ID: 900390981

View in Genome Browser
Species Human (GRCh38)
Location 1:2433815-2433837
Sequence GGGGGTTTGGGGAGCCGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 553
Summary {0: 1, 1: 0, 2: 1, 3: 40, 4: 511}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900390981_900390999 20 Left 900390981 1:2433815-2433837 CCCTGCCGGCTCCCCAAACCCCC 0: 1
1: 0
2: 1
3: 40
4: 511
Right 900390999 1:2433858-2433880 CACGGATGTGCCCACACTGGGGG 0: 1
1: 0
2: 0
3: 9
4: 99
900390981_900390998 19 Left 900390981 1:2433815-2433837 CCCTGCCGGCTCCCCAAACCCCC 0: 1
1: 0
2: 1
3: 40
4: 511
Right 900390998 1:2433857-2433879 CCACGGATGTGCCCACACTGGGG 0: 1
1: 0
2: 0
3: 15
4: 130
900390981_900390991 2 Left 900390981 1:2433815-2433837 CCCTGCCGGCTCCCCAAACCCCC 0: 1
1: 0
2: 1
3: 40
4: 511
Right 900390991 1:2433840-2433862 AGAGCCATCGACTCCCTCCACGG 0: 1
1: 0
2: 0
3: 4
4: 129
900390981_900390995 17 Left 900390981 1:2433815-2433837 CCCTGCCGGCTCCCCAAACCCCC 0: 1
1: 0
2: 1
3: 40
4: 511
Right 900390995 1:2433855-2433877 CTCCACGGATGTGCCCACACTGG 0: 1
1: 0
2: 0
3: 7
4: 150
900390981_900391000 26 Left 900390981 1:2433815-2433837 CCCTGCCGGCTCCCCAAACCCCC 0: 1
1: 0
2: 1
3: 40
4: 511
Right 900391000 1:2433864-2433886 TGTGCCCACACTGGGGGTCCCGG 0: 1
1: 0
2: 1
3: 24
4: 209
900390981_900391001 27 Left 900390981 1:2433815-2433837 CCCTGCCGGCTCCCCAAACCCCC 0: 1
1: 0
2: 1
3: 40
4: 511
Right 900391001 1:2433865-2433887 GTGCCCACACTGGGGGTCCCGGG 0: 1
1: 0
2: 3
3: 28
4: 211
900390981_900390996 18 Left 900390981 1:2433815-2433837 CCCTGCCGGCTCCCCAAACCCCC 0: 1
1: 0
2: 1
3: 40
4: 511
Right 900390996 1:2433856-2433878 TCCACGGATGTGCCCACACTGGG 0: 1
1: 0
2: 1
3: 7
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900390981 Original CRISPR GGGGGTTTGGGGAGCCGGCA GGG (reversed) Intronic
900100439 1:960070-960092 GGGGGTCGGGGGAGCGGGGATGG + Intergenic
900206627 1:1434450-1434472 GGGGGTGGGGGGCGCCGGCGGGG + Intergenic
900390981 1:2433815-2433837 GGGGGTTTGGGGAGCCGGCAGGG - Intronic
900511458 1:3062948-3062970 GGGGATCTGGGGAGAAGGCAGGG - Intergenic
900610351 1:3542071-3542093 GGGGGTTGGGGGAGGCGGCCAGG - Intronic
900911802 1:5601831-5601853 TGGGGTGTGGGGACGCGGCATGG + Intergenic
902083821 1:13840806-13840828 TGGGGTTGGGGGAGGGGGCAGGG + Intergenic
902208203 1:14885285-14885307 GGAGATTTGGGGAGCAGGCAAGG - Intronic
902512311 1:16973061-16973083 GGGTGCTTGGGGAGGCGGCAGGG + Intergenic
902624855 1:17670681-17670703 GGGGCGTTGGGGACCCGGCTGGG + Intronic
903006473 1:20302224-20302246 GGGGGTTGGGGGAGTAGTCAAGG - Intronic
903977657 1:27161581-27161603 AGGGGATTGGGGAGCAGACATGG - Intronic
905457173 1:38096200-38096222 GGGGGGTGGGGGGGCTGGCACGG + Intergenic
906511680 1:46413687-46413709 GGGGGTTGGGGGAGAGGACACGG - Exonic
906556028 1:46714687-46714709 GGGGGTGTGGGGTGCTGACACGG + Intronic
907736501 1:57117875-57117897 GGGGGTGTGGGGAGGGGGGATGG + Intronic
908106089 1:60843858-60843880 GGGGGTTGGGGGGGCGGGCAGGG - Intergenic
908465444 1:64389127-64389149 TGGGGTGTGGGGAGCGGGGAGGG - Intergenic
911309859 1:96278737-96278759 TGGGGTTGGGGGAGCAGGGAGGG - Intergenic
911949277 1:104152730-104152752 TGGGGTTGGGGGAGGCGGGAGGG - Intergenic
912958003 1:114169498-114169520 GAGAGTTGGGGGAGCCAGCAAGG + Intergenic
913129516 1:115827243-115827265 GGGGGTTGGGGGAGGCCGGAGGG - Intergenic
913455503 1:119026479-119026501 TGGGGTTGGGGGAGGGGGCAGGG + Intergenic
913718489 1:121565172-121565194 GGGGGGTTGGGCAGGGGGCAGGG - Intergenic
914742534 1:150477296-150477318 GGGGGTTTGGGGTGGTAGCAGGG + Intergenic
915485475 1:156217083-156217105 TGGGGTTGGGGGAGCGGGGAGGG + Intronic
915549332 1:156623606-156623628 GGAGGCTTGGGGAGACTGCAAGG + Intronic
917869405 1:179228991-179229013 GTGGGTTTGGGGACCCTGGATGG - Intronic
917914133 1:179684188-179684210 TGGGGTGTGGGGAGCAGGGAGGG - Intronic
918354770 1:183697175-183697197 GGGGGTTTGGGGCGGGAGCAGGG - Intronic
918588809 1:186218443-186218465 TGGGGTTGGGGGAGCGGGAAGGG + Intergenic
919803959 1:201369705-201369727 GGGGGTGTGAGTAGGCGGCAGGG - Intronic
919881319 1:201903054-201903076 TGGGGTGTGGGGAGAGGGCAGGG + Intronic
919929983 1:202214751-202214773 GGGGGTCTGGAGAGGCGGAAAGG + Intronic
919942463 1:202297712-202297734 TGGGGCTTGGGGAGCCGGGGCGG - Intronic
920401574 1:205679871-205679893 GGGACTTGGGGGAGCCGGGACGG - Intronic
920531847 1:206707710-206707732 GGGGGTTTGGGGGTAGGGCATGG + Intronic
921545494 1:216469755-216469777 TGGGGTTGGGGGAGCGGGGAGGG + Intergenic
922468649 1:225862001-225862023 GGGGGTGTGGGCAGCAGCCACGG - Intronic
922704770 1:227784229-227784251 GGAGGTTTGGGGAGGAGGCAAGG - Intergenic
922718583 1:227889165-227889187 GGGGGGGTAGGGAGCGGGCAGGG - Intergenic
922784604 1:228276716-228276738 GGTGCGTTGGGGGGCCGGCAGGG + Exonic
923676641 1:236086250-236086272 TGGTGTTTGGGGAGTGGGCAGGG + Intergenic
924229923 1:241954706-241954728 AGGGGTTGGGGGAGCCGAGAGGG - Intergenic
924436662 1:244048848-244048870 GGGGGGTGGGGGGGCCGGGAGGG + Intergenic
1063487167 10:6430699-6430721 GGGGAGTTGGGGCACCGGCAGGG + Intronic
1064923385 10:20543116-20543138 TGGGGTTGGGGGAGCGGGGAGGG - Intergenic
1065442439 10:25766716-25766738 GGTGGCTTGGGGAGGGGGCAAGG - Intergenic
1066148784 10:32592690-32592712 GGGGGTGTGGGGAGCAGGGAGGG - Intronic
1067913980 10:50376573-50376595 TGGGGTTGGGGGAGCAGGGAGGG - Intronic
1068944933 10:62720246-62720268 GGAGGTGTGGGGAGCCTGAAGGG - Intergenic
1069570653 10:69492646-69492668 GATGGTTTGGGGAGGCGGGATGG + Intronic
1069828637 10:71269567-71269589 GGGGGTTTGGGCAGCAGGAGCGG - Intronic
1070140250 10:73733186-73733208 GGGGGAGCGGGGAGCCGGCTGGG - Intergenic
1070627868 10:78063938-78063960 GGAGTTTTGGGGAGCTGGCCAGG - Intergenic
1070914773 10:80145847-80145869 TGGGGTGTGGGGAGCGGGAATGG - Intergenic
1071060136 10:81560532-81560554 TGGGGTTTGGGGAGGGGGGAGGG - Intergenic
1071126685 10:82344204-82344226 TGGGGTGTGGGGAGCGGGGAGGG - Intronic
1071600618 10:86957134-86957156 TGGGGCTTGGGGGGCTGGCAGGG - Intronic
1072613969 10:97037443-97037465 GGAGCTTTGGGGAGACGGCGTGG + Intronic
1076440282 10:130476771-130476793 GGGGGTTTGGGGAGAAGACCAGG - Intergenic
1076745487 10:132510620-132510642 GGGGCTTGGAGGAGCCGGCAGGG - Intergenic
1076767767 10:132646008-132646030 AGGGGTGTGGGGTGCCGGCGGGG + Intronic
1076916194 10:133424057-133424079 GGGGGCGGGGGGAGGCGGCATGG + Intronic
1076936302 10:133568852-133568874 GGGGGCGGGGGGAGGCGGCATGG + Intronic
1077107825 11:849633-849655 GGGGGGCTGGGGCGCCGGCGCGG + Intronic
1077419528 11:2444115-2444137 GTGTGGGTGGGGAGCCGGCAGGG - Intergenic
1077462089 11:2715695-2715717 GGGGGTATGGGGAGCCCTCTGGG + Intronic
1078861541 11:15252214-15252236 GGGGATTTGGGGAGGAGGAATGG + Intergenic
1079230360 11:18644193-18644215 GGGGGGTTGGGGAGCAGCCCTGG - Intergenic
1079527629 11:21409431-21409453 TGGGGTTGGGGGAGCGGGGAGGG + Intronic
1080252741 11:30253130-30253152 TGGGGTTGGGGGAGCGGGGAGGG + Intergenic
1080291852 11:30679787-30679809 TGGGGTTGGGGGAGCGGGGAGGG + Intergenic
1080491416 11:32768322-32768344 TGGGGTTGGGGGAGTGGGCAGGG + Intronic
1080786136 11:35476799-35476821 GTGGGTTTAGGCAGCCAGCAAGG - Intronic
1080810308 11:35697594-35697616 TGGGGTGTGGGGAGCGGGGAGGG - Intronic
1081050998 11:38341594-38341616 TGGGGTTGGGGGAGCAGGGAGGG - Intergenic
1081314248 11:41612116-41612138 TGGGGTGTGGGGAGCGGGGAGGG + Intergenic
1082682920 11:56200926-56200948 TGGGGTTGGGGGAGAGGGCAGGG - Intergenic
1082754447 11:57060041-57060063 TGGGGTTGGGGGAGCGGGGAGGG - Intergenic
1083451502 11:62749011-62749033 GGGAGTTTGGGGTGCCATCATGG - Intronic
1083617574 11:64034224-64034246 GGGGGTCTGGGAAGGCGGGACGG + Intronic
1083664070 11:64265261-64265283 GGGGGGTGGGGGAACCTGCAAGG - Intronic
1086335102 11:85792769-85792791 TGGGGTGTGGGGAGCGGGGAGGG - Intronic
1086664376 11:89461158-89461180 TGGGGTGGGGGGAGCCGGGAGGG + Intronic
1087564444 11:99836284-99836306 GGGGGTTGGGGGAGGGGGGAGGG - Intronic
1087576855 11:100000007-100000029 TGGGGTGTGGGGAGCGGGGAGGG + Intronic
1088490506 11:110382923-110382945 TGGGGTTTGGGGAGGGGGGAGGG - Intergenic
1088754767 11:112876628-112876650 GGGAGTCTGGGGACCCTGCAAGG - Intergenic
1088807997 11:113369409-113369431 GGGGGGTGGGGGGGCGGGCATGG - Intronic
1088988309 11:114929157-114929179 AGGGATTTGGGGAGGCAGCAGGG + Intergenic
1089013331 11:115147648-115147670 GGGGGGTTGGGGAGTGGGAAAGG + Intergenic
1089640232 11:119843136-119843158 GGGGGTTGGTGGAGAAGGCAGGG + Intergenic
1089775542 11:120832914-120832936 AGAGGTTGGGGGAGCCGCCAAGG - Intronic
1090213349 11:124938674-124938696 GGGGGTTGGGGGAGCAAGCAAGG + Intergenic
1090274829 11:125411883-125411905 GGGGGTGTGGAGTCCCGGCATGG + Intronic
1090394099 11:126407685-126407707 GGGAGTGGGGGGAGCGGGCAGGG - Intronic
1091047385 11:132336751-132336773 GGGGATTGGGGGATCCGGGAGGG + Intronic
1091543119 12:1480734-1480756 GGGGGTGTGGGTAGTGGGCAGGG + Intronic
1091645609 12:2270119-2270141 GGGGTCTAGGGGAGCCAGCAGGG + Intronic
1091897736 12:4118720-4118742 GCGGGGTGGGGGAGCCGTCATGG + Intergenic
1091937616 12:4445945-4445967 GGGGGTCTGGGGAGGCAGCCAGG - Intergenic
1092196438 12:6552347-6552369 GGCTGTGTGGGGAGCCAGCAGGG - Intronic
1093573744 12:20700589-20700611 GGGGATTGGGGGAGCGGGGAGGG - Intronic
1094428237 12:30338179-30338201 TGGGGTTGGGGGAGGGGGCAGGG + Intergenic
1094535958 12:31323682-31323704 GGGGGTGGGGGGAGCGGGGAAGG - Intronic
1095088367 12:38082901-38082923 TGGGTCTTGGGGAGCCGACAAGG - Intergenic
1095115888 12:38351852-38351874 TGGGGTTTGGGGAGTGGGGAGGG - Intergenic
1096073861 12:48789808-48789830 GGGGGGTTGTGGGGGCGGCAGGG - Intergenic
1096548579 12:52357433-52357455 GGGGGTTGGGGGAGGCAGGAAGG + Intergenic
1096656854 12:53097573-53097595 GGGGGGTGGGGGAGAGGGCAGGG - Exonic
1098095163 12:66946797-66946819 GGGGGCTGGGGGGGGCGGCATGG + Intergenic
1098287863 12:68926703-68926725 TGGGGTTGGGGGAGCGGGGAGGG - Intronic
1099086409 12:78252168-78252190 TGGGGTTGGGGGAGCGGGGAGGG - Intergenic
1100564384 12:95781153-95781175 TGGGGTTGGGGGAGCAGGGAGGG + Intronic
1101432383 12:104637336-104637358 GGGGGTTGGGGGAGGGGGGAGGG + Intronic
1102806548 12:115786461-115786483 TGGGGTTGGGGGAGCGGGGAGGG - Intergenic
1103443188 12:120978603-120978625 GGGGGTTGGGGGTGCCCACAGGG + Exonic
1103896765 12:124278250-124278272 AGGAGTTTGGGGAGCCAGGAGGG - Intronic
1104002714 12:124870379-124870401 GGGCGTTTGGGGACCCAGCAGGG + Intronic
1104081060 12:125430923-125430945 GGGAGTGTGGGGAGGAGGCAGGG + Intronic
1104943349 12:132404966-132404988 TGGGGCTTGCAGAGCCGGCAGGG + Intergenic
1106237320 13:27874740-27874762 TGGGGTGTGGGGAGCGGGGAGGG - Intergenic
1106248305 13:27966685-27966707 GGGGGTGTGGGGCGCCTCCAAGG - Intronic
1106933114 13:34688577-34688599 TGGGGTTGGGGGAGGGGGCAGGG + Intergenic
1107038915 13:35928481-35928503 GGTGGTGTGGGGAGGCTGCAGGG - Intronic
1107807166 13:44164268-44164290 GGTGGTTTGGGGAGGAGGGAAGG - Intergenic
1108849501 13:54710286-54710308 GGGGGGTTGGGGGGGTGGCAGGG + Intergenic
1110327618 13:74236086-74236108 GTGGGTTGGGGGAGCGGGGAGGG - Intergenic
1110353838 13:74542211-74542233 GTGGGTTGGGGGAGCGGGGAGGG + Intergenic
1112448714 13:99490406-99490428 GGGGGGTTGGGGAGGGGGCAGGG + Intergenic
1112551780 13:100428308-100428330 GGGGGGTCGGGGAGGAGGCAGGG - Intronic
1112888042 13:104197467-104197489 GGGGGTTTGGGGAGGAGGCCGGG - Intergenic
1114696347 14:24630824-24630846 GGGGGTTTGGGGAGGTGGCAAGG + Intergenic
1116358342 14:43960080-43960102 TGGGGTGTGGGGAGGGGGCAGGG + Intergenic
1117013107 14:51491020-51491042 AGGGTTTTGGGGAGAGGGCAGGG - Intronic
1117498868 14:56331996-56332018 GGGGGTTTGTAGGGCTGGCATGG + Intergenic
1118033693 14:61842775-61842797 GGGGGTGGGGGGAGCGGGGAGGG + Intergenic
1118749367 14:68795295-68795317 GGGGGGTGGGGGAGCGGGAATGG - Intronic
1118865836 14:69702899-69702921 GGGGGTTTGGGAAGCCTCCCAGG + Intronic
1120471207 14:84927468-84927490 GGGGGTGGGGGGAGCTGGTAGGG - Intergenic
1121201444 14:92121619-92121641 GTGGGTTTGGGGAGCCCGGGGGG - Intronic
1121440478 14:93945691-93945713 GGGGGTGTGGGGAGTGGGGAGGG + Intronic
1121634635 14:95445660-95445682 GGGGGTTTGGGGACAGGGCTGGG + Intronic
1122136333 14:99635081-99635103 GTGGGTTTGGGGTGGGGGCAGGG + Intergenic
1122183588 14:99972246-99972268 GGGCGTCTGGAGAGCCGGGAGGG + Intronic
1122209603 14:100166073-100166095 GGGAGTTGGGGGAGCCTGCCCGG + Intergenic
1122282595 14:100632873-100632895 GAGGTTTTGGGGAGCCGGGATGG + Intergenic
1122742914 14:103882137-103882159 GGGGGTATGAGGAGGCAGCAGGG - Intergenic
1122798751 14:104219533-104219555 GGGGGGTTGGGGGGCTGGGAAGG - Intergenic
1123207964 14:106731975-106731997 GGGGGTTGGGGGAGGGGGGAGGG - Intergenic
1123510454 15:20993501-20993523 GTGGGTTGGGGGAGCGGGGAGGG - Intergenic
1123567669 15:21567247-21567269 GTGGGTTGGGGGAGCGGGGAGGG - Intergenic
1123603928 15:22004544-22004566 GTGGGTTGGGGGAGCGGGGAGGG - Intergenic
1124345120 15:28917173-28917195 GGGGGTTTGGAGGGAGGGCAGGG - Intronic
1124848245 15:33311570-33311592 GGGAGTGTGGGGAGCCGGGTCGG + Intronic
1125335811 15:38625344-38625366 GGGGGTGTGGGGAGGGGGGAGGG - Intergenic
1125445592 15:39751823-39751845 GGGGGTTTGGGGAGAGGAAATGG + Intronic
1125506291 15:40269693-40269715 GGGAGTCTGGGGAGCTGGCTTGG - Intronic
1125684991 15:41558872-41558894 GGGGGTTTGCGGCGCTGGCTGGG + Intronic
1126445008 15:48732546-48732568 GGGGGTTTGGGGTGAGGGGAGGG + Intronic
1126688413 15:51267815-51267837 CGGGGCATGGGGAGCCGGCAGGG - Intronic
1127557738 15:60104577-60104599 GGGGGTTGGGGGAGAATGCATGG + Intergenic
1128199363 15:65791896-65791918 GTGGGTTCGGGGAGGAGGCACGG - Intronic
1128452075 15:67811523-67811545 GGGAGTTTGGGCAGCAGTCAGGG - Intergenic
1128725250 15:69983194-69983216 TGGGGTTTGGGGACCAGGAACGG + Intergenic
1129615594 15:77096930-77096952 AGGGGTTTGGGCAGCCTGCGTGG - Intergenic
1130868978 15:87955425-87955447 GGAGATTTGGGGACACGGCATGG + Intronic
1130984065 15:88833359-88833381 GGGAGCTTGGGGAGCAGGAAGGG - Intronic
1131730003 15:95269443-95269465 GGGGGTGTGGGGATGGGGCAGGG + Intergenic
1131827019 15:96330432-96330454 GGGGGTTGGGGGGGCGGGGACGG - Intronic
1132257925 15:100393651-100393673 GGTTATTTGGGGAGCTGGCAGGG + Intergenic
1202976032 15_KI270727v1_random:294341-294363 GTGGGTTGGGGGAGCGGGGAGGG - Intergenic
1132715083 16:1286162-1286184 GGGGGCTCGGGGAGCCGGGTAGG - Intergenic
1133206670 16:4238250-4238272 GGGGGAGTGGGGAGCAGGGAGGG - Intronic
1133455518 16:5939092-5939114 TGGGGTTGGGGGAGGCGGGAGGG + Intergenic
1133609893 16:7423358-7423380 GGGGGGTGGGGGTGCAGGCAGGG + Intronic
1134001026 16:10782966-10782988 GTGGGTTTGGGGAGCAGGTAGGG - Intronic
1134298407 16:12967409-12967431 TGGGGTTGGGGGAGCGGGGAGGG + Intronic
1134364676 16:13565918-13565940 TGGGGTTAGGGGAGCGGGGAGGG + Intergenic
1134503818 16:14789634-14789656 GGGCGGGTGGGGAGCTGGCAGGG + Intronic
1134576753 16:15339265-15339287 GGGCGGGTGGGGAGCTGGCAGGG - Intergenic
1134725689 16:16417224-16417246 GGGCGGGTGGGGAGCTGGCAGGG + Intergenic
1134941745 16:18294634-18294656 GGGCGGGTGGGGAGCTGGCAGGG - Intergenic
1135469116 16:22713369-22713391 AGGGGTTTGGGCTGCAGGCAAGG - Intergenic
1136096863 16:27963074-27963096 AGGGCTTTGGGGAGCCACCAAGG + Intronic
1136178874 16:28537573-28537595 GGGGGTGTGGCAAGCCGGCCTGG + Exonic
1136287710 16:29254103-29254125 TGGGGGTTGGGGGGCGGGCAGGG - Intergenic
1136385869 16:29925749-29925771 GGGGGTCTGGGGTGGGGGCACGG + Intronic
1137088032 16:36153492-36153514 TGGGGTTGGGGGAGCGGGGATGG - Intergenic
1138054357 16:53816484-53816506 GGGGGGGTGGGGAGTGGGCAGGG - Intronic
1138318158 16:56088124-56088146 GGGGGCTTGTGGAGCAGGCAAGG + Intergenic
1138454885 16:57115560-57115582 GGGGGTGCGGAGAGCCGGGAGGG - Intronic
1139009157 16:62611318-62611340 TGGGGTTGGGGGAGCGGGGAGGG - Intergenic
1139547370 16:67655979-67656001 TAGGGTGTGGGGAGCGGGCAGGG + Intronic
1140167739 16:72571424-72571446 TGGGGTTGGGGGAGCGGGTAGGG + Intergenic
1141492259 16:84382126-84382148 GGGGGTGTGGGGAGAGGGGAGGG - Intronic
1142093334 16:88226731-88226753 TGGGGGTTGGGGGGCGGGCAGGG - Intergenic
1142130625 16:88430181-88430203 GGGGGTTTGGGGGTCCGGCGTGG - Exonic
1142168189 16:88604916-88604938 GGGCGTATGGGGAGTTGGCAGGG - Intronic
1142850268 17:2701337-2701359 GGGGGTGTGGTGGGCTGGCAGGG + Intronic
1143180482 17:4981250-4981272 GTGGGTTCGGGGAGCAGGCTTGG + Exonic
1143376350 17:6469853-6469875 GGGAGTCTGGGGAGCTGGTAGGG - Intronic
1145795502 17:27653268-27653290 GGGGGTTTGGGGAGAGGCCAGGG + Intergenic
1145809941 17:27758599-27758621 GGGGGTTTGGGGAGAGGCCAGGG + Intronic
1146659284 17:34653626-34653648 TGGGGTTAGTGGAGCCGGCAGGG + Intergenic
1146671704 17:34742248-34742270 TTGGGTTTGGGAAGGCGGCAAGG + Intergenic
1146674964 17:34767143-34767165 AGGGAGTTGGGGAGCCGGAAGGG - Intergenic
1146788866 17:35740350-35740372 GGGGGCTAGGGGAGCCCTCATGG + Intronic
1147420697 17:40320895-40320917 GGGAGTGTGGGAAGCTGGCAGGG + Intronic
1147636421 17:41967050-41967072 GGGGTTTTGGGGTGCCGGAGAGG + Intronic
1148068752 17:44893773-44893795 GGGGGGTGGGGGGGCAGGCATGG + Intronic
1148154970 17:45418524-45418546 GGGGGTGGGGGGAGCTGGAAGGG - Intronic
1148239001 17:45987821-45987843 GGGGATTTGGAGAGCTGGCCTGG + Intronic
1148694367 17:49550164-49550186 GGTGGTGTAGGGAGCAGGCAGGG - Intergenic
1149167932 17:53775743-53775765 TGGGGTTGGGGGAGCGGGTAGGG + Intergenic
1149602230 17:57900295-57900317 GGGGGCTGGGGGAGCCGGTCAGG + Intronic
1150158085 17:62870859-62870881 GGGGGTTGGGGAGGCCGGGATGG + Intergenic
1150486891 17:65550285-65550307 GGGGGTTGGGGGAAGGGGCATGG - Intronic
1150901341 17:69280882-69280904 TGGGGTTGGGGGAGCGGGGAGGG + Intronic
1152628380 17:81398781-81398803 GGGGCTCTGAGGAGCCGGCCTGG + Intronic
1152773885 17:82187789-82187811 GGGGCTGGGGGGAGCTGGCAGGG + Intronic
1152785297 17:82244865-82244887 TGGGGCTGGGGGAGCCGGCCAGG + Intronic
1153106610 18:1535285-1535307 TGGGGTTGGGGGAGCGGGGAGGG + Intergenic
1153574963 18:6511079-6511101 AGGGGTTGGGGGAGCAGGCAAGG + Intergenic
1153674572 18:7445350-7445372 TGGGGTTGGGGGAGCGGGGAGGG + Intergenic
1155341404 18:24817943-24817965 CGGGGCATGGGGAGCTGGCATGG + Intergenic
1156162841 18:34381108-34381130 TGGGGTGTGGGGAGCGGGGAGGG - Intergenic
1156262547 18:35458877-35458899 GTGGGTTTGGGGAGGAGGCATGG - Intronic
1156301580 18:35841063-35841085 AGGGGCTTGGGGAGCAGGGAGGG - Intergenic
1156425444 18:37006659-37006681 TGGGGTTGGGGGAGCGGGGAGGG - Intronic
1157187139 18:45550311-45550333 GGGGGTTCAGGGAGCAGCCATGG - Intronic
1157497831 18:48169087-48169109 TGGGGCATGGGGAGCAGGCAAGG + Intronic
1158624228 18:59057742-59057764 GGGGGTTCGGGGAGCGTGCTTGG - Intergenic
1160726141 19:618651-618673 GGGGGTCTGGAGAGCAGCCACGG - Intronic
1160772535 19:839390-839412 GGGAGTTTGGGGAGCGGGGAGGG + Intergenic
1160906911 19:1455894-1455916 CGGGGCTTAGGGAGCTGGCAGGG + Intronic
1161027049 19:2041669-2041691 GGGGGTCTGGGGAGCACACAGGG + Intronic
1161051077 19:2164318-2164340 GGGGGTTTGGGGTGTCCCCAGGG - Intronic
1161283897 19:3459213-3459235 GGGGGTGTCGGGAGCCGGAGAGG - Intronic
1161401030 19:4066334-4066356 GAGGGTGGGGGGAGCCGGCGTGG - Intronic
1161487728 19:4544547-4544569 GGGGGTTAGTGGGGCCGGCGGGG + Intronic
1161821449 19:6533299-6533321 GAGGGTTTGGGGAAGGGGCAGGG - Intronic
1162050318 19:8028803-8028825 GGGGGTGTGGGGTGCTGACAAGG + Intronic
1162398304 19:10430663-10430685 GCGGGTCTGGGGCGCCCGCACGG - Intronic
1162781862 19:13010822-13010844 GGTTGTTGCGGGAGCCGGCAGGG + Intronic
1162911468 19:13850206-13850228 AGGGATTTGGGGAGCTGGCCTGG - Intergenic
1162944019 19:14031654-14031676 GGGGGAGTGGGGAGGCGGCCTGG - Intergenic
1163786548 19:19277659-19277681 GTGGGAATGGGGAGGCGGCAGGG + Intronic
1165304686 19:34996217-34996239 GGGGGGTTGGGGTGCAGGCGGGG - Intronic
1165326578 19:35117663-35117685 GGGGGTTGGGGGAGCTGGCGTGG - Intronic
1165443917 19:35846229-35846251 GGGGGTTGGTGGAAGCGGCAGGG - Intronic
1165479715 19:36055268-36055290 GGGGGTTAGGGGACGAGGCATGG - Intronic
1165494294 19:36142586-36142608 CTGGGTTTGGGGAGCCGTCCTGG + Intronic
1165856006 19:38879596-38879618 GGGGGTTGGGGCAGCCTGGAAGG - Intronic
1166068866 19:40376393-40376415 TGGGTTTTGGGGAGCAGGAATGG + Intronic
1166301141 19:41912854-41912876 GGGGGTCCAGAGAGCCGGCAGGG + Intronic
1166613390 19:44220799-44220821 TGGGGTTGGGGGAGGCGGGAGGG - Intronic
1166750497 19:45162094-45162116 GGGGGTGTGGGGGGTTGGCACGG - Intronic
1167201614 19:48069234-48069256 TGGGGTTGGGGGAGTTGGCAAGG + Intronic
1167212099 19:48139727-48139749 GGGGGTGTGGGGTGCAGGGAAGG - Intronic
1168298172 19:55388055-55388077 TGGGGTTTGGGGATCAGGCTTGG + Intronic
1168317473 19:55490416-55490438 TGGGGTCGGGGGAGCCTGCAGGG - Intronic
1168636741 19:58002710-58002732 GGGGGTCAGGAGAGCCGGCTGGG - Exonic
1168718690 19:58543106-58543128 GGGGGTTGGGGGGCCCGGCGTGG + Intergenic
925130282 2:1489445-1489467 GGGGGTTGTGAGAGCCGGGAGGG - Intronic
925137162 2:1529925-1529947 GGGGATATGGGGAGGCTGCAAGG - Intronic
926265634 2:11317756-11317778 TGGGGTTGGGGGAGCGGGGAGGG - Intronic
926723720 2:15981827-15981849 GGGGGTCTGGGAAGCCTTCATGG - Intergenic
926728511 2:16016657-16016679 GGGGGTTGGGGGAGGGGACAGGG - Intergenic
927361973 2:22246424-22246446 GGGGGTTGGGGGAGGTGGGATGG + Intergenic
927713877 2:25341064-25341086 GGGGGTGCGGGGCGCCGGCGGGG - Intronic
928162215 2:28938980-28939002 GGGGGTTTTGGGAGGTGGCCTGG + Intronic
928232257 2:29508546-29508568 TGGGGTGTGGGGAGCGGGAAGGG + Intronic
929571227 2:43024348-43024370 GGGGGTGTGAGGAGCCAGCATGG + Intergenic
930692665 2:54380382-54380404 GGGGGTTGGGGGATGCGGCATGG - Intronic
931224836 2:60320743-60320765 GGGTGCTGGGGGAGCCAGCAAGG - Intergenic
932481006 2:72039318-72039340 AGGGGTTTGGGGAGGGTGCAGGG - Intergenic
932573032 2:72947849-72947871 GGGGACGAGGGGAGCCGGCAGGG - Intronic
933206517 2:79513287-79513309 GGAGGGTTGGGGAGCGGGGAGGG - Intronic
933491018 2:82985804-82985826 GGGGGCTTGGGGCTCAGGCATGG + Intergenic
933715182 2:85354732-85354754 CGGGGCCAGGGGAGCCGGCACGG + Intronic
934698647 2:96420522-96420544 TGGGGTTGGGGGAGGCGGGAGGG - Intergenic
934983876 2:98869998-98870020 GGGTGGCTGGGGAGCCGGCTGGG - Intronic
937221947 2:120346831-120346853 GGGGGTTGAGGCAGCAGGCAAGG - Intronic
937519594 2:122696078-122696100 TGGGGTTGGGGGAGGCGGGAGGG - Intergenic
938302776 2:130228511-130228533 GGGGGTCGGGGGAGCGGGGATGG - Intergenic
938453889 2:131445710-131445732 GGGGGTCGGGGGAGCGGGGATGG + Intergenic
938826800 2:135013754-135013776 GGGGGATTGGGGTGGGGGCAGGG - Intronic
939393525 2:141599945-141599967 GGGTGTGTGTGGAGCGGGCAGGG - Intronic
939431115 2:142109355-142109377 CAGGCTTTGGGGAGCCAGCAGGG - Intronic
940191673 2:151047145-151047167 GGGGGTGAGGGGAGGTGGCAAGG - Intronic
941766146 2:169298853-169298875 GGGGGTTTGGGGAGTCGTGGTGG - Intronic
942252836 2:174062354-174062376 GAGGGTCTGGGGAGCAGGCTTGG - Intergenic
942685358 2:178525008-178525030 TGGGGTTGGGGGAGGCGGGAGGG - Intergenic
943003262 2:182357031-182357053 TGGGGTGTGGGGAGCGGGGAGGG + Intronic
943131229 2:183855389-183855411 TGGGGTGTGGGGAGCGGGGAGGG + Intergenic
943255836 2:185591931-185591953 TGGGGTGTGGGGAGCGGGGAGGG - Intergenic
943273730 2:185841869-185841891 TGGGGTGTGGGGAGGGGGCAGGG - Intergenic
943823902 2:192363044-192363066 TGGGGTTGGGGGAGCGGGGAGGG + Intergenic
943998647 2:194804537-194804559 TGGGGTTGGGGGAGCGGGGAGGG - Intergenic
944308259 2:198202260-198202282 TGGGGTGTGGGGAGCGGGGAGGG + Intronic
945865674 2:215172374-215172396 GGGGGTTGGGGGAGGTGGGAGGG - Intergenic
946106991 2:217379548-217379570 GGGGGTGAGGGGAGCAGGGAGGG + Intronic
946153611 2:217792710-217792732 GAGGGTTTGGGGAGGTGGGAGGG - Intergenic
946165645 2:217862194-217862216 GGGGGCTTGGGCAGAGGGCAGGG + Intronic
946193462 2:218019922-218019944 GGGGAGTGGGGGAGCGGGCAGGG - Intergenic
946929817 2:224660549-224660571 GGGGGTTGGGGGACCGGGCGTGG - Intergenic
948163351 2:235843165-235843187 GGGGGTACAGGGAGCCTGCAGGG - Intronic
948806140 2:240454067-240454089 GGGGCTTCGGGCAGACGGCAGGG + Intronic
949075101 2:242052077-242052099 TGGGGTTGGGGGAGCGGGGAGGG + Intergenic
1168757854 20:328270-328292 GGGGGTGTGGGGAGGCCGGAGGG - Exonic
1168829554 20:837867-837889 GAGGGTTTGGGGAGGAGGCTTGG + Intronic
1169266104 20:4168125-4168147 GGGGGGGTGGGGAGGGGGCATGG + Intronic
1170514493 20:17114932-17114954 TGGGGTGTGGGGAGCGGGGAGGG - Intergenic
1171226255 20:23444268-23444290 GAGGGTCTGGGGAGCAGGCCAGG - Intronic
1171971403 20:31567223-31567245 GGGAGCTTTGGGAGCAGGCATGG + Intronic
1172027182 20:31956607-31956629 GGGGGCTTGGGGAGGTGACAGGG + Intergenic
1172585176 20:36078160-36078182 GGGGAGTTGGGGAGCCAGAAGGG + Intergenic
1172587106 20:36092633-36092655 GGGGGTGTGGGGGGCGGGCGAGG + Intronic
1173006389 20:39142734-39142756 GGCGCCTTGGGGAGCAGGCATGG + Intergenic
1173757311 20:45528347-45528369 TGGGGTTTGGGGAGTGGGGAGGG - Intergenic
1174466872 20:50724647-50724669 GGGGGTTTAGGGAGGAGGGAAGG - Intergenic
1174804110 20:53592498-53592520 GGGGGTGGGGTGAGCAGGCAGGG - Intronic
1175350551 20:58315043-58315065 GGGTGGTTGGTGAGCCAGCAGGG + Intronic
1175633016 20:60557913-60557935 TGGGGTTAGGGGAGCGGGGAGGG - Intergenic
1176132453 20:63502057-63502079 GGGGGCTCTGGGAGGCGGCAAGG - Intergenic
1178700720 21:34831541-34831563 GGGGGTTTGGCGAGCTTGCCGGG - Intronic
1179480124 21:41671683-41671705 GGGGGTTTGGAGAGGAGGCAGGG + Intergenic
1179875089 21:44263051-44263073 GGGGGGTTGGGGAGCTGGGAGGG + Intergenic
1180085208 21:45505220-45505242 GGGGGCCTGGGGGGCCGGGAGGG - Exonic
1180945212 22:19688826-19688848 GGGGCTCTGGGGAGCCTTCAAGG - Intergenic
1181107801 22:20585084-20585106 GGGGCCCTGGGGAGGCGGCATGG - Exonic
1181688696 22:24546249-24546271 GGGGGTTTGGGGGCCGGGCGCGG - Intronic
1181749605 22:24979785-24979807 GGGGTTGTGGGGAGGCGGCATGG - Intronic
1182197587 22:28534912-28534934 TGGGGTTGGGGGAGGGGGCAGGG + Intronic
1183232808 22:36593424-36593446 GGGAGTTTAGGGAGGAGGCAGGG + Intronic
1183292708 22:37012568-37012590 GGGGATTTGGGGAGCAAGGAGGG - Intronic
1183636286 22:39064952-39064974 GGGGGTTTGGGGGGCTTCCAGGG + Intronic
1183645507 22:39123951-39123973 GGCAATTTGGGGAGCCGGGAAGG + Intronic
1183743932 22:39682676-39682698 AGGGCTGTGGGGAGCTGGCAGGG - Intronic
1183942213 22:41302173-41302195 GGGGGTCTCGGGGGCTGGCAGGG + Intronic
1184037976 22:41927429-41927451 GTGGGTTGGGGGAGATGGCAGGG - Intergenic
1184169873 22:42752516-42752538 CGGGGTTGGGGGAGCCTTCACGG - Intergenic
950484833 3:13266941-13266963 GGGGGTTAGGGGTGCAGCCAGGG - Intergenic
951471723 3:23063769-23063791 TGGGGTTGGGGGAGCGGGGAGGG - Intergenic
951487980 3:23235444-23235466 GGGGGAGTGGGGAGTGGGCAGGG + Intronic
951498359 3:23355229-23355251 GGGGGTTGGGGGAGGGGGGAGGG + Intronic
952886532 3:38015898-38015920 GGGGGTCTGGGGAGCCTGAGGGG - Intronic
953194970 3:40723804-40723826 GGGTGTTTGGGGAGAAGGGATGG - Intergenic
954624662 3:52015977-52015999 GGGGGATGGGGGAGATGGCAGGG + Intergenic
955143021 3:56288395-56288417 GGGGGTGTGGGGAGGCACCAGGG - Intronic
956016169 3:64885643-64885665 TGGGGTTGGGGGAGCAGGGAAGG - Intergenic
957259096 3:77877403-77877425 TGGGGTTTGGGGAGGGGGGAGGG - Intergenic
957648748 3:82971097-82971119 TGGGGTTGGGGGAGCAGGGAGGG - Intergenic
962629788 3:137264206-137264228 GGGGGTGTGGGGAGACAGCCTGG - Intergenic
962928820 3:140019112-140019134 GGGGCTTTGGGGAGCAAGGAGGG - Intronic
963372428 3:144417841-144417863 GGGGGTTGGGGGAGAGGGGAGGG + Intergenic
963397564 3:144753430-144753452 TGGGGTTAGGGGAGGGGGCAGGG - Intergenic
965186457 3:165471742-165471764 TGGGGTTGGGGGAGGCGGGAGGG - Intergenic
965278273 3:166716300-166716322 TGGGGTGTGGGGAGCGGGGAGGG - Intergenic
965497695 3:169417957-169417979 TGGGGTTGGGGGAGCGGGGAGGG + Intronic
965600224 3:170447036-170447058 GGGGGTTGGGGGAGGGGGGAGGG + Intronic
966560061 3:181310061-181310083 GGGGGGGTGGGGAGAGGGCATGG - Intergenic
966720728 3:183060715-183060737 TGGGGTTGGGGGAGCGGGGAAGG - Intronic
968078329 3:195829494-195829516 GGGGGTGCGGGGAGCTGGCTGGG - Intergenic
968089923 3:195893362-195893384 GGGTGTTTGGGCAGCAGACAGGG - Intronic
968090158 3:195894398-195894420 GGGGGTTCCAGGAGCCGGCCTGG - Intronic
968196730 3:196712716-196712738 GGGGATGTGGGGACCCGGCGCGG + Intronic
968593658 4:1471872-1471894 GGGGGTTGGGGGAGCCGCCGGGG + Intergenic
968938068 4:3624032-3624054 CGGGGTATAGGGAGGCGGCAGGG - Intergenic
969029885 4:4203437-4203459 GGGGGTTTGCAGAGTCGGTAAGG + Intronic
969639556 4:8388750-8388772 TGCTGTTTGGGGAGCCAGCAGGG + Intronic
969870833 4:10103766-10103788 GGGGGGTGGGGGAGCAGGCTGGG - Intronic
970990605 4:22209189-22209211 GGGGTTTTGGGTAGTCAGCATGG - Intergenic
971662743 4:29440645-29440667 TGGGGTTGGGGGAGCGGGGAGGG + Intergenic
971839661 4:31835106-31835128 GGGGGTGTGGGGAGGGGGGAGGG - Intergenic
974085915 4:57261416-57261438 TGGGGTTGGGGGAGCGGGGAGGG - Intergenic
974804716 4:66863071-66863093 GGGGTTTTGGGGAGAGGGGATGG + Intergenic
978286602 4:107084830-107084852 GGGGGTGTGGGGAGGGGGGAGGG + Intronic
978474247 4:109108171-109108193 TGGGGTGGGGGGAGCCGGAAGGG - Intronic
979423065 4:120530528-120530550 TGGGGTGTGGGGAGGGGGCAGGG - Intergenic
979670655 4:123357224-123357246 GGGAGGTTGGGGAGCCAGCTGGG - Intergenic
981018887 4:140004530-140004552 AGGGGTTTGGGGAGGGGGCAGGG + Intronic
981144411 4:141308572-141308594 TGGGGTTGGGGGAGGGGGCAGGG - Intergenic
981379563 4:144057145-144057167 TGGGGTTTGGGGTGCAGGGAAGG + Intergenic
981391166 4:144193497-144193519 TGGGGTTGGGGGAGCGGGAAGGG - Intergenic
983336210 4:166396935-166396957 TGGGGTGTGGGGAGCAGGGAGGG - Intergenic
987550604 5:19375241-19375263 TGGGGTGTGGGGAGCGGGGAGGG + Intergenic
991088723 5:62672941-62672963 TGGGGTTGGGGGAGCGGGGAGGG - Intergenic
991371539 5:65925477-65925499 GCGGGGTCGGGGAGCGGGCAGGG + Intergenic
991379737 5:66007389-66007411 TGGGGTTGGGGGAGCGGGGAGGG + Intronic
991557784 5:67914809-67914831 GGGGATGTGGGGAGAAGGCAGGG + Intergenic
992939676 5:81750540-81750562 GGGTGTTTGGCGGGCCGGCCGGG - Intronic
993515807 5:88833527-88833549 AGTGGTTTGAGGAGCCAGCAGGG + Intronic
993665110 5:90686355-90686377 TGGGGTGTGGGGAGCGGGGAGGG - Intronic
994526804 5:100916142-100916164 TGGGGTGGGGGGAGCCGGGAGGG - Intergenic
994977548 5:106829328-106829350 TGGGGTGGGGGGAGCCGGGAGGG + Intergenic
995693220 5:114850393-114850415 TGGGGTTTGGGGAGTGGGGAGGG + Intergenic
996140537 5:119904139-119904161 TGGGGTTGGGGGAGAGGGCAGGG - Intergenic
999131342 5:149285741-149285763 GGGGCCTTGGGGAGCAGACATGG - Intronic
999171515 5:149599220-149599242 AGGGGCTGGGGGAGCCAGCAGGG + Intronic
999442213 5:151611341-151611363 GGGGCTGTGGGGACCTGGCAGGG - Intergenic
1001156728 5:169278791-169278813 AGGGGTTTGGGGAGAGAGCAGGG + Intronic
1001178456 5:169495315-169495337 GGGGATTTGGCGAGCAGGCCAGG + Intergenic
1001709412 5:173766062-173766084 GGGGGTTTGAGTAGGCAGCAAGG + Intergenic
1001928765 5:175658208-175658230 GCGGGCTTGGGGACCCGGCGTGG + Intronic
1002321895 5:178381307-178381329 TGGGAGTAGGGGAGCCGGCAGGG - Intronic
1002637741 5:180616491-180616513 TGGGGTGCGGGGAGGCGGCAGGG + Intronic
1004713500 6:18194311-18194333 GGGGGATGGGGGAACCAGCACGG - Intronic
1006360214 6:33583483-33583505 GGAGGTGTGGGGGGCAGGCAGGG - Intergenic
1006369605 6:33635790-33635812 GGGGGATTGAGGAGCCTGGAGGG + Intronic
1006829864 6:36962110-36962132 GGGGGCTAAGGGAGCCGCCAGGG - Intronic
1007303270 6:40884727-40884749 GGGTGTTTGGGGAGCTGGAGAGG + Intergenic
1008300052 6:49825717-49825739 TGGGGGTTGGGGAGCAGGTAGGG + Intergenic
1008313549 6:50008800-50008822 TGGGGTTGGGGGAGCGGGGAGGG + Intergenic
1008390214 6:50941764-50941786 AGGGGTTTGGGGAGATTGCAGGG + Intergenic
1008956487 6:57221836-57221858 GGGGGATGGGGGAGCCGGGCCGG + Exonic
1009275367 6:61671987-61672009 TGGGGTTGGGGGAGGGGGCAGGG - Intergenic
1010297024 6:74210255-74210277 TGGGGTTGGGGGAGGGGGCAGGG + Intergenic
1010620834 6:78071934-78071956 TGGGGTTCGGGGAGCGGGGAGGG + Intergenic
1010644607 6:78372353-78372375 TGGGGTTGGGGGAGCGGGGAGGG + Intergenic
1010857132 6:80853610-80853632 TGGGGTTGGGGGAGCGGGAAGGG + Intergenic
1011350494 6:86417877-86417899 GGGGCTTTGGGAAGGGGGCAGGG - Intergenic
1012093973 6:94934420-94934442 GGGTGTTTGTGGAGCTGTCAGGG - Intergenic
1012483530 6:99694226-99694248 TGGGGTTGGGGGAGCAGGGAGGG + Intergenic
1012819183 6:104063055-104063077 TGGGGTTGGGGGAGCGGGGAGGG + Intergenic
1012912874 6:105137122-105137144 GCGGGCTTGGGGACCCGGCCCGG - Exonic
1013756628 6:113469494-113469516 TGGGGTTGGGGGAGCAGGGAGGG + Intergenic
1015551231 6:134414353-134414375 GGGGGTGGGGGGAGCAGACATGG + Intergenic
1016177442 6:141097974-141097996 TGGGGTGTGGGGAGGAGGCAGGG - Intergenic
1016260488 6:142163689-142163711 GGGGGTGTGGGGAAGAGGCATGG + Intronic
1017561045 6:155628172-155628194 GTGTGTTTGGGGAGCAGGGATGG - Intergenic
1018158629 6:161014907-161014929 GGAGGGTTGGGGACCGGGCAGGG - Intronic
1019274967 7:171479-171501 AGGGGGTCGGGGAGCCGGGAGGG - Intergenic
1019274977 7:171498-171520 AGGGGGTCGGGGAGCCGGGAGGG - Intergenic
1019274987 7:171517-171539 GGGGGGTCGGGGAGCCGGGAGGG - Intergenic
1019599406 7:1873796-1873818 GTGTGTTTGGGGAGCAGGCAGGG + Intronic
1019774964 7:2906860-2906882 GGGGCTGTGGGGAGGCTGCAAGG + Intronic
1022222994 7:28332573-28332595 GGGGGTGTGAGGAGACGGGAAGG - Intronic
1022422087 7:30232869-30232891 AGGGGCTGGGGGAGCCAGCAGGG - Intergenic
1025256863 7:57389799-57389821 GGGGGTATGGGGAGTAGGCATGG - Intergenic
1025581308 7:62721835-62721857 GGGGGTGGGGGGAGGGGGCAGGG + Intergenic
1025840436 7:65141412-65141434 AGGGGTTTGGGGACCCGGGCTGG + Intergenic
1025878279 7:65508752-65508774 AGGGGTTTGGGGACCCGGGCTGG - Intergenic
1025882620 7:65554552-65554574 AGGGGTTTGGGGACCCGGGCTGG - Intergenic
1025890823 7:65648051-65648073 AGGGGTTTGGGGACCCGGGCTGG + Intronic
1026087194 7:67271938-67271960 GGGGGTGGGGGGAGCGGGGAGGG + Intergenic
1026689904 7:72542761-72542783 GGGGGTGGGGGGAGCGGGGAGGG - Intergenic
1026833232 7:73622783-73622805 GAGGTTCTGGGGAGCTGGCAAGG - Intronic
1027001655 7:74658227-74658249 GGGGGTAGGGGGAGGCGGCACGG - Intronic
1027138135 7:75639004-75639026 GGGGGTGTGGGGAGGGGGCTCGG + Intronic
1027922262 7:84408894-84408916 TGGGGTTGGGGGAGCGGGGAGGG + Intronic
1028762303 7:94509823-94509845 GGGCGCCTGGGGAACCGGCACGG + Exonic
1028830729 7:95324334-95324356 GGGGGCTCGTGGAGCTGGCAGGG + Intronic
1029475295 7:100779760-100779782 AGGGGTTTGGGGTGACAGCAGGG - Intronic
1029482947 7:100823955-100823977 AGGGGGCTGGGGAGCCGCCAGGG + Intronic
1031574995 7:123404393-123404415 GGGGGTGTGGGGAGTTGGGAGGG + Intergenic
1032057656 7:128696750-128696772 GGGTGTTTGGGGAGTCACCATGG + Intergenic
1032462704 7:132123807-132123829 GGTGGTTTAAGGAACCGGCAGGG - Exonic
1033633132 7:143181155-143181177 TGGGGTGTGGGGAGGGGGCAGGG + Intergenic
1034299032 7:149999017-149999039 GGGGGCTTGTGGAGGCAGCAGGG - Intergenic
1035022869 7:155809369-155809391 GGAGGTTTGGGGAGCCTGCTCGG - Intronic
1035235081 7:157492057-157492079 TGGGGTGGGGGGAGCCGGGAGGG - Intergenic
1035566319 8:643556-643578 GGGGGTAGGGGGAGCTGCCAGGG - Intronic
1035722176 8:1800109-1800131 GGGGTTCTGGGGTGCTGGCAGGG + Intergenic
1035895378 8:3393839-3393861 TGGGGTGTGGGGAGGGGGCAGGG + Intronic
1036709218 8:11067699-11067721 GGGAGTTTGGGGAGGGGGCCCGG - Intronic
1036932993 8:12974213-12974235 GGTGGTGAAGGGAGCCGGCAAGG - Intronic
1037905509 8:22713912-22713934 TGGGGTCAGGGGAGCCTGCAGGG - Intronic
1037983702 8:23273218-23273240 GGAAATTTGGGGATCCGGCATGG + Intronic
1037989039 8:23307464-23307486 AGGGGGTTGGGGAGCAGGCAGGG + Intronic
1038239331 8:25793592-25793614 TGGGGTTGGGGGAGGCGGGAGGG + Intergenic
1038429793 8:27491073-27491095 GGGGGTGTGGGGAGGAGGCGGGG + Exonic
1039729837 8:40262700-40262722 TGGGGTTTGGGGAGGAGGAAGGG - Intergenic
1039808597 8:41024840-41024862 GGGGGTTGGGGGAGTGGGGAGGG + Intergenic
1039896295 8:41719113-41719135 GGGAGTCTGGGGATCCAGCAGGG - Intronic
1040437895 8:47410800-47410822 TGGGGTTGGGGGAGCGGGGAGGG - Intronic
1040735833 8:50507825-50507847 GGGGGTGTGGGGAGGGGGAAGGG - Intronic
1040771199 8:50977893-50977915 GGGGGTGTGGGGAGGGGGGAGGG + Intergenic
1040896378 8:52373248-52373270 GGGGCTTTGGGGAGGAGGGAGGG - Intronic
1041357057 8:57012398-57012420 TGGGGTTGGGGGAGCGGGGAGGG + Intergenic
1042764753 8:72308774-72308796 GGGGGTGTGGGGAGCAGGGTGGG + Intergenic
1045164593 8:99589346-99589368 TGGGGTTGGGGGAGCGGGGAGGG - Intronic
1045414158 8:101950103-101950125 TGGGGTTTGGGGAGAGAGCAAGG - Intronic
1045643661 8:104279602-104279624 GGGGGTTTATGTAGCAGGCAAGG + Intergenic
1046869053 8:119184379-119184401 GGGAGTTTGGGGAGGGGGCTAGG + Intronic
1047200207 8:122758940-122758962 GGGGGTAAGGGGAGCGGGGAGGG - Intergenic
1047483058 8:125302700-125302722 GAGGGGTTGGGGAGCGTGCAGGG + Intronic
1048879913 8:138863642-138863664 GTGGGTGCGGGGAGCCTGCAGGG + Intronic
1048928518 8:139292039-139292061 TGGGGTTTGGGGAGCCTGTTGGG + Intergenic
1049242445 8:141544853-141544875 TGGGGTTGGGGGAGCCTGCTGGG - Intergenic
1049367845 8:142249310-142249332 GGTGGGCTGGGCAGCCGGCAAGG + Intronic
1049593886 8:143474658-143474680 GGCGGGTCGGGGAGCCAGCATGG + Intronic
1049689627 8:143952952-143952974 GGGCGTGTGCGGAGCTGGCAGGG - Intronic
1051360387 9:16276837-16276859 GGGGGTTCGGGGAGCAAGGACGG + Intergenic
1052448225 9:28591158-28591180 TGGGGTTGGGGGAGGCGGGAGGG + Intronic
1052623984 9:30951362-30951384 TGGGGTGGGGGGAGCCGGGAGGG - Intergenic
1053150363 9:35739265-35739287 GGGGGTATGGGGAGCCAAGAGGG + Intronic
1053461912 9:38277977-38277999 GGGGGCTTGGGGAGGAGGGAGGG - Intergenic
1054718992 9:68584885-68584907 GGGGGATTGGGGGGCAGGGAGGG + Intergenic
1056679800 9:88706935-88706957 GAGGGTGTGCGGTGCCGGCATGG + Intergenic
1056840872 9:89997198-89997220 AGGGGTTTGGGGAGCTTCCAGGG - Intergenic
1056843456 9:90017662-90017684 GGTGGTCTGGGGAGAAGGCATGG + Intergenic
1057430883 9:94992707-94992729 GGGGGTAAGGGGAGCTGGCCTGG + Intronic
1059438531 9:114290146-114290168 GCGGGTGTGGGGGGCGGGCAGGG - Intronic
1059666498 9:116451065-116451087 AGGGGAGTGGGGAGCTGGCAGGG + Intronic
1060091616 9:120748146-120748168 AGGGGTTTTGGGAGCCGGGCGGG + Intergenic
1060389829 9:123268339-123268361 GGCGGTTGGCGGAGCCGGCCCGG - Intronic
1060667858 9:125443688-125443710 GGGGGCTGGGGGAGCTGGCGGGG - Intronic
1061203216 9:129148858-129148880 GGGGGATGGGGGAGCCAGGAAGG - Exonic
1061293723 9:129666188-129666210 CGGGGTCCGGGGAGCCGGCGCGG + Intronic
1061406295 9:130394606-130394628 GGGGGTTGGGGGAGAGGGGAGGG + Intronic
1061893844 9:133636724-133636746 AAGGGTTTGGAGAGCTGGCAGGG - Intronic
1062158230 9:135065942-135065964 GAGGGCATGGGGAGCAGGCAGGG - Intergenic
1062399584 9:136366534-136366556 GGGGGTCTGGGCAGCCCCCATGG - Intronic
1062432779 9:136533363-136533385 GAGGTTTGGGGGAGCCGCCAGGG - Intronic
1062452709 9:136622254-136622276 GGGGGGTTGGGGGACAGGCAGGG - Intergenic
1062458922 9:136654759-136654781 AGTGGTTGGGGGAGCCGGCTGGG + Intergenic
1062583974 9:137240785-137240807 GGGCCTTTCGGGAGCCGGGAAGG - Intergenic
1062589419 9:137266754-137266776 GGGGGTTTGAGGAGATGGCCTGG + Intronic
1062688582 9:137828889-137828911 GGGGGCTTGTGGAGCCTGCTAGG + Intronic
1186508743 X:10114872-10114894 GGAGTTTTGGGGATCCGCCAGGG + Intronic
1186899556 X:14038781-14038803 GGGGATTTAGGGAGCCAGAATGG + Intergenic
1186914034 X:14200831-14200853 GGGGGTTGGGGGAGGGGGGAGGG - Intergenic
1187210065 X:17221386-17221408 TGGGGTTGGGGGAGCGGGGAGGG - Intergenic
1187656706 X:21483441-21483463 TGGGGTTGGGGGAGCGGGGAGGG + Intronic
1189180143 X:38996189-38996211 GGGGGAATGGGAAGTCGGCATGG + Intergenic
1189407066 X:40735159-40735181 GGGGGGCTGGGGAACAGGCAGGG + Intronic
1190064121 X:47228899-47228921 GGGTGTTTGGGCAGGCAGCAGGG - Exonic
1191173671 X:57477630-57477652 TGGGGTTGGGGGAGCGGGGAGGG - Intronic
1192981018 X:76341350-76341372 TGGGGTTGGGGGAGCTGGGAGGG + Intergenic
1193370166 X:80686264-80686286 GGGGGTTGGGGGAGGGGGGAGGG + Intronic
1193934158 X:87595161-87595183 TGGGGTTGGGGGAGGGGGCAGGG - Intronic
1194246544 X:91519141-91519163 GGGGGTTTGGGAAGCAGGTAGGG - Intergenic
1194683002 X:96876760-96876782 TGGGGTTTGGGGAGGGGGGAGGG + Intronic
1195252826 X:103064467-103064489 GGGGGTTTGGGGTGGGGGAAAGG - Intergenic
1195342391 X:103918578-103918600 GGGTGTTCGGGGAGGTGGCAAGG - Intergenic
1195919786 X:109972080-109972102 GGGGGTTAGGGGGGCGGGCAGGG + Intergenic
1198018520 X:132635590-132635612 GGGGGTTTGGGGAGTGGAGATGG - Intronic
1198518153 X:137428562-137428584 GGGGGGCTGGGAAGCCAGCAGGG + Intergenic
1198839321 X:140840035-140840057 TGGGGTTGGGGGAGCGGGGAGGG - Intergenic
1199554299 X:149089796-149089818 TGGGGTTTGGGGAGCGGGGAGGG + Intergenic
1200054362 X:153451066-153451088 GGGGGTCTGGAGAGACGCCAGGG - Intronic
1200076713 X:153554808-153554830 GGGGCCTTGGGGAGAAGGCAGGG + Intronic
1200565506 Y:4760385-4760407 GGGGGTTTGGGAAGCAGGTAGGG - Intergenic
1201565590 Y:15362318-15362340 GGGGCTTGTGGGAGCCCGCATGG - Intergenic
1202167039 Y:22000544-22000566 TGGGGTGTGGGGAGCGGGGAGGG + Intergenic
1202224321 Y:22585829-22585851 TGGGGTGTGGGGAGCGGGGAGGG - Intergenic
1202318793 Y:23609831-23609853 TGGGGTGTGGGGAGCGGGGAGGG + Intergenic
1202360903 Y:24109514-24109536 TGGGGTGGGGGGAGCGGGCAAGG - Intergenic
1202509875 Y:25560604-25560626 TGGGGTGGGGGGAGCGGGCAAGG + Intergenic
1202551975 Y:26060227-26060249 TGGGGTGTGGGGAGCGGGGAGGG - Intergenic