ID: 900390980

View in Genome Browser
Species Human (GRCh38)
Location 1:2433814-2433836
Sequence GGGGTTTGGGGAGCCGGCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 587
Summary {0: 1, 1: 0, 2: 1, 3: 54, 4: 531}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900390980_900390999 21 Left 900390980 1:2433814-2433836 CCCCTGCCGGCTCCCCAAACCCC 0: 1
1: 0
2: 1
3: 54
4: 531
Right 900390999 1:2433858-2433880 CACGGATGTGCCCACACTGGGGG 0: 1
1: 0
2: 0
3: 9
4: 99
900390980_900390996 19 Left 900390980 1:2433814-2433836 CCCCTGCCGGCTCCCCAAACCCC 0: 1
1: 0
2: 1
3: 54
4: 531
Right 900390996 1:2433856-2433878 TCCACGGATGTGCCCACACTGGG 0: 1
1: 0
2: 1
3: 7
4: 102
900390980_900390991 3 Left 900390980 1:2433814-2433836 CCCCTGCCGGCTCCCCAAACCCC 0: 1
1: 0
2: 1
3: 54
4: 531
Right 900390991 1:2433840-2433862 AGAGCCATCGACTCCCTCCACGG 0: 1
1: 0
2: 0
3: 4
4: 129
900390980_900390998 20 Left 900390980 1:2433814-2433836 CCCCTGCCGGCTCCCCAAACCCC 0: 1
1: 0
2: 1
3: 54
4: 531
Right 900390998 1:2433857-2433879 CCACGGATGTGCCCACACTGGGG 0: 1
1: 0
2: 0
3: 15
4: 130
900390980_900391000 27 Left 900390980 1:2433814-2433836 CCCCTGCCGGCTCCCCAAACCCC 0: 1
1: 0
2: 1
3: 54
4: 531
Right 900391000 1:2433864-2433886 TGTGCCCACACTGGGGGTCCCGG 0: 1
1: 0
2: 1
3: 24
4: 209
900390980_900390995 18 Left 900390980 1:2433814-2433836 CCCCTGCCGGCTCCCCAAACCCC 0: 1
1: 0
2: 1
3: 54
4: 531
Right 900390995 1:2433855-2433877 CTCCACGGATGTGCCCACACTGG 0: 1
1: 0
2: 0
3: 7
4: 150
900390980_900391001 28 Left 900390980 1:2433814-2433836 CCCCTGCCGGCTCCCCAAACCCC 0: 1
1: 0
2: 1
3: 54
4: 531
Right 900391001 1:2433865-2433887 GTGCCCACACTGGGGGTCCCGGG 0: 1
1: 0
2: 3
3: 28
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900390980 Original CRISPR GGGGTTTGGGGAGCCGGCAG GGG (reversed) Intronic
900357641 1:2272426-2272448 GGGGGTTGGGGAGACGGCCCTGG + Intronic
900390980 1:2433814-2433836 GGGGTTTGGGGAGCCGGCAGGGG - Intronic
900511457 1:3062947-3062969 GGGATCTGGGGAGAAGGCAGGGG - Intergenic
900644379 1:3702448-3702470 GGGGTGTGGGCAGCAGGCAGTGG - Intronic
900658572 1:3772188-3772210 TGGGTTCGGGGACCCGGCCGCGG - Intergenic
900758819 1:4456630-4456652 GGTGTTTGGGGAGAAGTCAGAGG - Intergenic
900911803 1:5601832-5601854 GGGGTGTGGGGACGCGGCATGGG + Intergenic
901129800 1:6955171-6955193 GGGGTTGGGGGAGCAGGGACAGG + Intronic
901132245 1:6969288-6969310 GTGGTTTGTGGAGGCGGCAGCGG + Intronic
901301306 1:8201666-8201688 GGGGTTTGGGGAGGGGACACCGG + Intergenic
901403979 1:9033823-9033845 GGGGGTTGGGGAGGAGGAAGGGG - Intergenic
901634470 1:10664210-10664232 AGGGCTAGGGGAGCGGGCAGGGG + Intronic
901659473 1:10789352-10789374 GGGGTGCGGGGGGCAGGCAGAGG - Intronic
901847291 1:11991503-11991525 GGGGTTTGGGCAGCAGGGAATGG + Intronic
901863389 1:12088867-12088889 GGGGGAGGGGGAGGCGGCAGGGG - Intronic
902299853 1:15494042-15494064 GGGTGGTGGGGAGCCGGCGGAGG - Intronic
902372195 1:16013855-16013877 GGGGTCTGGGGAGCCCACGGAGG + Intergenic
902772273 1:18652159-18652181 GGGGTGTGCAGAGCCGGTAGAGG + Intronic
903344335 1:22674913-22674935 GGGGTTGAGGGAGCTGGAAGAGG - Intergenic
903919166 1:26787491-26787513 GGGGTTTCTGTGGCCGGCAGCGG - Intronic
904029841 1:27527385-27527407 GGCGTGGGGGGAGCCAGCAGAGG - Intergenic
904810614 1:33161275-33161297 GGGGTCAGGGGAACAGGCAGAGG + Intronic
905300426 1:36982911-36982933 GGGTTCTGGGGAGCTGTCAGCGG - Intronic
906773265 1:48504501-48504523 GGGGTGTGGGGAGGAGGAAGTGG - Intergenic
907243811 1:53094716-53094738 GGGGAGGGCGGAGCCGGCAGGGG - Intronic
907311606 1:53542062-53542084 GGCATTTGGGGAGGAGGCAGTGG - Intronic
907520580 1:55020860-55020882 GGGGTCTGGGGTGGAGGCAGAGG + Intergenic
909502760 1:76353878-76353900 TGGGTTTGGGGAGTAGGCTGGGG - Intronic
910111127 1:83684653-83684675 GGGGTTGGGGGAGGGGGGAGGGG - Intergenic
910799860 1:91134147-91134169 GGAGTCTGGGGAGACGGGAGAGG + Intergenic
911791997 1:102029070-102029092 GGGGTTTGGGGGGCTGGGGGAGG + Intergenic
912416381 1:109510525-109510547 GGGGAGTGGGGAGCTGGCACTGG - Intergenic
912705544 1:111909228-111909250 GGGGGGTGGGGAGGTGGCAGTGG + Intronic
912753730 1:112307165-112307187 GGGGCCTGGGGATCCAGCAGAGG - Intergenic
912777489 1:112514918-112514940 CTGGTTTGGTGAGCCGGCAGCGG + Exonic
913129515 1:115827242-115827264 GGGGTTGGGGGAGGCCGGAGGGG - Intergenic
915623609 1:157100913-157100935 GGGATCTGGGGAGCCAGCAGAGG - Intergenic
916810927 1:168305085-168305107 TGGGTGTGGGGAGCAGGCAGAGG - Exonic
917538473 1:175891605-175891627 GAGGTAGGGGGAGCAGGCAGAGG + Intergenic
917672624 1:177287331-177287353 GTGGGGTGGGGAGCAGGCAGTGG + Intergenic
918354769 1:183697174-183697196 GGGGTTTGGGGCGGGAGCAGGGG - Intronic
919942462 1:202297711-202297733 GGGGCTTGGGGAGCCGGGGCGGG - Intronic
920432242 1:205926478-205926500 GGGGTTGGAGGAGAGGGCAGGGG + Intronic
920856392 1:209665972-209665994 AGGGTTGGGGGAGCAGACAGGGG + Intergenic
921846905 1:219892679-219892701 GGGGTTGGGGGAGTGGGGAGGGG + Intronic
921929709 1:220745366-220745388 GGGGTTGGGGGTGCCTTCAGGGG - Intergenic
922432442 1:225569323-225569345 GGGGTGTGGGGAGCTGGGGGAGG + Intronic
922586093 1:226736291-226736313 GGGCTCTGGGGAGCCTGAAGTGG - Exonic
923676625 1:236086168-236086190 GGTGTTTGGGGAGTGGGGAGGGG + Intergenic
923676642 1:236086251-236086273 GGTGTTTGGGGAGTGGGCAGGGG + Intergenic
923990120 1:239426986-239427008 GGGGTGGGTGGAGCAGGCAGAGG + Intronic
924052532 1:240092816-240092838 GGGCTGAGGGGAGACGGCAGTGG - Exonic
924598563 1:245467898-245467920 GGGGGTTGGGGGGTTGGCAGTGG + Intronic
1063332447 10:5175115-5175137 GGGGTTGGGGGAGGGGGGAGGGG - Intergenic
1063487168 10:6430700-6430722 GGGAGTTGGGGCACCGGCAGGGG + Intronic
1066987135 10:42477452-42477474 GGAGTCTGGGGTGCCGGCAGCGG + Intergenic
1068944932 10:62720245-62720267 GAGGTGTGGGGAGCCTGAAGGGG - Intergenic
1069162140 10:65105731-65105753 GGGGTTGGGGGAGGTGGGAGGGG + Intergenic
1069278462 10:66623122-66623144 GGGGTTTGGGGAGTGGAAAGGGG - Intronic
1069691891 10:70359176-70359198 GGGGTTTGGAGGGCAGGGAGAGG - Intronic
1069957741 10:72062072-72062094 AGTGTTTGGGGATCCGGCAAAGG + Exonic
1070140249 10:73733185-73733207 GGGGAGCGGGGAGCCGGCTGGGG - Intergenic
1070502384 10:77083853-77083875 GGGGTTGGGGGAGGTGGGAGAGG + Intronic
1070914772 10:80145846-80145868 GGGGTGTGGGGAGCGGGAATGGG - Intergenic
1072196264 10:93119363-93119385 GGGCTTCGGGGAGCATGCAGAGG - Intergenic
1072224266 10:93353336-93353358 GGAATGTGGGGAGCAGGCAGAGG + Intronic
1072578540 10:96720776-96720798 GGGGTGTGGGGAGGAGGCGGAGG + Intergenic
1072688246 10:97551692-97551714 AGAGTTTGGGGAGCCGACGGTGG - Intronic
1073523389 10:104155909-104155931 GGGATTGGGGGAGGAGGCAGGGG + Intronic
1073742205 10:106420691-106420713 GGGGTGGGGGGAGCGGGGAGGGG - Intergenic
1075675143 10:124291071-124291093 GGGACTGGGGGAGCTGGCAGGGG - Intergenic
1075727315 10:124617210-124617232 TGGGGTTGCGGAGCAGGCAGGGG - Exonic
1075965212 10:126605357-126605379 GGCCTGTGGGGAGCAGGCAGGGG + Intronic
1076193323 10:128498206-128498228 GGGCCTTGGACAGCCGGCAGAGG - Intergenic
1076337815 10:129720361-129720383 GGGGTCTGGGGAGCCAGCCTCGG + Intronic
1076613164 10:131738880-131738902 GGGGTGTTGGGAGTGGGCAGGGG - Intergenic
1076767768 10:132646009-132646031 GGGGTGTGGGGTGCCGGCGGGGG + Intronic
1077424208 11:2466880-2466902 GGTGTTCTGGGAGCGGGCAGAGG - Intronic
1077432835 11:2524532-2524554 GGGGCGTGGGTAGCGGGCAGTGG + Intronic
1077462090 11:2715696-2715718 GGGGTATGGGGAGCCCTCTGGGG + Intronic
1077610757 11:3642055-3642077 GGGGTGTGGGGAGTCGGGGGCGG - Exonic
1078432306 11:11297546-11297568 GGGGCAGGGGGAGCCGGGAGAGG + Intronic
1078543278 11:12228594-12228616 GGAGTTTGAGGCGCTGGCAGAGG + Intronic
1078660146 11:13278938-13278960 GGGGTCGCGAGAGCCGGCAGCGG + Intronic
1079177248 11:18153686-18153708 GGTGTGTGGGGCGACGGCAGTGG - Intronic
1079179182 11:18173646-18173668 GGTGTGTGGGGCGGCGGCAGCGG - Exonic
1080008127 11:27430889-27430911 GGGGTTGGGGGAGCTGGGAGTGG - Intronic
1081436931 11:43037122-43037144 GGAGTTTGGGAAGCTGGTAGTGG - Intergenic
1081612185 11:44569160-44569182 GGGGTCTGAGGAGCTGGGAGGGG + Intronic
1081808147 11:45901056-45901078 AGGGTTGGGGGAGCTGGCTGTGG + Intronic
1083053254 11:59795646-59795668 GGGCTTTGTGGAGCGGGCCGTGG + Intronic
1083675072 11:64320672-64320694 AGGGTTTGTGGAGCAGGCTGAGG + Exonic
1083843254 11:65316342-65316364 GGGCTGTGGGGAGCTGGGAGGGG - Intronic
1083997147 11:66278241-66278263 GGGGCCCGGGCAGCCGGCAGCGG + Exonic
1084965216 11:72741109-72741131 GGAGTTGGGGGAAGCGGCAGGGG - Intronic
1085834278 11:79935657-79935679 GGGGCTTGTGGTGGCGGCAGGGG - Intergenic
1086006783 11:82047360-82047382 GGGGTACGGGGGGCAGGCAGGGG + Intergenic
1086831840 11:91575979-91576001 GGGGTTGGGGCAGGGGGCAGGGG + Intergenic
1088373211 11:109113746-109113768 GGGATTTGGGGTGCTGGAAGTGG + Intergenic
1088747247 11:112814476-112814498 GGGGTCTGGTGAGCTGGTAGTGG - Intergenic
1089174317 11:116537340-116537362 GGGGTCTGGAGTGCGGGCAGAGG - Intergenic
1089640233 11:119843137-119843159 GGGGTTGGTGGAGAAGGCAGGGG + Intergenic
1089836898 11:121378835-121378857 GTGTTTTAGGGAGCCTGCAGGGG - Intergenic
1090172091 11:124613969-124613991 GGGGTTTTAGGAGGAGGCAGTGG + Intronic
1090213350 11:124938675-124938697 GGGGTTGGGGGAGCAAGCAAGGG + Intergenic
1090394098 11:126407684-126407706 GGAGTGGGGGGAGCGGGCAGGGG - Intronic
1091538443 12:1436114-1436136 AGGGCTGGGGGAGCAGGCAGAGG - Intronic
1091543120 12:1480735-1480757 GGGGTGTGGGTAGTGGGCAGGGG + Intronic
1092237255 12:6818296-6818318 GGGGTTGGGGGAGAGGGGAGGGG - Intronic
1092727311 12:11498773-11498795 GGGGCTGAGGAAGCCGGCAGGGG + Intronic
1092743344 12:11650361-11650383 GGGGGCCGAGGAGCCGGCAGGGG - Intronic
1094069289 12:26395212-26395234 GGGGTTTTGGGAGACGGAATAGG + Intronic
1094499970 12:31012456-31012478 GGGGCTGAGGAAGCCGGCAGGGG - Intergenic
1095943294 12:47739960-47739982 TGAGTTTGGGGAGCTGGCTGAGG - Intronic
1096437824 12:51609816-51609838 GGGGTGTGGGGAGGGGGGAGGGG + Intronic
1096656853 12:53097572-53097594 GGGGGTGGGGGAGAGGGCAGGGG - Exonic
1096890206 12:54761907-54761929 GGGGTTGGGGGAGAGGGGAGGGG + Intergenic
1096994849 12:55832069-55832091 GGGGATTGGGAAACCTGCAGCGG - Intergenic
1097186705 12:57200052-57200074 GGGGGTTGGGGAGCGGGCACTGG - Intronic
1097197086 12:57248975-57248997 GAGGTTTGGGGAGAGGGCATAGG - Intronic
1097512814 12:60565087-60565109 GTTGTTTGGGGAGGCTGCAGTGG + Intergenic
1097667501 12:62497158-62497180 GGGGTTGGGGGAGGGGGGAGGGG + Intronic
1101675641 12:106914080-106914102 GGGGGGTGGGGAGTGGGCAGTGG + Intergenic
1102212614 12:111138325-111138347 GGGCGCTGGGGAGCCAGCAGGGG + Intronic
1102341655 12:112126247-112126269 GGGGTATCTGGACCCGGCAGGGG + Intronic
1103397698 12:120620650-120620672 AGGTTTTGGGGAGGTGGCAGAGG + Intergenic
1103465875 12:121141495-121141517 GGGGCTGGGGAAGCCAGCAGGGG + Intronic
1103568642 12:121829991-121830013 TGGGTTTGGGGGGTCTGCAGTGG + Intronic
1103708747 12:122895669-122895691 GGGGCTTGGGGAGCCGATTGGGG - Intronic
1104621828 12:130319595-130319617 GGGGTTGGGGGAGCAGGGATAGG - Intergenic
1104771639 12:131367680-131367702 GGGGTCGGGGGAGCCGGATGGGG + Intergenic
1104943350 12:132404967-132404989 GGGGCTTGCAGAGCCGGCAGGGG + Intergenic
1105072171 12:133241260-133241282 GGGGGTTGGGGTGCGGGTAGGGG + Intergenic
1105677151 13:22684112-22684134 GGGGCTGGGGGTGCTGGCAGAGG - Intergenic
1106893914 13:34276992-34277014 CGGGTTTGTGGAGCCGCCAGAGG + Intergenic
1107038914 13:35928480-35928502 GTGGTGTGGGGAGGCTGCAGGGG - Intronic
1107217185 13:37935078-37935100 GGGGGTTGGGGTGCAGGCGGTGG + Intergenic
1107352262 13:39528229-39528251 CTGGTTTGGGGAGACGGTAGAGG - Intronic
1108292504 13:48975834-48975856 GGGGTTCGGGGTCCCGGCCGCGG + Intergenic
1108298774 13:49053187-49053209 GCATTTTGGGGAGCCTGCAGTGG + Intronic
1108849502 13:54710287-54710309 GGGGGTTGGGGGGGTGGCAGGGG + Intergenic
1109576819 13:64270386-64270408 GGGCTTTGGGGCTCCGGAAGGGG + Intergenic
1111062813 13:83045524-83045546 GGGGTTGGGGGAGGCGGTGGAGG - Intergenic
1111127527 13:83930708-83930730 GGGGGATGGGGAGCGGGAAGAGG - Intergenic
1111401111 13:87736239-87736261 GGGGTGGGGGGAGGCGGGAGGGG - Intergenic
1111935280 13:94550888-94550910 AGGGTTTGGGGAGCTTGGAGTGG + Intergenic
1112294097 13:98171280-98171302 GGGGTTTGGGTAGGTGGGAGAGG + Intronic
1112448715 13:99490407-99490429 GGGGGTTGGGGAGGGGGCAGGGG + Intergenic
1113643834 13:111978230-111978252 GGGTTTTGGTGAGCCAGCATAGG - Intergenic
1113801056 13:113086409-113086431 GGGGTCTGTGGACCCGGCTGTGG - Intronic
1113801063 13:113086430-113086452 GGGGTCTGTGGACCCGGCTGTGG - Intronic
1114577469 14:23727337-23727359 GGAGTTTGGGGATAGGGCAGTGG + Intergenic
1114696348 14:24630825-24630847 GGGGTTTGGGGAGGTGGCAAGGG + Intergenic
1115820196 14:37205610-37205632 GGGGGATGGGGAGCTGGCGGGGG - Intronic
1117591066 14:57268761-57268783 GGGAGCTGGGGAGCCCGCAGCGG - Exonic
1119705174 14:76778870-76778892 TGGAGTTGGGGAGCCAGCAGCGG - Intronic
1119859394 14:77925382-77925404 GGGCTTGGAGGAGCCTGCAGGGG + Intronic
1119906113 14:78303627-78303649 GGAGATGGGGGAGCTGGCAGGGG - Intronic
1119939181 14:78622484-78622506 GGGGTCTGGGGATCCATCAGAGG + Intronic
1121686318 14:95837956-95837978 AGTGCTTGGGGAGCAGGCAGAGG - Intergenic
1122136334 14:99635082-99635104 TGGGTTTGGGGTGGGGGCAGGGG + Intergenic
1122282596 14:100632874-100632896 AGGTTTTGGGGAGCCGGGATGGG + Intergenic
1122309019 14:100783098-100783120 GGGGTTTGTGGGGCTGGCAGAGG + Intergenic
1123038046 14:105479236-105479258 GGGGCTTGGGGGCCGGGCAGGGG + Intronic
1125335810 15:38625343-38625365 GGGGTGTGGGGAGGGGGGAGGGG - Intergenic
1127734320 15:61827829-61827851 GAGTTTTGGGGAGGCGGGAGTGG - Intergenic
1128452074 15:67811522-67811544 GGAGTTTGGGCAGCAGTCAGGGG - Intergenic
1128633432 15:69287589-69287611 AGGGTCTGGGGACCCAGCAGGGG + Intergenic
1129119855 15:73389677-73389699 GGGGTTGGGGGAGCAGGGTGAGG - Intergenic
1129330867 15:74826529-74826551 GGGGTTTGGGGAGGTGGGGGCGG + Exonic
1129360257 15:75019959-75019981 GGGGCATGGGGAGGAGGCAGAGG - Exonic
1129676861 15:77636473-77636495 GGGGGTTGGGCAGCTGGCATTGG + Intronic
1130571720 15:85051962-85051984 GGGGTGTGGGGAGGGGGGAGGGG - Intronic
1130984064 15:88833358-88833380 GGAGCTTGGGGAGCAGGAAGGGG - Intronic
1131593883 15:93776747-93776769 GGGGTTGGGGGAGGCAGGAGGGG + Intergenic
1131718913 15:95145860-95145882 AGGGTTTGTGGTGTCGGCAGAGG + Intergenic
1132376316 15:101330402-101330424 GGGGTGTGCGGAGCCGGCCATGG - Intronic
1132703538 16:1231693-1231715 GGGGGTCGGGGGGCAGGCAGGGG - Intergenic
1132704973 16:1239668-1239690 GGGGGTCGGGGGGCAGGCAGGGG + Intergenic
1132707980 16:1254702-1254724 GGGGGTCGGGGGGCAGGCAGGGG + Intergenic
1133609894 16:7423359-7423381 GGGGGTGGGGGTGCAGGCAGGGG + Intronic
1134001025 16:10782965-10782987 TGGGTTTGGGGAGCAGGTAGGGG - Intronic
1134046792 16:11107054-11107076 GGGGTGTGGAGAGGCGGCAGAGG + Intronic
1134523165 16:14927736-14927758 GGGGCTGGGGGAGGAGGCAGGGG - Intronic
1134710832 16:16326387-16326409 GGGGCTGGGGGAGGAGGCAGGGG - Intergenic
1134948769 16:18342258-18342280 GGGGCTGGGGGAGGAGGCAGGGG + Intergenic
1134955754 16:18381483-18381505 GGGGCTAGGGGAGGAGGCAGGGG + Intergenic
1135469115 16:22713368-22713390 GGGGTTTGGGCTGCAGGCAAGGG - Intergenic
1136580750 16:31149561-31149583 GGGGGTTGGAGAGCAGGAAGTGG - Intronic
1136630378 16:31486334-31486356 AGGGTTTAGGGAGCTGCCAGAGG + Intronic
1136992791 16:35166002-35166024 GGGGTGGGGGGAGCGGGGAGGGG + Intergenic
1136993166 16:35169592-35169614 GGGGTTTGGGGGGCGGCCGGTGG - Intergenic
1138054356 16:53816483-53816505 GGGGGGTGGGGAGTGGGCAGGGG - Intronic
1138318159 16:56088125-56088147 GGGGCTTGTGGAGCAGGCAAGGG + Intergenic
1138454884 16:57115559-57115581 GGGGTGCGGAGAGCCGGGAGGGG - Intronic
1140892246 16:79295086-79295108 GGGGGTGGGGGAGGGGGCAGGGG + Intergenic
1141132410 16:81445098-81445120 GGGGCTGGGGGCGCCCGCAGGGG - Intergenic
1141565405 16:84898358-84898380 GAGGGTGGGGGAGCGGGCAGGGG - Intronic
1141701560 16:85644644-85644666 GGGGCCTGGGGAGACGGGAGTGG + Intronic
1141840110 16:86568539-86568561 TGGGGCTGGGGAGCCGGCGGGGG - Exonic
1142168188 16:88604915-88604937 GGCGTATGGGGAGTTGGCAGGGG - Intronic
1142232174 16:88905131-88905153 GGGGGTGGGGGAGTGGGCAGCGG + Intronic
1142262842 16:89050746-89050768 GGGATTTGGGGACACAGCAGTGG - Intergenic
1142903209 17:3026254-3026276 GGGGCGTGGGGAGCCGCCAGAGG + Intronic
1143376349 17:6469852-6469874 GGAGTCTGGGGAGCTGGTAGGGG - Intronic
1143495016 17:7307819-7307841 GGGGGTCGGGGAGGGGGCAGAGG + Intronic
1143584831 17:7845897-7845919 GGGGGTAGGGGAGCAGGAAGCGG - Exonic
1143590657 17:7884645-7884667 GGGGTTTGGGGGGCTGGGGGAGG + Intronic
1143866357 17:9926561-9926583 GGGGACTGGGAAGCCAGCAGTGG - Intronic
1144275689 17:13666362-13666384 AGGGTTGGGGGACCGGGCAGAGG + Intergenic
1144740931 17:17581880-17581902 GGGGATCGGGGAGCTGGGAGGGG - Intronic
1145904149 17:28507229-28507251 GGAGTCGGGGGAGCTGGCAGGGG - Intronic
1146671705 17:34742249-34742271 TGGGTTTGGGAAGGCGGCAAGGG + Intergenic
1146842514 17:36165790-36165812 GGGGCTTGGGGTGCTGGGAGGGG + Exonic
1146891703 17:36510599-36510621 GGGGTTTGAGGAGCAGGGAGAGG + Intronic
1146928566 17:36762049-36762071 GGGGGTGGGGGAGAAGGCAGGGG + Intergenic
1147400547 17:40177967-40177989 GGGGGTGGGGGACCCGGCGGGGG + Intronic
1147927376 17:43953999-43954021 GGGGGAGGGGGAGCCAGCAGGGG + Intronic
1147986164 17:44308768-44308790 CGGGTTTGGGGCTCCGGGAGGGG + Exonic
1148020141 17:44548041-44548063 GGGGTGAGGGGAGGCAGCAGAGG - Intergenic
1148218571 17:45847273-45847295 GGGGTTGGGCAAGCAGGCAGAGG - Intergenic
1148761142 17:50001243-50001265 GGGGAGTGGGGAGCTGGAAGCGG + Intergenic
1148765753 17:50037406-50037428 AGGGTTTGGGGAGGCTGCAGCGG - Intergenic
1150013533 17:61529600-61529622 GGGGTTAGGAGAGCAGGGAGAGG + Intergenic
1150565833 17:66338682-66338704 GGGCTTTGAGGAGCCTACAGTGG + Intronic
1150856632 17:68759515-68759537 GGGGTTTGCAGAGCAGGCACAGG + Intergenic
1151334510 17:73432020-73432042 CGGGTTGGGGGAGCTGGCGGGGG + Intronic
1151658520 17:75506897-75506919 GGGGTTGGGGGAGCCGAGTGAGG + Intronic
1152092366 17:78254198-78254220 GGGGGTCGTGGAGGCGGCAGCGG - Intergenic
1152170910 17:78747578-78747600 GGGGTTTGGGGATGCGGGAATGG - Intronic
1152362925 17:79840666-79840688 GGGGTGGGGGGACCCGGGAGCGG + Intergenic
1152426110 17:80219745-80219767 GGGGTTGGGGGAGACGGTGGTGG + Intronic
1152489609 17:80621474-80621496 CGGGGCTGGGGAGGCGGCAGAGG - Intronic
1152527676 17:80898626-80898648 GGGGTTGGGGGAGCCGGGGCAGG - Intronic
1152773886 17:82187790-82187812 GGGCTGGGGGGAGCTGGCAGGGG + Intronic
1153440381 18:5111220-5111242 GGGGTTGGGGGAGCCTGGATAGG - Intergenic
1155257862 18:24014466-24014488 GCGGCTTGGGGACCCGGGAGGGG + Intronic
1156012411 18:32510776-32510798 TGGGTTGGCGGAGCCGGGAGAGG - Intergenic
1156063993 18:33117571-33117593 GGGGTGGGGGGAGCGGGGAGAGG + Intronic
1156458418 18:37307602-37307624 GGGGGGTGGGGAGACGACAGAGG + Intronic
1157497832 18:48169088-48169110 GGGGCATGGGGAGCAGGCAAGGG + Intronic
1159419700 18:68201629-68201651 GGGGTGTGGGGAGGGGGGAGCGG + Intergenic
1160501001 18:79400961-79400983 GGGGCGTGGGGAGACGGCGGCGG - Intronic
1160690187 19:458053-458075 GGGTCTTGGGGAGGCGGAAGCGG + Intronic
1160690194 19:458074-458096 GGGTCTTGGGGAGGCGGAAGTGG + Intronic
1160690209 19:458116-458138 GGGTCTTGGGGAGGCGGAAGTGG + Intronic
1160690262 19:458265-458287 GGGTCTTGGGGAGGCGGAAGTGG + Intronic
1160690278 19:458307-458329 GGGTCTTGGGGAGGCGGAAGCGG + Intronic
1160690323 19:458433-458455 GGGTCTTGGGGAGGCGGAAGTGG + Intronic
1160690427 19:458709-458731 GGGTCTTGGGGAGGCGGAAGTGG + Intronic
1160690468 19:458814-458836 GGGTCTTGGGGAGGCGGAAGAGG + Intronic
1161016847 19:1987475-1987497 GGGGCTTGGGGTGCAGGCGGGGG - Intronic
1161028205 19:2046328-2046350 GGCATTGGGGGAGCCGGGAGCGG - Intronic
1161051076 19:2164317-2164339 GGGGTTTGGGGTGTCCCCAGGGG - Intronic
1161064647 19:2231631-2231653 GGGGCTTGGGGCTCAGGCAGAGG - Exonic
1161245605 19:3249913-3249935 GGGGTGAGGGGAGTGGGCAGAGG - Intronic
1161647394 19:5461948-5461970 GAGGTTTGGGGAGCCAGGCGTGG - Intergenic
1161769217 19:6222346-6222368 GGGCTTTGGCGAGTCGGCGGTGG + Exonic
1161808673 19:6459409-6459431 GGGGCTTGGGTAACCGGGAGCGG + Intronic
1162070445 19:8149364-8149386 GGGGGCGGGGGGGCCGGCAGGGG - Intronic
1163414998 19:17181005-17181027 GGGGTTTCTGGAGCCGACTGAGG - Exonic
1163760650 19:19134718-19134740 GGGGCGTGGGGAGCCAGAAGGGG + Intronic
1163761260 19:19137963-19137985 GGGGTGTGTGGAACGGGCAGGGG - Intronic
1163786549 19:19277660-19277682 TGGGAATGGGGAGGCGGCAGGGG + Intronic
1163846983 19:19643485-19643507 GGGGGTCGGGGATCCGGGAGGGG - Intronic
1164855276 19:31516350-31516372 GGGGATAGGGCAGCAGGCAGTGG + Intergenic
1165304685 19:34996216-34996238 GGGGGTTGGGGTGCAGGCGGGGG - Intronic
1165326577 19:35117662-35117684 GGGGTTGGGGGAGCTGGCGTGGG - Intronic
1165433504 19:35784954-35784976 TGGGCCTGGGGAGCAGGCAGCGG - Exonic
1165466620 19:35978647-35978669 GGGGTTTGGGGAGGAGCCAATGG - Intergenic
1165806685 19:38584702-38584724 TGGGTGTGGGGCGCAGGCAGAGG - Intronic
1166068867 19:40376394-40376416 GGGTTTTGGGGAGCAGGAATGGG + Intronic
1166069122 19:40377288-40377310 GGGGTTGGGGGCACAGGCAGAGG + Intronic
1166694879 19:44846700-44846722 GGGGCTCGGGGAGCCGGGGGTGG - Intronic
1166750883 19:45163496-45163518 TGGGCCTGGGGAACCGGCAGAGG + Intronic
1166755621 19:45189156-45189178 TGGGGTTGGGGAGGTGGCAGAGG - Intronic
1167230589 19:48280457-48280479 GGCGTTTATGGAGCGGGCAGTGG + Intronic
1167412128 19:49350822-49350844 GGGGGCGGGGGAGCCGGGAGGGG - Intronic
1167464965 19:49645825-49645847 GGGGTTGGGGGAGGCAGGAGAGG + Intronic
1167620343 19:50556823-50556845 GGGGGTGGGGGAGCCGTCCGAGG + Intronic
1167741912 19:51329009-51329031 GGGGTATGGGGTGGCGGGAGTGG - Exonic
1167833653 19:52048578-52048600 GGGGTTGGGGGAGGCGGGGGCGG - Intronic
1167862031 19:52292957-52292979 GGGGGGTGGGGGGCTGGCAGAGG - Exonic
1168298173 19:55388056-55388078 GGGGTTTGGGGATCAGGCTTGGG + Intronic
1168721228 19:58555990-58556012 GGGGTTTGGGGGGCGGCCGGTGG - Exonic
924998706 2:386800-386822 GGGGAGAGGGGAGCGGGCAGAGG - Intergenic
925130281 2:1489444-1489466 GGGGTTGTGAGAGCCGGGAGGGG - Intronic
925182628 2:1827005-1827027 GGGGTCTGGGGCACCAGCAGGGG - Intronic
925400178 2:3567039-3567061 AGGGGTTGGGGAGGCAGCAGTGG - Intergenic
925467044 2:4115445-4115467 GGGGGTTGGGGAGCAAGGAGAGG - Intergenic
925894907 2:8463543-8463565 AGGAATTGGGGAGCGGGCAGCGG - Intergenic
925948916 2:8893065-8893087 GGGGGTGGGGGAGGAGGCAGGGG + Intronic
925948930 2:8893090-8893112 GGGGGTGGGGGAGGAGGCAGGGG + Intronic
926165878 2:10521988-10522010 GGGGGGTGGGGAGCAGTCAGGGG + Intergenic
926180933 2:10642521-10642543 GGGGTCTTGTGAGCCGGCTGTGG - Intronic
926204579 2:10826804-10826826 GGGGTTTGAGGTGACGTCAGAGG - Intronic
926461916 2:13140626-13140648 GGGGTTGGGGGAGGGGGAAGTGG - Intergenic
927245826 2:20956500-20956522 GGGCTCTGTGGAGCCTGCAGGGG + Intergenic
928022536 2:27715824-27715846 GGGGTGTGGGGAGGGGGGAGGGG - Intergenic
928463927 2:31502293-31502315 GGGGTGGGGGGAGCGGGGAGGGG + Intergenic
928522851 2:32107314-32107336 GGGGTTAGGGGAGGCTGCGGAGG - Intronic
929140936 2:38666117-38666139 GGAGTTTGAAGAGCGGGCAGTGG + Exonic
929571228 2:43024349-43024371 GGGGTGTGAGGAGCCAGCATGGG + Intergenic
929832496 2:45358322-45358344 GGGAGTGGGGGAGCCCGCAGGGG + Intergenic
930692664 2:54380381-54380403 GGGGTTGGGGGATGCGGCATGGG - Intronic
931069554 2:58629333-58629355 TGGGTTTGGGAAGCAGGGAGGGG + Intergenic
931762844 2:65432239-65432261 GGGGGCTCGGGAGCGGGCAGAGG + Intronic
932620239 2:73260763-73260785 GGGGTCGGGGGTGCCGGCTGTGG - Exonic
933206516 2:79513286-79513308 GAGGGTTGGGGAGCGGGGAGGGG - Intronic
934058015 2:88268831-88268853 GGTGTCTGGGGAGCCTGGAGTGG + Intergenic
934712984 2:96527687-96527709 CGGGCTTGGGGGGCGGGCAGCGG - Intergenic
935331414 2:101980284-101980306 GGGGCTGAGGGAGGCGGCAGTGG - Intergenic
936412916 2:112276069-112276091 GGGGTCTGGGGCGGCGGGAGCGG + Intronic
937206266 2:120238962-120238984 GGGGAGCGGGGAGCGGGCAGGGG - Intergenic
937519593 2:122696077-122696099 GGGGTTGGGGGAGGCGGGAGGGG - Intergenic
938584017 2:132671117-132671139 GGGGTGTGGGGAGCAGCCAGAGG - Intronic
942235215 2:173897482-173897504 GAGGCTGGGGAAGCCGGCAGAGG + Intergenic
942674744 2:178414810-178414832 GGGATTTGAGGAGCCTGGAGAGG + Intergenic
944328776 2:198440542-198440564 GGGGTTTGGAGATGTGGCAGAGG + Intronic
944485324 2:200199591-200199613 GGCATCTGGGGAGCCTGCAGAGG - Intergenic
945283393 2:208058760-208058782 GGGGTGTGGGGAGGGGGGAGGGG + Intergenic
945719137 2:213396916-213396938 AGGGTTTGGGGAGTCAGAAGAGG - Intronic
946191621 2:218010604-218010626 GGCGGGAGGGGAGCCGGCAGAGG + Intergenic
946193461 2:218019921-218019943 GGGAGTGGGGGAGCGGGCAGGGG - Intergenic
946322127 2:218960286-218960308 GGGGCTGGGGGAGGCGGCGGCGG - Exonic
946428516 2:219612728-219612750 GGACTCTGGGGGGCCGGCAGGGG + Intronic
947005123 2:225502625-225502647 GGGGATTTGTGAGCTGGCAGTGG - Intronic
947662862 2:231882823-231882845 GGGGTTTGGGGAGACAGACGGGG - Intergenic
948398342 2:237663865-237663887 GGGGAGAGGGGAGCCGTCAGCGG + Intronic
948401035 2:237685664-237685686 TGGGTGTGGGGAGCGGGGAGGGG - Intronic
948796477 2:240405174-240405196 GGGGTATGGGGTGCCGCCAGTGG - Intergenic
948806141 2:240454068-240454090 GGGCTTCGGGCAGACGGCAGGGG + Intronic
948870032 2:240793150-240793172 GGGATTGGGGGAGCCCACAGCGG + Intronic
948904524 2:240972289-240972311 GGAATATGGGGAGCCAGCAGTGG + Intronic
948983844 2:241508391-241508413 GGCGATTGGGGAGGGGGCAGAGG - Intronic
949047364 2:241878005-241878027 GGGGGTGGGGGGGCCGGGAGAGG - Intergenic
1168757195 20:325844-325866 GGGGGTGGGGGAGGAGGCAGCGG - Exonic
1168757853 20:328269-328291 GGGGTGTGGGGAGGCCGGAGGGG - Exonic
1171046094 20:21810181-21810203 GGGCTCTGGGGAGGCGGAAGAGG + Intergenic
1172656998 20:36543452-36543474 GGGGTTTGGGCAGAGGGAAGAGG + Intronic
1172774906 20:37401688-37401710 AGGGTGTGGGGAGGCGGGAGGGG - Intronic
1172848667 20:37945022-37945044 GGGCATTGGGGGGCCGGCAGAGG - Exonic
1174056320 20:47800738-47800760 TGGGTTTGGGGAGGCACCAGAGG + Intergenic
1174371315 20:50090058-50090080 TGGGTTTGGGAGGCCAGCAGAGG - Intronic
1175187446 20:57188443-57188465 GGGGTTGGGGGAGCAGAGAGTGG + Intronic
1175306784 20:57981696-57981718 GGGGTTGGGGAAGGAGGCAGGGG + Intergenic
1175350659 20:58315700-58315722 GGGGTTTGGGGATTGGGCTGGGG - Intronic
1175604654 20:60302736-60302758 GGAGTTGGGGGAGCCGGAAAAGG - Intergenic
1176150928 20:63590356-63590378 GGGGTAGGTGGAGCCGGAAGAGG + Exonic
1178115076 21:29408420-29408442 GGGGTTTGGGGGGAAGGCAAAGG + Intronic
1179007582 21:37529033-37529055 GGGGCATGGGGAGACAGCAGGGG - Intergenic
1179574560 21:42299732-42299754 AGGGTTTGAGGAGTGGGCAGGGG - Intergenic
1179875090 21:44263052-44263074 GGGGGTTGGGGAGCTGGGAGGGG + Intergenic
1180040594 21:45277354-45277376 GGGGCTGGCAGAGCCGGCAGGGG - Intronic
1180867168 22:19126267-19126289 GGGGTTGTGGGAGGCTGCAGAGG + Intergenic
1181361619 22:22342063-22342085 GGGGTTAGGGGAGTGGGGAGGGG + Intergenic
1181749604 22:24979784-24979806 GGGTTGTGGGGAGGCGGCATGGG - Intronic
1181905055 22:26187702-26187724 GGGGTTTGGGAGGCGGGGAGGGG - Intronic
1181978171 22:26747208-26747230 GGGGTTAGGGGAGCAGTCAAAGG - Intergenic
1182197588 22:28534913-28534935 GGGGTTGGGGGAGGGGGCAGGGG + Intronic
1182459695 22:30475071-30475093 GGGGTTTAGGGGGCAGGCTGGGG - Intergenic
1183068009 22:35376998-35377020 GTGGTTTGGGCAGCAGGGAGGGG - Intergenic
1183200916 22:36385687-36385709 GGTGTCTGGAGAGCCGGCATTGG - Intronic
1183939177 22:41283218-41283240 GGGGGTTGGGGGGCCGGGAGTGG + Intronic
1183942214 22:41302174-41302196 GGGGTCTCGGGGGCTGGCAGGGG + Intronic
1184037975 22:41927428-41927450 TGGGTTGGGGGAGATGGCAGGGG - Intergenic
1184130913 22:42515931-42515953 TGTGTTGGGGGAGCTGGCAGTGG - Intronic
1184854265 22:47137843-47137865 GGGGAGCGGGGAGCCGGGAGTGG + Intronic
1185084096 22:48727331-48727353 AGGCTGTGGGGAGCAGGCAGTGG + Intronic
1185101515 22:48843315-48843337 GGGGTTTGGGGGGCAGGGTGTGG + Intronic
1185101526 22:48843342-48843364 GGGGTTTGGGGTGCAGGATGTGG + Intronic
950008005 3:9703925-9703947 GGGGCTAGGGGCGACGGCAGCGG - Exonic
950176027 3:10875071-10875093 GGGGGTCGGAGAGCCGGGAGAGG - Exonic
950484832 3:13266940-13266962 GGGGTTAGGGGTGCAGCCAGGGG - Intergenic
950958133 3:17077048-17077070 GGAGTTCAGGGAGCCGACAGTGG - Intronic
951487981 3:23235445-23235467 GGGGAGTGGGGAGTGGGCAGGGG + Intronic
951640435 3:24829574-24829596 GGGGGTTGGGGGGTCTGCAGCGG + Intergenic
953974399 3:47371398-47371420 AGGGGTTGGGGGGCCGGCGGCGG - Intergenic
954624663 3:52015978-52016000 GGGGATGGGGGAGATGGCAGGGG + Intergenic
954690445 3:52392761-52392783 GGGGTTTGGGGGGCAGGCCTAGG - Intronic
955092771 3:55768771-55768793 TGGGTTTGGGGAGTAGGCAGCGG + Intronic
956179108 3:66501044-66501066 GGGGCTTGGGGGACCGGCCGGGG - Intronic
956448631 3:69350825-69350847 GGGGTGTGGGGAGGGGGGAGGGG + Intronic
956703266 3:71977433-71977455 GGGGTTTATGGAGCAGACAGAGG - Intergenic
956761222 3:72446943-72446965 GGGGCTGGGGGGGCCGGGAGGGG + Intergenic
957112463 3:75981899-75981921 GGGTTTTTGGGAGGGGGCAGAGG - Intronic
959498546 3:107078935-107078957 GGGGTGTGGGGAGTGGGGAGGGG - Intergenic
959540000 3:107525808-107525830 GGGTGTTTGGGAGACGGCAGTGG + Intronic
961562726 3:127741546-127741568 GGTTTGTGGGGAGCGGGCAGAGG + Intronic
965519971 3:169662172-169662194 GGGGTTTGGGGAGGGGGCGGTGG - Intronic
966595397 3:181720613-181720635 GGGGTCTGGGGGGCGGCCAGGGG - Intergenic
966711840 3:182980213-182980235 GGAGTTTGGGGCGCGGGGAGCGG - Intronic
967754193 3:193149847-193149869 GGGGTTGGGGGAGGGGGGAGGGG + Intergenic
967761244 3:193228416-193228438 GATGGTTGGGGAGCCAGCAGCGG - Intergenic
968593659 4:1471873-1471895 GGGGTTGGGGGAGCCGCCGGGGG + Intergenic
969870832 4:10103765-10103787 GGGGGTGGGGGAGCAGGCTGGGG - Intronic
970071329 4:12162802-12162824 GGGGATTGGGGAGGGGGGAGCGG + Intergenic
970202986 4:13627910-13627932 GGGGTTTAGGTCACCGGCAGGGG + Intergenic
970473847 4:16402526-16402548 GGGGTGTGGGGAGGGGGGAGGGG - Intergenic
970511881 4:16789089-16789111 GGGGGAGGGGGAGCAGGCAGCGG + Intronic
974069338 4:57110116-57110138 GGGGGTGGCGGCGCCGGCAGGGG - Exonic
976049463 4:80994615-80994637 GGGGTGTGGGGAGGGGGGAGGGG - Intergenic
979670654 4:123357223-123357245 GGAGGTTGGGGAGCCAGCTGGGG - Intergenic
981018888 4:140004531-140004553 GGGGTTTGGGGAGGGGGCAGGGG + Intronic
981359041 4:143826286-143826308 GGGGTTTGGGGTGCAGGGAATGG + Intergenic
981369824 4:143947185-143947207 GGGGTTTGGGGTGCAGGGAATGG + Intergenic
981379564 4:144057146-144057168 GGGGTTTGGGGTGCAGGGAAGGG + Intergenic
981528906 4:145733536-145733558 GGGGTGTGGGGAGCAGAGAGCGG - Intronic
981635090 4:146868223-146868245 GGGGTGTGGGGAGTGGGGAGGGG + Intronic
985504659 5:271968-271990 GGGGTCGGGGGCGGCGGCAGGGG - Intronic
985743453 5:1633627-1633649 GGGGTCGGGGGAGGCGGCGGCGG + Intergenic
985783464 5:1882440-1882462 GGGGTTTGGGGAGCAGGGGTTGG + Intronic
986433566 5:7705509-7705531 GGGGCATGGGGAGCAGGAAGAGG + Intronic
990545367 5:56816083-56816105 GGGACTTGGAGAGCGGGCAGAGG + Intronic
990582021 5:57174277-57174299 GGGGTTTGAGGGGTCGGGAGCGG + Intronic
991379738 5:66007390-66007412 GGGGTTGGGGGAGCGGGGAGGGG + Intronic
991557785 5:67914810-67914832 GGGATGTGGGGAGAAGGCAGGGG + Intergenic
991993514 5:72364894-72364916 GGGGTTGGGGGAGTAGGCGGTGG + Intergenic
992496648 5:77300440-77300462 AGGGTTTGGGGAGATGGGAGGGG + Intronic
992939675 5:81750539-81750561 GGTGTTTGGCGGGCCGGCCGGGG - Intronic
993271115 5:85797170-85797192 GGGGTTGGGGGAGCAGCTAGGGG + Intergenic
993515808 5:88833528-88833550 GTGGTTTGAGGAGCCAGCAGGGG + Intronic
993554308 5:89316559-89316581 GGGGAGTGGGGAGCTGGAAGAGG - Intergenic
994863732 5:105235232-105235254 GGAGTTGGAGGAGCAGGCAGTGG + Intergenic
995391607 5:111646121-111646143 GGGGTTCTGGGAGCCACCAGTGG + Intergenic
996735650 5:126755849-126755871 GGGGAGTGGGGAGGCTGCAGAGG - Intergenic
997112765 5:131093137-131093159 GGGGTGTGGGGAGGGGGGAGGGG + Intergenic
997409468 5:133680097-133680119 AGACTTTGGGGAGCCAGCAGAGG - Intergenic
997798389 5:136834405-136834427 GGCATTTGGGGAGCCTGCAGTGG + Intergenic
998252299 5:140561393-140561415 GGGGTCTGGGGAGCAGCAAGAGG + Exonic
998263216 5:140647216-140647238 GGGGTCTGGGGCTCCGGTAGGGG - Intronic
998391131 5:141787678-141787700 GGGGTTGGGGGTGCCAGCAGTGG + Intergenic
999243637 5:150141597-150141619 TGGGTCTGGGGAGAAGGCAGTGG + Intronic
1000064691 5:157684374-157684396 TGGGTTTAGGGAGATGGCAGTGG - Intergenic
1001289085 5:170443803-170443825 GGGGCTTGGGCAGCAGGCGGGGG + Intronic
1002106958 5:176884287-176884309 GGGGAGTAGGGAGCGGGCAGAGG - Intronic
1002467257 5:179413837-179413859 AGAGTGTGGGGAGCGGGCAGGGG - Intergenic
1002637742 5:180616492-180616514 GGGGTGCGGGGAGGCGGCAGGGG + Intronic
1002803951 6:553536-553558 GTGGGTTGGGGAGCAGGCAGAGG - Intronic
1002917155 6:1538567-1538589 GGGGCCTGGAGAGCCAGCAGAGG - Intergenic
1002966496 6:1971190-1971212 GGGCACTGGGGAGCCAGCAGTGG + Intronic
1004318730 6:14615387-14615409 GGGGCTTGGGCAGTCGGGAGAGG - Intergenic
1005017328 6:21386630-21386652 GGGGTTTAGGAGGCAGGCAGTGG + Intergenic
1005898428 6:30197303-30197325 GGGGTTGGGGGAGTCCTCAGTGG + Intronic
1006090207 6:31624298-31624320 GGCGTCTGTGAAGCCGGCAGTGG - Exonic
1006295323 6:33167576-33167598 GGGGTGTGGGCAGGGGGCAGAGG + Intronic
1006369606 6:33635791-33635813 GGGGATTGAGGAGCCTGGAGGGG + Intronic
1006388535 6:33745569-33745591 GGGGGTCGGGGGGCTGGCAGAGG + Intronic
1006509574 6:34514829-34514851 GGGGAGTGGGGAGGAGGCAGCGG + Intronic
1006514749 6:34539579-34539601 GGGGGTTGGGGACCCAGGAGAGG + Intronic
1006682249 6:35805558-35805580 GGGGTTTGGGGAGGAGGCTGAGG - Exonic
1006829863 6:36962109-36962131 GGGGCTAAGGGAGCCGCCAGGGG - Intronic
1007630382 6:43269987-43270009 GGGGGGTGGGGAGCAGGCAGAGG + Intronic
1008300053 6:49825718-49825740 GGGGGTTGGGGAGCAGGTAGGGG + Intergenic
1008313550 6:50008801-50008823 GGGGTTGGGGGAGCGGGGAGGGG + Intergenic
1010700792 6:79044089-79044111 GGGGTTTGGGGTGGGGGCAGCGG - Intronic
1011350493 6:86417876-86417898 GGGCTTTGGGAAGGGGGCAGGGG - Intergenic
1011393539 6:86881077-86881099 GGGGTATGGGGAGCAAGGAGGGG - Intergenic
1011525474 6:88259610-88259632 GGGGTGGGGGGAGGCGGAAGGGG + Intergenic
1012185576 6:96211184-96211206 GGGGTGTGAGGAGCTGGCAGTGG + Exonic
1014931671 6:127343533-127343555 GGGGTCACGGGAACCGGCAGGGG - Intronic
1015554978 6:134451782-134451804 GGGGGTTGGGGAGCAGAGAGTGG + Intergenic
1016374533 6:143406797-143406819 GGGGTTTGTGGAAACGGCAAAGG - Intergenic
1017079713 6:150655946-150655968 GGGGGTTGGGGGGCCAGGAGAGG + Intronic
1018158628 6:161014906-161014928 GAGGGTTGGGGACCGGGCAGGGG - Intronic
1018613301 6:165662905-165662927 GCGGTTCGGGCGGCCGGCAGGGG - Intronic
1019179431 6:170177310-170177332 GGGGGAGGGGCAGCCGGCAGCGG + Intergenic
1019215274 6:170439070-170439092 GGGGCTGGGGGAGCAGGCTGTGG + Intergenic
1019274966 7:171478-171500 GGGGGTCGGGGAGCCGGGAGGGG - Intergenic
1019274976 7:171497-171519 GGGGGTCGGGGAGCCGGGAGGGG - Intergenic
1019274986 7:171516-171538 GGGGGTCGGGGAGCCGGGAGGGG - Intergenic
1019353011 7:564033-564055 GGGAAGTGGGGAGCGGGCAGAGG - Intronic
1019361643 7:608073-608095 GGGCATGGGGGAGCTGGCAGAGG + Intronic
1019446458 7:1074003-1074025 GGGGTTGGGAGTGACGGCAGCGG - Intronic
1019795178 7:3043633-3043655 GGGGATGGGGGAGCTGGCGGAGG - Intronic
1020088307 7:5323375-5323397 GGGGTCGGGGGTGCAGGCAGAGG - Intronic
1023694260 7:42828677-42828699 GGGGTGGGGGGAGCGGGGAGGGG - Intergenic
1023865986 7:44238676-44238698 GTGGGCTGGGGACCCGGCAGAGG - Intronic
1024348982 7:48343612-48343634 GGGTTTTGGGGAGCAGGTGGTGG + Intronic
1024426319 7:49230428-49230450 GGGGTGGGGGGAGCGGGGAGAGG - Intergenic
1024581981 7:50808068-50808090 GAGGTTTGGGGGGCCAGTAGAGG - Intergenic
1025032803 7:55571804-55571826 GGGGTGAGGGGAGCGGGCGGAGG - Intronic
1025206005 7:56993740-56993762 GGGGTCGGGGGTGCAGGCAGAGG + Intergenic
1025236679 7:57239415-57239437 TGGGTTTGGGGAGGCACCAGAGG - Intergenic
1025256862 7:57389798-57389820 GGGGTATGGGGAGTAGGCATGGG - Intergenic
1025665935 7:63583199-63583221 GGGGTCGGGGGTGCAGGCAGAGG - Intergenic
1025740627 7:64192851-64192873 AGGGTTTGTGGGGCCAGCAGGGG + Intronic
1025777044 7:64569154-64569176 GGGGTATGGGGTGGCGGGAGTGG + Intergenic
1025840437 7:65141413-65141435 GGGGTTTGGGGACCCGGGCTGGG + Intergenic
1025878278 7:65508751-65508773 GGGGTTTGGGGACCCGGGCTGGG - Intergenic
1025882619 7:65554551-65554573 GGGGTTTGGGGACCCGGGCTGGG - Intergenic
1025890824 7:65648052-65648074 GGGGTTTGGGGACCCGGGCTGGG + Intronic
1026969580 7:74459846-74459868 GGGGTTTGGGGAGGGGCCAGAGG + Intronic
1027001654 7:74658226-74658248 GGGGTAGGGGGAGGCGGCACGGG - Intronic
1029510756 7:100993496-100993518 AGGGCTTGTGGAGCTGGCAGGGG - Exonic
1029511249 7:100996745-100996767 AGGGCTTGTGGAGCTGGCAGGGG - Exonic
1029511475 7:100998167-100998189 AGGGCTTGTGGAGCTGGCAGGGG - Exonic
1029511973 7:101001416-101001438 AGGGCTTGTGGAGCTGGCAGGGG - Exonic
1029536280 7:101159681-101159703 GGGGATTTGGGGGCTGGCAGAGG + Intronic
1030330843 7:108268631-108268653 GGGGTTGGGGGGGGCGGCGGTGG + Intronic
1032279808 7:130491636-130491658 GGGCTCTGGGGTGCCGGCCGTGG - Intronic
1032462703 7:132123806-132123828 GTGGTTTAAGGAACCGGCAGGGG - Exonic
1032933149 7:136697396-136697418 GGGGTTTGTGGAGGCAGGAGTGG + Intergenic
1033279020 7:139992653-139992675 AGGGCTTGGGGAGCTTGCAGAGG - Intronic
1033607198 7:142936221-142936243 GGGACATGGGGGGCCGGCAGGGG + Intergenic
1034183681 7:149157876-149157898 GTGGTAGGAGGAGCCGGCAGAGG + Intronic
1035049858 7:155992490-155992512 GGGGTTTCTAGGGCCGGCAGAGG - Intergenic
1035357177 7:158283288-158283310 GGGGTCTGGGGAGCTGCCTGAGG - Intronic
1035519813 8:266857-266879 GGCGTGTGGGGAGACGGGAGAGG + Intergenic
1035728034 8:1836601-1836623 GGAGTTGGGGGAGCAGGCTGTGG + Intronic
1036823171 8:11955770-11955792 AGGGCTGGGGGAGCCGGCGGAGG + Intergenic
1037653687 8:20864424-20864446 GGGGGTTGGGGAGCAGTGAGGGG + Intergenic
1038807873 8:30812078-30812100 GGGATCTGGGCAGCCGGCCGGGG + Intronic
1039283496 8:36012050-36012072 GGGGGTTGGGGAGCTGGGGGAGG + Intergenic
1039435829 8:37558737-37558759 GGGGTGTGGGGAGCGGAAAGGGG - Intergenic
1040311132 8:46237418-46237440 GGGGTATGTAGAGGCGGCAGAGG + Intergenic
1041001382 8:53457752-53457774 GGGGGTTGGGGGGCTGGGAGAGG + Intergenic
1041085570 8:54253399-54253421 GGGATTTGGGGAGCCAGAAGAGG + Intergenic
1042764754 8:72308775-72308797 GGGGTGTGGGGAGCAGGGTGGGG + Intergenic
1044290398 8:90462238-90462260 GGTGTCTGGGGAGCAGCCAGTGG - Intergenic
1045787047 8:105934171-105934193 GGGGTTGGGGGAGGGGGGAGGGG - Intergenic
1046583241 8:116119619-116119641 GGGGCTTGGGGAAGAGGCAGAGG - Intergenic
1046841739 8:118866102-118866124 AGGGTTGGGGGAGAAGGCAGGGG + Intergenic
1047200206 8:122758939-122758961 GGGGTAAGGGGAGCGGGGAGGGG - Intergenic
1047483059 8:125302701-125302723 AGGGGTTGGGGAGCGTGCAGGGG + Intronic
1048345097 8:133570240-133570262 GGGGCTTGGGGACCCGCGAGGGG + Intronic
1048928519 8:139292040-139292062 GGGGTTTGGGGAGCCTGTTGGGG + Intergenic
1049002936 8:139837703-139837725 GGGGTGTGGGGAAATGGCAGGGG - Intronic
1049377399 8:142295803-142295825 GGGGTTGGAGGTGCAGGCAGAGG - Intronic
1049590784 8:143460944-143460966 AGGGTTTGGGAAGCGGGGAGTGG + Intronic
1049665160 8:143839716-143839738 CGGGTATGGGGAGCGGGCTGGGG - Exonic
1050037515 9:1452921-1452943 GGGGTTTGGGGTGAAGGAAGGGG + Intergenic
1050678967 9:8087582-8087604 GGGGTTGGGGGAGGGGGGAGGGG + Intergenic
1051117690 9:13715988-13716010 GGGGGGTGGGGAGCGGGGAGAGG - Intergenic
1052997094 9:34556988-34557010 GGGGTCTGGGGAGAAGACAGGGG + Intronic
1053461911 9:38277976-38277998 GGGGCTTGGGGAGGAGGGAGGGG - Intergenic
1054718993 9:68584886-68584908 GGGGATTGGGGGGCAGGGAGGGG + Intergenic
1056760475 9:89411095-89411117 GGGAGCTGGGGAGCAGGCAGAGG + Intronic
1057611983 9:96552799-96552821 TGGGGTTGGGGAGGCGGGAGCGG + Intronic
1057809961 9:98250239-98250261 GGGACTGGGGGAGCAGGCAGAGG + Intronic
1057900374 9:98943777-98943799 GGGGCGTGGGGAGGCGGCCGGGG + Exonic
1058833192 9:108837637-108837659 GGGGTTTGGAGAGCTGGAGGTGG + Intergenic
1059393587 9:114016811-114016833 GGGGTTGGGGGACCCGGGACAGG + Intronic
1060091617 9:120748147-120748169 GGGGTTTTGGGAGCCGGGCGGGG + Intergenic
1060127470 9:121062430-121062452 GGGGTTTGGGGTGACTGCATAGG + Intergenic
1061293724 9:129666189-129666211 GGGGTCCGGGGAGCCGGCGCGGG + Intronic
1061504757 9:131025522-131025544 GGGGTTCAGGGAGCAAGCAGAGG + Intronic
1061713666 9:132505185-132505207 GGGGGTTGGGGGGCTGGCTGTGG - Intronic
1062372294 9:136246041-136246063 GGGGTTTGGGGAACGCGCGGCGG - Intergenic
1062432778 9:136533362-136533384 AGGTTTGGGGGAGCCGCCAGGGG - Intronic
1062447732 9:136602678-136602700 CGGGGTTGGGGGGCCTGCAGGGG - Intergenic
1062452708 9:136622253-136622275 GGGGGTTGGGGGACAGGCAGGGG - Intergenic
1062458923 9:136654760-136654782 GTGGTTGGGGGAGCCGGCTGGGG + Intergenic
1203492300 Un_GL000224v1:118836-118858 GGCGTTGGGGGGGCGGGCAGTGG + Intergenic
1203504923 Un_KI270741v1:60708-60730 GGCGTTGGGGGGGCGGGCAGTGG + Intergenic
1185547581 X:957767-957789 GGGGATTGGGGGGCAGGCAGAGG - Intergenic
1186508744 X:10114873-10114895 GAGTTTTGGGGATCCGCCAGGGG + Intronic
1187002459 X:15196717-15196739 GGGGTTGGGGGAGGGGGAAGGGG - Intergenic
1187107084 X:16254439-16254461 GGGGTTGGGGGAGCTGGGAGAGG - Intergenic
1187280172 X:17852550-17852572 GGTGTTTGGGGGGCAGGGAGAGG - Intronic
1187281574 X:17861363-17861385 GGGCTTGGGGGAGGCGGCGGAGG + Intergenic
1187348570 X:18490101-18490123 AGGGGTTGGGGAGCCAGCACAGG - Intronic
1187507180 X:19887368-19887390 GGGGGTTGGGGCGCCGGGATCGG + Exonic
1188245151 X:27830082-27830104 GGGGTTTGTGGGGCTGGCACTGG - Intergenic
1189221753 X:39378063-39378085 GGGGTTGGGGGAGCTTCCAGAGG + Intergenic
1189294863 X:39910925-39910947 GGGGTTCTGGGAACCTGCAGAGG + Intergenic
1189407067 X:40735160-40735182 GGGGGCTGGGGAACAGGCAGGGG + Intronic
1189927555 X:45972557-45972579 GCTGTTAGGGGAGCTGGCAGTGG + Intergenic
1190064120 X:47228898-47228920 GGTGTTTGGGCAGGCAGCAGGGG - Exonic
1192058986 X:67803854-67803876 GGGGTGGGGGGAGCGGGGAGGGG - Intergenic
1192169720 X:68846806-68846828 GGGGGCTGGGGCACCGGCAGGGG - Intergenic
1192219007 X:69184409-69184431 GGGGTCAGGGGAGCAGGGAGAGG - Intergenic
1193305404 X:79944746-79944768 GGAGTTTGGGGAGGCTGCAGTGG + Intergenic
1195299031 X:103509348-103509370 GGGGTTAGGGGAGAGGGGAGGGG - Intronic
1195320903 X:103721398-103721420 GGGGTGTGGGGAGTGGGAAGAGG - Intronic
1195705970 X:107738373-107738395 AGGGTTGGGGGAGCAGGCACAGG - Intronic
1196297432 X:114015157-114015179 CGGGTTGGGGGAGCGGGCGGAGG + Intergenic
1197008340 X:121531343-121531365 GGGGTAGGGGGAGCGGGGAGGGG - Intergenic
1197991312 X:132320416-132320438 GGGGTTGGGGGAGGGGGGAGGGG + Intergenic
1198177874 X:134173354-134173376 GGGATTTGGGGAGCGTGCGGGGG + Intergenic
1198344378 X:135745114-135745136 GGTGTGTGGGGAGCGGGGAGGGG + Intergenic
1199710585 X:150466476-150466498 GGGGTTTGGGGTGCCGATAGAGG - Intronic
1200054361 X:153451065-153451087 GGGGTCTGGAGAGACGCCAGGGG - Intronic
1201546214 Y:15164859-15164881 GGGGTTGGGGGAGGAGGGAGGGG + Intergenic
1202241751 Y:22778119-22778141 GGGGTTGGGGGAGGGGGGAGGGG - Intergenic
1202394733 Y:24411863-24411885 GGGGTTGGGGGAGGGGGGAGGGG - Intergenic
1202476051 Y:25258229-25258251 GGGGTTGGGGGAGGGGGGAGGGG + Intergenic