAGGG + Intronic
1085510697 11:77086704-77086726 CAGGGGATGGAGTGGGAGGAGGG - Intronic
1085514890 11:77106250-77106272 GTGGGGGTTGGGTGCGGGGCTGG - Intronic
1085654718 11:78303039-78303061 CTCGGGAAAGGGTGAGAGGAGGG + Intronic
1085986061 11:81789932-81789954 CGGGGGAAAGGGTGGGAGGAGGG + Intergenic
1086887951 11:92225463-92225485 CTGGGGAGGGGTTGCGAGGGGGG + Intergenic
1086976941 11:93142943-93142965 TTGGGGGTGGGGTGGGAGGAGGG + Intergenic
1088972701 11:114787605-114787627 CTGGGGAGTTGGAGAGAGGAGGG + Intergenic
1089224690 11:116907906-116907928 TTGGGGATAGAGTGTGAGGATGG - Intronic
1089307372 11:117535167-117535189 ATGGGGATGGTGTGGGAGGAGGG + Intronic
1089607328 11:119648913-119648935 CTGGGGCTTGGGTCTGAGGCTGG + Intronic
1090114629 11:123955489-123955511 CAGGGGGTTGGGTGGGAGGAAGG + Intergenic
1090803316 11:130187985-130188007 CAGGGGCTTGGGTGAGAAGAAGG - Intronic
1091693371 12:2611779-2611801 CTGGGGGTTTGGTTCAAGGAAGG + Intronic
1091994455 12:4982294-4982316 TTGGGGTTTGGGTGGGTGGATGG + Intergenic
1092128388 12:6091281-6091303 ATGGGGGGTGGGTGGGAGGAGGG + Intronic
1092147260 12:6223221-6223243 CTGGGGTTGGGGTGGAAGGAGGG + Intronic
1092880691 12:12885668-12885690 CTGGGGACTGGGTGTGGGGCGGG + Intergenic
1094365213 12:29672638-29672660 ATGAGGATGGGGTGAGAGGAGGG - Intronic
1095225234 12:39671377-39671399 CTGGGGATGGGATGCCAGGTGGG + Intronic
1095662720 12:44756501-44756523 GTGGGGAGTGGGTGGGAGAAGGG - Intronic
1096618449 12:52847759-52847781 CTGGGGAATGGGGACGCGGAGGG + Intronic
1096854846 12:54473576-54473598 CTGGGGCTTGCGTGGGAGGAAGG - Intronic
1096909211 12:54965338-54965360 CAGGGGATGGGGTGAGAGGAGGG - Intronic
1097637139 12:62136980-62137002 CTGGGGATGGGGGTGGAGGATGG - Intronic
1098061943 12:66572414-66572436 TTGGGGGTGGGGTGGGAGGAAGG - Intronic
1099111013 12:78561030-78561052 CTGGGGAGTGGGTGAGATGGAGG - Intergenic
1099676424 12:85766689-85766711 CTAGTGATTGGGTTCCAGGATGG - Intergenic
1101191049 12:102332930-102332952 CTGGGGACAGGGTGCCTGGAAGG + Intergenic
1101966285 12:109284399-109284421 CTGGGGCTGGGCTGGGAGGAGGG + Intronic
1102025039 12:109709649-109709671 CTGGGGGTGGGGTGGGAGGCTGG + Intergenic
1103247877 12:119473600-119473622 CTGGGGGAAGGGTGGGAGGAGGG - Intronic
1104613362 12:130248421-130248443 CTGGGGATTTGGAGCAAGAAAGG - Intergenic
1106556497 13:30813320-30813342 CAGGGGTTTAGGTGCAAGGATGG - Intergenic
1107802003 13:44117055-44117077 GTGGGGATTGGGAAAGAGGATGG + Intergenic
1107955412 13:45506570-45506592 CTGGGGTAGGGGTGTGAGGATGG + Intronic
1108323355 13:49307115-49307137 CTGGGGATGGGGGGCGGGTATGG - Intergenic
1108432815 13:50371353-50371375 CTGGGGATTGGGTGCAAGAATGG + Intronic
1108783614 13:53867737-53867759 CTTGGGTTTGGGTGGGAGAAGGG + Intergenic
1109018733 13:57056280-57056302 CTGGGGATAGGCTGGGAGAAAGG + Intergenic
1111993421 13:95139038-95139060 CTTGGGATTGGCTCCGTGGAAGG - Intronic
1112025390 13:95406659-95406681 CTTGGGGTTGGGGGCGAGGAGGG + Intergenic
1113264186 13:108598995-108599017 CTGGGGATGGGGTGGGGGGAGGG - Intronic
1114482268 14:23043160-23043182 CTGGGGAGTGGGTGGGAGGATGG + Exonic
1116489564 14:45490057-45490079 TTGGGGCTGGGGTGGGAGGAGGG + Intergenic
1116502678 14:45639361-45639383 CTGGGGTTGGGGTTGGAGGACGG + Intergenic
1117065273 14:52007615-52007637 CTGGGGTTTGGGTGGAGGGAAGG - Exonic
1117943375 14:60992619-60992641 CTGGGGACTGAGTGTGAGGTGGG + Intronic
1118086477 14:62423680-62423702 CAGGGGATGGGGGGCAAGGAGGG + Intergenic
1118776266 14:68976268-68976290 CAGGGGAGTGAGTGTGAGGAGGG - Intronic
1119585758 14:75833296-75833318 CTGGGGACTGGGTGACAGGAGGG - Intronic
1121615127 14:95308649-95308671 ATGGGGAGTGTGTGCGGGGAGGG - Intronic
1122012811 14:98766745-98766767 CTATGGATTGGGTGCAGGGAGGG - Intergenic
1122078670 14:99252108-99252130 CTGGGGTTTGGGTGTTGGGATGG - Intronic
1122154596 14:99742554-99742576 CTGGGGCTGGGGTGCTGGGACGG + Intronic
1122292783 14:100688468-100688490 CTGGGGGTGGGGGGCCAGGAAGG - Intergenic
1122300316 14:100727535-100727557 CTGGGAATTGGGGGCTAAGACGG - Intronic
1122572751 14:102718575-102718597 CTGAGGGTTGGGTGGGAGGGTGG + Intronic
1122779422 14:104137428-104137450 CTGGGGAGTGCGTGCGTGGGCGG + Intergenic
1122825749 14:104369660-104369682 CTGGGGGTGGGGTGAGGGGAGGG - Intergenic
1122848064 14:104511459-104511481 CTGGGGTGTGGGTGGGAGGCTGG - Intronic
1202902290 14_GL000194v1_random:50805-50827 CTGGGGATTGGGAGAGTGGCCGG - Intergenic
1124064063 15:26323221-26323243 CTGGTGAGTGGGTGGTAGGAGGG + Intergenic
1124594469 15:31081647-31081669 CTGTGGCTTTGGTGCGAGGTTGG - Intronic
1127294005 15:57593873-57593895 CTGGGGATTGTGTGTGTGGTGGG + Intronic
1128567731 15:68712152-68712174 CTGGGTCTTGGGTTTGAGGAAGG + Intronic
1128658591 15:69481198-69481220 CTGTGGGTTGGGTGCGGGAATGG - Intergenic
1130028256 15:80288735-80288757 CTGGGGACTTTGTGTGAGGATGG - Intergenic
1130109650 15:80953982-80954004 CTGGGGATTGGGGATGAGGAAGG - Intronic
1130206391 15:81879524-81879546 ATTGGGATTGGGTGGGTGGATGG - Intergenic
1132323590 15:100946301-100946323 GAGGGGATGGGGTGAGAGGAGGG + Intronic
1132532595 16:460456-460478 CAGGGGATGGGGTGGGAGGGGGG - Intronic
1133226834 16:4344790-4344812 GAGGGGATTGTGTGAGAGGAGGG + Intronic
1133226838 16:4344808-4344830 GAGGGGATTGTGTGAGAGGAGGG + Intronic
1135177424 16:20242900-20242922 CTGGGAATTGGGATGGAGGATGG + Intergenic
1135238586 16:20782390-20782412 CTGGGGAAAGGGTGGGAGGTGGG - Intronic
1135563541 16:23494606-23494628 CTGGGGGTTGGCTGAGGGGAGGG - Intronic
1136412051 16:30083287-30083309 CTGGGCAGTGGTTGTGAGGATGG + Intronic
1136867278 16:33768261-33768283 GTGGGGTTTGGCTGAGAGGATGG - Intergenic
1137720429 16:50624621-50624643 CTGGGGCGCAGGTGCGAGGAAGG + Intronic
1138482691 16:57314274-57314296 CAGGGGATAGGGTGTGAGGCTGG + Intergenic
1138535268 16:57656633-57656655 CTGGGGTGTGGCTGCGAGGTGGG - Intronic
1139640942 16:68290888-68290910 CTGGGGACTGGATGCCAGGCTGG - Intronic
1140503866 16:75457519-75457541 CTGGGATTAGGGTGCCAGGATGG - Intronic
1141663803 16:85455497-85455519 CTGAGCATGGGGTGTGAGGAGGG - Intergenic
1141695113 16:85615406-85615428 CTGCGGGCCGGGTGCGAGGATGG + Intronic
1142004733 16:87684297-87684319 GTGGGGAGGGGGTGCGTGGATGG + Intronic
1142267747 16:89072279-89072301 CTGGGGAGGGGGTACAAGGATGG + Intergenic
1203104884 16_KI270728v1_random:1347942-1347964 GTGGGGTTTGGCTGAGAGGATGG + Intergenic
1203128630 16_KI270728v1_random:1614426-1614448 GTGGGGTTTGGCTGAGAGGATGG - Intergenic
1143481117 17:7227880-7227902 ATGGGGAATGGGTGGGAGGAGGG - Intronic
1143636536 17:8167022-8167044 CCTGGGATTGGGTGCGTGAAAGG + Intergenic
1144196951 17:12903743-12903765 CAGGGGAAAGGGTGGGAGGAGGG - Intronic
1144432466 17:15206769-15206791 CAGGGGGTGGGGTGGGAGGAAGG + Intergenic
1144484003 17:15650094-15650116 CTAGGGATTGGCAGAGAGGAGGG + Intronic
1146002269 17:29138488-29138510 CTAGGGATTGAGGGCGAGGAAGG + Intronic
1146374564 17:32285391-32285413 CTGGGGAGTGGGGGCCGGGAGGG + Intronic
1146591613 17:34132394-34132416 CTGGGGATGGAGTGCGAGCCGGG + Intronic
1146955710 17:36935487-36935509 CGGGGGAGGGGGTGCTAGGAAGG - Intergenic
1147605911 17:41773620-41773642 CTGGGGAAGGGGTGTGGGGAAGG - Intronic
1147935599 17:44008856-44008878 CTGGGGATTAGGGGAGGGGAGGG + Exonic
1149304428 17:55334604-55334626 CTGGGAAGGGGGTGAGAGGAAGG + Intergenic
1149505610 17:57191303-57191325 CTGTGGATTGGGTGAGAGGCAGG + Intergenic
1149849795 17:60027542-60027564 CTGGGGCTGGGGTGTGGGGAGGG + Intergenic
1149860373 17:60118982-60119004 CTGGGGCTGGGGTGTGGGGAGGG - Intergenic
1150091735 17:62332438-62332460 CTGGGGGTGGGCTGGGAGGAAGG + Intergenic
1152541411 17:80978583-80978605 CTGGGGATTCGGTGCCAACAGGG - Intergenic
1152636593 17:81432830-81432852 CTGGGGATGGGGGGGGAGGGTGG - Intronic
1152636621 17:81432879-81432901 CTGGGGATGGGGGGGGAGGTTGG - Intronic
1152862408 17:82703819-82703841 GTGGGGGTTGGGTGAGAGGTGGG - Intergenic
1155312011 18:24533125-24533147 CTGGGGTTGGGGTGGGAGTAGGG + Intergenic
1157810083 18:50688731-50688753 CTGGGGAAAGGGTGGGAGGGGGG + Intronic
1157824196 18:50797748-50797770 CCGGGGAGTGGGTGCTAGGGAGG + Intronic
1158565657 18:58552210-58552232 CTGGGGTTGGGGTGGGAGGTAGG - Intronic
1159453564 18:68633036-68633058 CAGGGGAAAGGGTGGGAGGAGGG - Intergenic
1160974449 19:1785728-1785750 CTTGGGATTGGGTGGGGGGCGGG + Intronic
1161055378 19:2188332-2188354 CTGGGGCTGGGGTGGGAGCAGGG + Intronic
1161347829 19:3776918-3776940 ATGGTGATTGGGTGGGTGGATGG + Intergenic
1161520744 19:4722466-4722488 CTGGGGTTTGGCAGCCAGGAAGG - Intronic
1162581079 19:11530749-11530771 CTGGGGAGTGGGTAAGATGATGG + Intergenic
1163128276 19:15256307-15256329 CTGGGTCTTGGGTGACAGGAAGG - Intronic
1163210760 19:15838463-15838485 CTGGGGATTGGGGGTGGGGGTGG + Intergenic
1163587760 19:18173280-18173302 GTGGGGGTTGGGTGTGAGGGAGG + Intronic
1163698101 19:18774167-18774189 CTGGGGTGTGGAGGCGAGGAGGG - Intronic
1163719404 19:18891576-18891598 CTGGGGGTTGGGGGTGTGGAGGG - Intronic
1165792829 19:38502349-38502371 GTGGGCATAGGGTGGGAGGAGGG + Intronic
1166251788 19:41576354-41576376 CCTGGGAGTGGGTGGGAGGAGGG + Intronic
1166266528 19:41688064-41688086 CCTGGGAGTGGGTGGGAGGAGGG - Intronic
1166411994 19:42561655-42561677 CTTGGGAGTGGGTGGGAGGAGGG - Intergenic
1167120205 19:47512281-47512303 CTGGGGAGTGGGGCCGGGGAGGG - Intronic
1167518943 19:49940517-49940539 CTGGGGATGGGATGCCAGGTGGG - Intronic
1167621796 19:50564873-50564895 TTGGGGATTGGGGGCGGGGGTGG - Intronic
1167748803 19:51367933-51367955 CTGCGGATTCGGTGCGACGAGGG - Exonic
1168467445 19:56614883-56614905 CTGGGGATGGGGGTTGAGGAAGG - Intronic
925878916 2:8334174-8334196 CAGCGGGTTGGGTGCGGGGAGGG + Intergenic
926254928 2:11185037-11185059 CTGGGGTATGGGAGTGAGGAGGG - Intronic
927499765 2:23574943-23574965 CTGAGGAATGGGTGGGAGGGTGG + Intronic
928142928 2:28746246-28746268 TTGGGGTTTGGTTGCCAGGAAGG - Intergenic
929547113 2:42862930-42862952 CTGGGAATTGGCTGCGAGTTGGG + Intergenic
930459388 2:51652595-51652617 ATGGGGATTGTGTGAGAGGGAGG - Intergenic
930570820 2:53084626-53084648 CTGGGGATTTGGTGGTGGGAAGG + Intergenic
931168693 2:59779011-59779033 CTGGGGATTGGGGGAGTGGAGGG + Intergenic
932780738 2:74556924-74556946 CTGGGGCTTGGGAGCAAGGAGGG - Exonic
933725136 2:85422528-85422550 CTGGGGATGGGGAGGTAGGAGGG + Intronic
934504378 2:94879603-94879625 CTGGGGATTGGGAGAGTGGCCGG + Intergenic
934578985 2:95423221-95423243 CGGGGGAAAGGGTGGGAGGAGGG + Intergenic
934600462 2:95653482-95653504 CGGGGGAAAGGGTGGGAGGAGGG - Intergenic
934808909 2:97265206-97265228 CTGGGGCCTGGGGGAGAGGATGG + Intergenic
934828596 2:97491963-97491985 CTGGGGCCTGGGGGAGAGGATGG - Intergenic
935953881 2:108355349-108355371 CTGTGGTTTGTGTGTGAGGATGG - Intergenic
936020050 2:108988041-108988063 CTGGGGACTGGGGAAGAGGACGG + Intronic
936070729 2:109369569-109369591 CTGGGGGTTGGGGGAGAGGATGG + Intronic
936386112 2:112030744-112030766 CTGGAGATTGGGTGCCTGGGTGG - Intergenic
936533820 2:113295543-113295565 CGGGGGAAAGGGTGGGAGGAGGG - Intergenic
937373542 2:121319528-121319550 CTGGGAATTGGGTGAGGGGCAGG - Intergenic
937819744 2:126296174-126296196 CTGGGGATTGGGTTTAGGGAGGG + Intergenic
939558701 2:143708541-143708563 GTGGGGATTGGGTATGAGAATGG - Intronic
939629849 2:144517558-144517580 CTGGGGGTGGGGGGCGGGGAGGG - Intronic
939936381 2:148298389-148298411 CTGGTGAGTGGGAGTGAGGAAGG + Intronic
939990902 2:148875967-148875989 GTGGGGATGGGGGGCGAAGACGG + Intronic
941211966 2:162651357-162651379 TTGGGGGTGGGGTGGGAGGAGGG - Intronic
941373738 2:164701880-164701902 CTGGGGATGTGGTGGGAGGGGGG + Intronic
941714810 2:168752584-168752606 CTGGTGATGGGGTGCGAACAAGG + Intronic
941809995 2:169745957-169745979 CTGGGGATTGTTTGCTTGGATGG + Intronic
942255521 2:174093205-174093227 TTGGGGATTTGGTGGGAAGATGG + Intronic
942378788 2:175365209-175365231 CTGGGGTGGGGGTGAGAGGATGG - Intergenic
944969262 2:204973099-204973121 CTGGGGACTGGCTGCAAGGGAGG - Intronic
945045074 2:205774708-205774730 CTGGGGAATAGGTGGGAGGTGGG - Intronic
947039773 2:225903590-225903612 GTGGGGATTGTGTGGGAGGTAGG + Intergenic
947232697 2:227903694-227903716 CTTGGGCTGGGGTGGGAGGAAGG - Intronic
947810009 2:232998218-232998240 CAGGGGATGGGGTGGGAGTAGGG + Intronic
948286948 2:236793395-236793417 CAGGCCATTGGGTGCGAGGGTGG - Intergenic
948643319 2:239388725-239388747 GTGGGGAGTGGGGGCCAGGAAGG - Intronic
1169975218 20:11317994-11318016 TTGGGGAAAGGGTGGGAGGAGGG - Intergenic
1170828098 20:19814369-19814391 CTGGGGAGGGGGTGGGAGGAGGG - Intergenic
1172029982 20:31975043-31975065 CTGGGGAGTGGGAGGGCGGAGGG + Intronic
1172434785 20:34921301-34921323 CAGGGGAATGGGAGAGAGGAAGG - Intronic
1172758056 20:37301379-37301401 CTTGGGAATGGGTACGATGATGG - Exonic
1172771279 20:37384069-37384091 CTGTGGAATGGGTGGGAGGGAGG + Intronic
1172772402 20:37389298-37389320 CTGGAATTTGGGTGGGAGGAAGG - Intronic
1173837973 20:46138284-46138306 CAGGGGATGGGGTGGCAGGAGGG - Intergenic
1174791915 20:53486841-53486863 CTGGGGCTGGGGAGGGAGGAAGG - Intronic
1176178076 20:63737957-63737979 GTAGGGACTGGGGGCGAGGAAGG - Exonic
1176554026 21:8245313-8245335 CTGGGGAGGGGGTGGGGGGAAGG - Intergenic
1176572948 21:8428337-8428359 CTGGGGAGGGGGTGGGGGGAAGG - Intergenic
1176621658 21:9065572-9065594 CTGGGGATTGGGAGAGTGGCCGG - Intergenic
1178396895 21:32250729-32250751 CTGGGAAATAGGTGAGAGGAGGG - Intergenic
1178493314 21:33067934-33067956 TTGGGGATTGGGTGTAAGGATGG - Intergenic
1178598311 21:33974647-33974669 AGGGGGATGGGGTGGGAGGAAGG - Intergenic
1179985822 21:44919821-44919843 GGGGGGATTGGGTGTGGGGACGG + Intronic
1180049308 21:45324120-45324142 CTGAGGGTTGGGAGGGAGGAGGG - Intergenic
1181033288 22:20158270-20158292 CTGGGGCTTGGGTGGGAGTGGGG + Intergenic
1181520752 22:23448269-23448291 CTGGGGATGCGGGGTGAGGAGGG - Intergenic
1181852705 22:25761453-25761475 CTGGAGTTTGGGTGGGAGGAGGG + Intronic
1182073588 22:27479810-27479832 CTGGGGGTGTGGTGGGAGGATGG - Intergenic
1182279149 22:29208206-29208228 CTGGGGTGTGGGTGGCAGGAAGG - Intronic
1182355255 22:29719932-29719954 CTGGGGGTGGGGAGCGCGGAGGG + Intergenic
1182373462 22:29828736-29828758 ATGGGGAAAGGGTGGGAGGAAGG + Intronic
1183057344 22:35315110-35315132 GTGGAGAATGGGTGGGAGGAGGG + Intronic
1183321366 22:37167060-37167082 CTGGGGGTTAGGTGGGATGAGGG - Intronic
1183460547 22:37947351-37947373 GTGGGGACGGGCTGCGAGGATGG + Exonic
1185097784 22:48821160-48821182 GTGAGGATTCGGTGAGAGGATGG + Intronic
1185229276 22:49670914-49670936 CTGGGGATGGGGAGGGAGGCTGG + Intergenic
1203259031 22_KI270733v1_random:162351-162373 CTGGGGAGGGGGTGGGGGGAAGG - Intergenic
949465019 3:4335188-4335210 GTGAGGAATGGGTGGGAGGATGG - Intronic
949509546 3:4756179-4756201 CTGGGGATTACTTGAGAGGAGGG + Intronic
950149623 3:10676495-10676517 ATGGGGATGGGGAGGGAGGAGGG + Intronic
950556369 3:13698634-13698656 CTGGGGTCTGGGGGCGGGGAGGG - Intergenic
950761682 3:15235550-15235572 CTGGGGGGTGGGTGGGAGCATGG + Intronic
950791196 3:15473820-15473842 CTGGGGAGAGGGTGGCAGGATGG - Intronic
951696282 3:25448884-25448906 CTGGGGATTGCGGGGGTGGAGGG - Intronic
955513189 3:59701315-59701337 CTGGGGCTCAGGTGCGAGGTAGG - Intergenic
956406523 3:68933368-68933390 CTAGGAATGGGGTGGGAGGAGGG - Intergenic
956413656 3:69004714-69004736 TTGGGGAATGGGTGGGGGGATGG - Intronic
958026035 3:88050264-88050286 CTGGGGGTTGGGTGTGATTAGGG - Intergenic
958940278 3:100304636-100304658 CTGGTGCTTGGGTGGGAAGAAGG - Intronic
960618632 3:119618676-119618698 CTGGGGAAAGGATGCCAGGAAGG + Intronic
961411678 3:126726804-126726826 CTGAGGACTGGGTGTGTGGAGGG + Intronic
961984090 3:131114004-131114026 CTGGGAATTTGGAGTGAGGAGGG + Intronic
962276185 3:134015430-134015452 CTGGGGGTGGGGTGGGAGGGGGG + Intronic
962327442 3:134447640-134447662 CTGGAGATTGGGTGGGGTGAGGG + Intergenic
965165124 3:165188061-165188083 CTGGGTATTGCATGCCAGGAGGG + Exonic
965499460 3:169440539-169440561 TTGGGGATGGGGTGGGAGGAGGG + Intronic
965828100 3:172751002-172751024 CTGGGGGTGGGGTGCGGCGAGGG - Intronic
966882098 3:184356290-184356312 CTGAGGATTGGGAGTGGGGAGGG - Intronic
966893593 3:184426107-184426129 CTGGGGGTGGGGTGGGAGTAGGG + Intronic
967189768 3:186975210-186975232 CTGGGGAGTGAGTGGGAGTATGG + Intronic
967715192 3:192754393-192754415 TTGGGGATTGGGGGCGGGGGTGG - Intronic
968267659 3:197375209-197375231 GTGGGGATGGGGAGAGAGGATGG - Intergenic
968650287 4:1757714-1757736 GTGGGGGTTGGGTGGGGGGATGG - Intergenic
968662873 4:1806028-1806050 CTGGGGAAGGGGTGGGAGGCAGG - Intronic
968700099 4:2051636-2051658 CTGGGGATTTGGTGTAAAGATGG + Intergenic
969393438 4:6906138-6906160 AAGGGGATTGGGAGGGAGGATGG + Intergenic
969600146 4:8171379-8171401 CTGGGGAGAGGGAGCCAGGAGGG - Intergenic
971132525 4:23828478-23828500 CTGTGGGTTTGGTGTGAGGAGGG + Exonic
971654392 4:29323751-29323773 CTGGGGAATGTGAGCGAAGAAGG + Intergenic
971968630 4:33593990-33594012 ATGTGGATTGGGGGCCAGGAAGG - Intergenic
972166182 4:36287124-36287146 CTGGGGAAAGGGTGGGAGGGAGG - Intronic
973651021 4:52997277-52997299 TTGGGGCTTGAGTGGGAGGAGGG - Intronic
973728036 4:53795471-53795493 CGGGGGATGGGGTGGGGGGAGGG + Intronic
974017792 4:56664777-56664799 CTGGGGAATGGTGGTGAGGAAGG - Intronic
977082040 4:92542616-92542638 CTGGGGACTCGGTGGGAGGGTGG + Intronic
979887559 4:126048262-126048284 TGGGGGATTGGGTGGGAGGTGGG + Intergenic
981087398 4:140698303-140698325 ATGGGGATTGAGTGAGAGGAAGG - Intronic
981422784 4:144570560-144570582 CTGGGGAAGGGGTGCATGGATGG + Intergenic
982031277 4:151303573-151303595 CTGGGGAGTGGAATCGAGGAGGG - Intronic
982361944 4:154527706-154527728 CTGGGGCTTGGGGGCGGGTAGGG + Intergenic
984891583 4:184498772-184498794 CTGGGGACTGGGCGCAGGGAGGG + Intergenic
985817421 5:2137082-2137104 CTGGGCATTGCGTGCGTGGGTGG + Intergenic
988687086 5:33535748-33535770 CTGGGGATTGGATGTGAGGAGGG + Intronic
988882832 5:35522256-35522278 CTGGGGAAAGGGTGGGAGGTGGG + Intergenic
989147849 5:38266155-38266177 CTTGGGATTGGGGGTGAGGGAGG - Intronic
989351660 5:40493802-40493824 CGGGGGAAAGGGTGGGAGGAGGG - Intergenic
990486370 5:56262965-56262987 CTGGGGATGGGATGAGAGGGTGG + Intergenic
991018815 5:61958967-61958989 CTGCTGAGTGGGAGCGAGGAGGG + Intergenic
991182614 5:63771147-63771169 GTGGGGATCGGGGGCTAGGAGGG - Intergenic
991370176 5:65910371-65910393 CGGGGGAAAGGGTGAGAGGAGGG + Intergenic
992413648 5:76532470-76532492 CTGAGGATTGGGTGGGTGGGGGG + Intronic
993188989 5:84656930-84656952 CTGGGGGTGGGGAGGGAGGATGG + Intergenic
993737695 5:91497655-91497677 TTGGGCATAGGGTACGAGGAAGG - Intergenic
994022920 5:95048797-95048819 CAGGGGATTTGGAGAGAGGAAGG + Intronic
995846506 5:116499423-116499445 CGGGGGGTGGGGTGCGGGGAGGG + Intronic
996487699 5:124056256-124056278 TTGGGGATGGAGTGGGAGGAAGG + Intergenic
996621898 5:125515296-125515318 CAGGGTATAGGGTGAGAGGAAGG + Intergenic
996767551 5:127049398-127049420 ATGGGGATTGGGAGTAAGGAGGG - Intronic
996815889 5:127572132-127572154 CTGGGGATTTGCTGGGTGGATGG - Intergenic
997295195 5:132764558-132764580 CTGGGGAATGGGGGTGATGAGGG - Intronic
997633750 5:135389710-135389732 ATGGGGATTGGGAGCAAGGAAGG - Intronic
999234050 5:150079955-150079977 CTGGGGACTGGGTGTGATGGGGG - Intronic
999715425 5:154356370-154356392 CTGGGGGTTGGGTATGAGAAAGG + Intronic
999791610 5:154945130-154945152 GTGGGGATGGGGAGCAAGGATGG + Intronic
1001085182 5:168695313-168695335 CTGGGAATAGTGTTCGAGGATGG + Intronic
1001430741 5:171660034-171660056 CTGGGGATGGGGGGTGGGGAAGG - Intergenic
1002161989 5:177319802-177319824 CTAGGAATTGGATGAGAGGATGG - Intergenic
1002465377 5:179405779-179405801 CTGGGGGGTGGGGGCGAGGCTGG - Intergenic
1003218415 6:4135728-4135750 CCGGGGCTTGGGTGCGGGGCGGG + Intergenic
1004562323 6:16761823-16761845 CTCGGGATGGGGTGCGGGGGAGG + Intergenic
1005039531 6:21588499-21588521 CAGGGGATGGGGTAGGAGGACGG + Intergenic
1005886409 6:30101050-30101072 CTGGGGACTGGGTAGGCGGATGG - Intergenic
1006099505 6:31677414-31677436 TTGGAGATTGGGTGGCAGGAAGG + Intronic
1006307771 6:33234971-33234993 CTGAAAATTGGTTGCGAGGAGGG + Intergenic
1007100047 6:39239821-39239843 CTGAGGATTGGTTGGGAGGCGGG + Intergenic
1007237838 6:40403715-40403737 CTGGGGGATGGGAGCAAGGAAGG - Intronic
1007577161 6:42932600-42932622 CTGGGGAGGGCGTGGGAGGAGGG + Intronic
1007606325 6:43120607-43120629 CTGAGGATTGGCTGTGCGGATGG + Intronic
1007957400 6:45929990-45930012 CTGGGGGCTGGGAGGGAGGAAGG + Intronic
1007958537 6:45938383-45938405 GGGGGTATTGGGTGGGAGGAAGG + Intronic
1008189414 6:48436589-48436611 CAGGGGATGGGGTGGGGGGAGGG - Intergenic
1012027575 6:94017095-94017117 CTGGGGATTGGAGTGGAGGATGG - Intergenic
1012548025 6:100441405-100441427 ATGGGGATGGGATGAGAGGAAGG - Intronic
1013450101 6:110272113-110272135 CGGGGGAATGGGTGGGAGGAGGG - Intronic
1017783428 6:157734394-157734416 CTGGGGATTGGATGGCAGGATGG + Intronic
1017935178 6:158999383-158999405 CTGGGGATGGGGTGCAAGTATGG + Intronic
1018273155 6:162102182-162102204 CTGGGGGATGGGTGGGGGGACGG - Intronic
1018303264 6:162426553-162426575 TTGGGGATGAGGTGGGAGGATGG - Intronic
1018439987 6:163803030-163803052 CTTGGGATGGAGTGAGAGGAGGG + Intergenic
1018454714 6:163941538-163941560 CTGGGGTTGGGGTGTGGGGATGG + Intergenic
1019525112 7:1477294-1477316 GTGGGGATGGGGTGGGTGGATGG - Intronic
1019590487 7:1827978-1828000 CTGGGGATGCGGGGTGAGGAGGG + Intronic
1019704487 7:2491056-2491078 ATGGGGGATGGGTGCGTGGATGG - Intergenic
1019902032 7:4028473-4028495 CTGGTGGTTGGGTGGGAGGCTGG + Intronic
1021205676 7:17777021-17777043 CTGGGGATAGGGAATGAGGAGGG - Intergenic
1021827611 7:24571497-24571519 CTGGGGTTGGGGTGGGAGGTAGG - Intergenic
1021945431 7:25721472-25721494 CTGGGCACTGGGTGGAAGGAAGG - Intergenic
1022253891 7:28636273-28636295 CTGGGGGGTGGGAGGGAGGAGGG + Intronic
1022467346 7:30660733-30660755 CTGGAGATTGGGTCTCAGGAAGG - Intronic
1023028561 7:36073818-36073840 CTGGAGTGTGGGTGCGAGGGTGG - Intergenic
1023158500 7:37275275-37275297 CTGGGTGCTGGGTGGGAGGAGGG + Intronic
1023215260 7:37855507-37855529 CTTGGGATTTGGTGGGGGGAGGG - Intronic
1023630351 7:42157458-42157480 CTGGGGCTGTGGTGTGAGGAAGG - Intronic
1024000394 7:45185519-45185541 CTGGGGATGGGGTCCAATGAGGG + Intronic
1024257549 7:47549925-47549947 GTGGGGATGGGGTGGGAGGGCGG - Intronic
1025712861 7:63927828-63927850 CTGGGGAAAGGGTGTGAGGCAGG - Intergenic
1027188553 7:75985448-75985470 CTGAGGTTTGGGTGCCAGGTGGG + Intronic
1028816427 7:95151451-95151473 CCGGGGATTTGGTGGGAGGGAGG + Intronic
1029492513 7:100879856-100879878 CTGGTGATTGGTTGGGAGGTTGG + Intronic
1029526784 7:101099596-101099618 CTGGGCATTGGGTGCTAGGAAGG - Intergenic
1029540727 7:101180478-101180500 CTGGGGAGTGGGACTGAGGATGG + Intergenic
1029545833 7:101210195-101210217 CTGGGGGCTGGGAGCGAGGGGGG - Intronic
1029580610 7:101434665-101434687 ATGGGGACAGGGTGCGAGGCAGG + Intronic
1031493668 7:122420905-122420927 CTGGGGAAGGGGAGGGAGGATGG + Intronic
1032578471 7:133081369-133081391 GTGGGGAGTGGGTGGGAGGAGGG + Intronic
1033046044 7:137962880-137962902 CTGGGGGATGAGTGCGAGGATGG - Intronic
1033659078 7:143391433-143391455 TTGGGCATGGGGTGAGAGGAGGG + Exonic
1034163325 7:149007855-149007877 CTGGTGATTGCCTGCCAGGAGGG + Intronic
1034263836 7:149772347-149772369 CTGGGGACTGGGGACGGGGAGGG - Intronic
1035021606 7:155804021-155804043 CTGGGGGTGGGGTTGGAGGAAGG - Intronic
1037874220 8:22531498-22531520 CTGAGGGTTGGATGTGAGGAAGG + Intronic
1038267460 8:26047730-26047752 CGGGGGGTTGGCTGGGAGGAGGG - Intergenic
1038284697 8:26196501-26196523 CTGGAGATGGGGCGGGAGGAGGG - Intergenic
1038644480 8:29350855-29350877 CCGGGGAGGGGGTGGGAGGAGGG - Intergenic
1039552192 8:38451238-38451260 CTGGAGATGGGGTGGGAGTAGGG + Intronic
1040022887 8:42756183-42756205 CTGGGCATTGTGTGCGTGGTTGG + Exonic
1040567822 8:48582717-48582739 ATGGGGATTGGGTGGTAGGGGGG + Intergenic
1040662989 8:49597107-49597129 CCAGGGATTGGGGGTGAGGAAGG + Intergenic
1042936333 8:74062388-74062410 CCGGGGTTGGGGTGCGGGGAGGG - Intergenic
1044289112 8:90446959-90446981 CTGGGGATTGGGTGGAGGGAGGG - Intergenic
1044822073 8:96161310-96161332 CTGGCGGTTGGGGCCGAGGAGGG - Intergenic
1045719992 8:105097915-105097937 CTTGGGAGTGGGTATGAGGAGGG - Intronic
1045967028 8:108036679-108036701 CTGGGGGTGAGGTGGGAGGAAGG + Intronic
1046241894 8:111507155-111507177 CAGGGGATAGGGTGGGAGGCGGG + Intergenic
1048469002 8:134690687-134690709 CTGGGGATGGGTTGAGGGGATGG - Intronic
1048507140 8:135031806-135031828 AAGGGGAGTGGGTGGGAGGAAGG - Intergenic
1049536675 8:143185829-143185851 CTGAGGCTTGGGACCGAGGAGGG - Intergenic
1049583301 8:143422263-143422285 CTGAGGACTGGGTGGGAGGGAGG + Intronic
1052673772 9:31592991-31593013 CTGGGGCATGGGTGCCAGGGTGG - Intergenic
1053000077 9:34573161-34573183 CTGGGCATGGGGTGAGGGGAGGG - Intronic
1053050479 9:34957823-34957845 CCGGGGGTTGGGTGGGGGGAAGG - Intronic
1055883410 9:81030739-81030761 CTGGCTATTGGCTGCGAGGTGGG + Intergenic
1056106292 9:83349854-83349876 CTGGGGAGTGGGGGCCAGGAGGG + Intronic
1056133676 9:83609486-83609508 CTGGGGAAAGGGTGGGAGGGGGG + Intergenic
1056490247 9:87099110-87099132 TTGGAGGTTGGGTGGGAGGAGGG + Intergenic
1056877544 9:90349310-90349332 GTGGGGAGTGGGTGTGGGGAGGG - Intergenic
1056931797 9:90883771-90883793 CTGGGGAGTGGGTGTGATGTGGG - Intronic
1057302581 9:93895397-93895419 CTGTGGATTGGGGTAGAGGATGG - Intergenic
1057474269 9:95385385-95385407 CTGGGTATTGGGAGTGATGACGG - Intergenic
1058228262 9:102393730-102393752 CTGGAGCTTGGGGGAGAGGAAGG - Intergenic
1058732324 9:107862163-107862185 CTAGAGATTGGGAGGGAGGAGGG - Intergenic
1059340659 9:113595784-113595806 CTGGGGATTGGAGGAGCGGAGGG - Intronic
1060223935 9:121780256-121780278 CTGGGGGTGGGGTGGCAGGAGGG - Intronic
1060404091 9:123364556-123364578 GTGGGGATGGGGAGGGAGGAGGG + Intronic
1060975363 9:127762042-127762064 ATGGGGGTGGGGTGGGAGGAGGG - Intronic
1061488553 9:130933035-130933057 GAGGGGCTTGGGTGGGAGGAGGG - Intronic
1062218202 9:135400349-135400371 CTGGGGATGGGGTGCCAGGTTGG - Intergenic
1062464560 9:136675377-136675399 CTGGGGACTGGGAGCAGGGAGGG + Intronic
1062464601 9:136675500-136675522 CTGGGGACTGGGAGCAGGGAGGG + Intronic
1203744842 Un_GL000218v1:35982-36004 CTGGGGATTGGGAGAGTGGCCGG - Intergenic
1203475222 Un_GL000220v1:144360-144382 CTGGGGAGGGGGTGGGGGGAAGG - Intergenic
1203565262 Un_KI270744v1:83502-83524 CTGGGGATTGGGAGAGTGGCCGG + Intergenic
1187066759 X:15847956-15847978 CTGTGGATAAGGAGCGAGGATGG - Intronic
1187731942 X:22264282-22264304 CTGGAGAATGGGAGGGAGGATGG - Intergenic
1188327131 X:28819093-28819115 CTGGGGAGTGGGTGTTTGGAGGG - Intronic
1189251092 X:39601203-39601225 CTGGGGTTGGGGTGGGAGGAGGG - Intergenic
1189704153 X:43743217-43743239 CTGGGGACTGGCTGAGAGCAAGG - Intronic
1190732044 X:53232986-53233008 CTGGGGCTTGGGGGCGGGGGAGG - Exonic
1190806624 X:53844098-53844120 CTGGGAGTTGGGTGCGGGGTTGG - Intergenic
1191906597 X:66098973-66098995 CTGGGAATTGGGGGGAAGGATGG - Intergenic
1192200813 X:69065662-69065684 CTGGGGGCTGGGTGCAAGGGAGG - Intergenic
1192226449 X:69231491-69231513 AGGGGGATTGGGGGAGAGGAGGG + Intergenic
1192764231 X:74125970-74125992 CTGGGTATAAGGTGAGAGGATGG + Intergenic
1195329198 X:103782947-103782969 CTGGGGATGGGGGGAGAAGAAGG - Intronic
1196305301 X:114095538-114095560 ATGGGGAATGGGAGGGAGGAGGG - Intergenic
1199616068 X:149657168-149657190 CTGGAAATTGGGTGGAAGGAGGG - Intergenic
1201145390 Y:11062316-11062338 CTGGGGAGTGGGTGGCAGGAGGG - Intergenic
1201158180 Y:11151025-11151047 CTGGGGATTGGGAGAGTGGCCGG - Intergenic