ID: 900390983

View in Genome Browser
Species Human (GRCh38)
Location 1:2433820-2433842
Sequence TCTGAGGGGGTTTGGGGAGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 458
Summary {0: 1, 1: 0, 2: 4, 3: 36, 4: 417}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900390983_900391001 22 Left 900390983 1:2433820-2433842 CCGGCTCCCCAAACCCCCTCAGA 0: 1
1: 0
2: 4
3: 36
4: 417
Right 900391001 1:2433865-2433887 GTGCCCACACTGGGGGTCCCGGG 0: 1
1: 0
2: 3
3: 28
4: 211
900390983_900391000 21 Left 900390983 1:2433820-2433842 CCGGCTCCCCAAACCCCCTCAGA 0: 1
1: 0
2: 4
3: 36
4: 417
Right 900391000 1:2433864-2433886 TGTGCCCACACTGGGGGTCCCGG 0: 1
1: 0
2: 1
3: 24
4: 209
900390983_900390991 -3 Left 900390983 1:2433820-2433842 CCGGCTCCCCAAACCCCCTCAGA 0: 1
1: 0
2: 4
3: 36
4: 417
Right 900390991 1:2433840-2433862 AGAGCCATCGACTCCCTCCACGG 0: 1
1: 0
2: 0
3: 4
4: 129
900390983_900390999 15 Left 900390983 1:2433820-2433842 CCGGCTCCCCAAACCCCCTCAGA 0: 1
1: 0
2: 4
3: 36
4: 417
Right 900390999 1:2433858-2433880 CACGGATGTGCCCACACTGGGGG 0: 1
1: 0
2: 0
3: 9
4: 99
900390983_900390995 12 Left 900390983 1:2433820-2433842 CCGGCTCCCCAAACCCCCTCAGA 0: 1
1: 0
2: 4
3: 36
4: 417
Right 900390995 1:2433855-2433877 CTCCACGGATGTGCCCACACTGG 0: 1
1: 0
2: 0
3: 7
4: 150
900390983_900390998 14 Left 900390983 1:2433820-2433842 CCGGCTCCCCAAACCCCCTCAGA 0: 1
1: 0
2: 4
3: 36
4: 417
Right 900390998 1:2433857-2433879 CCACGGATGTGCCCACACTGGGG 0: 1
1: 0
2: 0
3: 15
4: 130
900390983_900390996 13 Left 900390983 1:2433820-2433842 CCGGCTCCCCAAACCCCCTCAGA 0: 1
1: 0
2: 4
3: 36
4: 417
Right 900390996 1:2433856-2433878 TCCACGGATGTGCCCACACTGGG 0: 1
1: 0
2: 1
3: 7
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900390983 Original CRISPR TCTGAGGGGGTTTGGGGAGC CGG (reversed) Intronic
900390983 1:2433820-2433842 TCTGAGGGGGTTTGGGGAGCCGG - Intronic
900552234 1:3262617-3262639 GCTGAGGGGTTTTGGGGAAGGGG + Intronic
900615160 1:3562437-3562459 TATGCGAGGGTTTGGGGATCTGG - Intronic
900798490 1:4723705-4723727 TCTGCAGGGGTTTGGGGAAAGGG + Intronic
900816732 1:4853036-4853058 TCTGTGGGGTTTTGGTAAGCTGG + Intergenic
900979062 1:6035818-6035840 TCTGAGGGGCTTTGTGGGGATGG + Intronic
901790491 1:11651200-11651222 CCTGAGGAGGTGAGGGGAGCAGG - Intronic
901810912 1:11766385-11766407 CCTGGGGTGGTCTGGGGAGCTGG + Exonic
901847289 1:11991497-11991519 GGGGAGGGGGTTTGGGCAGCAGG + Intronic
901861662 1:12078592-12078614 TCTCATGGGGAGTGGGGAGCAGG + Intronic
902414744 1:16232062-16232084 TCTCTGGGGGGTTGGGAAGCAGG + Exonic
902973870 1:20074836-20074858 TCTGAAGGGCTGTGGGGAGTAGG - Intronic
903281574 1:22253018-22253040 GCTGTGGGGCTTTTGGGAGCTGG + Intergenic
903295320 1:22339768-22339790 GGTGAGCGGGTGTGGGGAGCAGG - Intergenic
903693903 1:25193447-25193469 TCTGAGGGTGTCTGGGGGGCTGG - Intergenic
904359445 1:29962567-29962589 GCTAAGGGGGTGTGGTGAGCAGG - Intergenic
904521996 1:31102792-31102814 TCTGAGGCAGTATGGGGAGGTGG - Intergenic
904991672 1:34598318-34598340 TCTGAGGGGGTCTGGGATTCAGG - Intergenic
906264571 1:44418261-44418283 TGGGAGGAGGTTGGGGGAGCAGG + Intronic
906527938 1:46507199-46507221 ACTGTGGGGGTTGGGGGAGAAGG + Intronic
908649249 1:66313954-66313976 TGTGAGGGAGTTAGGGGAGGAGG - Intronic
908734083 1:67257485-67257507 TGTGAGGGGGGCTGGGGAGAGGG + Intronic
910799858 1:91134141-91134163 TCTGAAGGAGTCTGGGGAGACGG + Intergenic
911595538 1:99794746-99794768 CCTGTGGGGGTTGGGGGGGCTGG - Intergenic
911764335 1:101656108-101656130 TTAAAGGGGGTTTGGGGATCAGG + Intergenic
911791993 1:102029064-102029086 TGTTGGGGGGTTTGGGGGGCTGG + Intergenic
914433420 1:147640142-147640164 TCTGCTGGGGTTAGGGGAGGGGG - Intronic
915105756 1:153534295-153534317 TGTGATGGGGTTTGGGGGCCTGG - Intergenic
915362017 1:155291676-155291698 TTTGAGTGGGTATGGGAAGCTGG + Intronic
915409361 1:155688597-155688619 TCTGAGGGGGAGTGGAGAACTGG - Exonic
915485472 1:156217078-156217100 TGTGGTGGGGTTGGGGGAGCGGG + Intronic
915625280 1:157110726-157110748 TGTCAGGGAGTTTAGGGAGCTGG - Intergenic
916070570 1:161167349-161167371 TCTGAGGGCATGTGGAGAGCAGG + Exonic
916815099 1:168343931-168343953 TGTGAGAGGGAGTGGGGAGCAGG - Intergenic
917225270 1:172774999-172775021 TCAGACTGGGGTTGGGGAGCAGG + Intergenic
917493135 1:175515427-175515449 TCAGAGAGGGTTTGAGGAGGAGG + Intronic
917689921 1:177458331-177458353 ACTGAGTGGGTTTGGGGATGTGG + Intergenic
917801409 1:178573845-178573867 CCTGTGGGTGTATGGGGAGCAGG - Intergenic
919472742 1:197999210-197999232 ACTGAGGAGGCATGGGGAGCTGG - Intergenic
920129829 1:203723619-203723641 TCTGGAGGAGTTAGGGGAGCTGG - Intronic
920421599 1:205837994-205838016 ATTGAGGGGGTTGGGGGAGTGGG - Intronic
921083170 1:211760449-211760471 TTTGAGGGGGGTTGGGGGGACGG - Intronic
923056627 1:230431219-230431241 TCTGAGTGGGTCTGGAAAGCAGG + Intergenic
923650676 1:235870151-235870173 TCTTGGGGGGTGTGGGGAGGTGG + Intronic
1065903634 10:30229308-30229330 AATGTGGGGGCTTGGGGAGCTGG + Intergenic
1066148787 10:32592695-32592717 TGTCGGGGGGTGTGGGGAGCAGG - Intronic
1067266851 10:44753754-44753776 TGTTAGGGGGTTTGGAGAGTTGG + Intergenic
1067570678 10:47368837-47368859 TCTTTGGGGGTTTGGGGTTCTGG + Exonic
1068758080 10:60677933-60677955 TCTGAGCGGATTTGGGCAGCTGG - Intronic
1069619433 10:69827509-69827531 TCAGAGAAGGTTTGGGGAGCAGG + Intronic
1069752091 10:70751456-70751478 CCTGAGGGGAGATGGGGAGCTGG - Exonic
1069785037 10:70982312-70982334 TGGGAGGGAGGTTGGGGAGCAGG - Intergenic
1069828638 10:71269572-71269594 TCAGAGGGGGTTTGGGCAGCAGG - Intronic
1070579786 10:77710763-77710785 TTTCAGCGGGTGTGGGGAGCTGG - Intergenic
1071872014 10:89806369-89806391 TCTGAGGGGATCAGGGGACCTGG + Intergenic
1072733160 10:97861700-97861722 TCTGAATGGGTTTGGGAAGTGGG + Intronic
1073042202 10:100615278-100615300 TGTGTGTGGGTTTGGGGAGGAGG + Intergenic
1073441157 10:103553617-103553639 TCTGAGTGGGTCTGGGGAAGCGG - Intronic
1073704869 10:105971606-105971628 TCTGAAGGTGCTTGGGTAGCTGG + Intergenic
1075612229 10:123863421-123863443 ATTGAGGGGGTTTGTGCAGCAGG + Intronic
1075657109 10:124169300-124169322 CCTGGGGGTGTTTGGGGAGCAGG - Intergenic
1075945351 10:126428257-126428279 ACTGTGGGTGTCTGGGGAGCTGG + Intronic
1076698044 10:132256604-132256626 TCTCCAGCGGTTTGGGGAGCTGG - Intronic
1077167999 11:1152373-1152395 TCTGGGGGGTCCTGGGGAGCAGG + Intergenic
1077442421 11:2574889-2574911 CCTGAGCAGGTTTGGGCAGCAGG + Intronic
1078012109 11:7580334-7580356 GCTGAGGTGGTGTGGAGAGCTGG + Intronic
1078753762 11:14189454-14189476 TCCGAGGGGGCTTAGGCAGCTGG - Intronic
1078830242 11:14971469-14971491 TCTGTGTGGCTTTGGGGAGAAGG - Intronic
1078861540 11:15252209-15252231 TGTCAGGGGATTTGGGGAGGAGG + Intergenic
1079977528 11:27110382-27110404 TCTGAAGGGCTTTGGGGACTAGG - Intronic
1080008129 11:27430895-27430917 CTTGTGGGGGTTGGGGGAGCTGG - Intronic
1080252738 11:30253125-30253147 TGTGGTGGGGTTGGGGGAGCGGG + Intergenic
1081757507 11:45555110-45555132 ACTGAGGGTGTCTGGGGAGTAGG - Intergenic
1082663529 11:55945466-55945488 TTTGCGGGGGGTTGGGGGGCTGG - Intergenic
1083061810 11:59880930-59880952 TCTGAGGAGGTTTGAGGTGGAGG + Intergenic
1083426620 11:62591241-62591263 TCCGAGGGGATTTGGAGAGTCGG - Intronic
1083758009 11:64801803-64801825 TGAGAGGGGGTTTGGGGAGGTGG - Intronic
1083824064 11:65188400-65188422 TCTGAGGAGCTGTGAGGAGCAGG - Exonic
1083843372 11:65316923-65316945 TGTGATGGGGTTGGGGGTGCGGG + Intronic
1084191938 11:67503441-67503463 TCTGAGGGGTGTGGCGGAGCTGG - Intronic
1085444090 11:76589290-76589312 TGGGAGGGTGGTTGGGGAGCTGG - Intergenic
1085508138 11:77071735-77071757 TCTGCCTGGGTATGGGGAGCAGG + Intronic
1085697240 11:78715394-78715416 CCTGAGGGGGTATGGTGAGGGGG + Intronic
1086338793 11:85826360-85826382 TCTGTGAGGGTTTGGGCAGATGG + Intergenic
1086473366 11:87142043-87142065 CCTGAGGGGGTTTGGGGAGGAGG - Intronic
1089907079 11:122051167-122051189 TGTGTGTGTGTTTGGGGAGCGGG - Intergenic
1091132323 11:133156925-133156947 GCTGAGGGGGTTTGAGAGGCAGG - Intronic
1091209624 11:133845060-133845082 TCTCAGTGGGTGTGGGGATCTGG - Intronic
1091917236 12:4278465-4278487 TGGGAGGGGGTAAGGGGAGCTGG + Intronic
1092163697 12:6329817-6329839 TCTGAAGGGGGTTGGGGATGGGG + Exonic
1093573747 12:20700594-20700616 TCTCGGGGGATTGGGGGAGCGGG - Intronic
1095051038 12:37554509-37554531 TATGGGGGAGTTGGGGGAGCAGG + Intergenic
1095115891 12:38351857-38351879 TGTCATGGGGTTTGGGGAGTGGG - Intergenic
1095503396 12:42865782-42865804 TGTGAGGAGGTTTGAGGAGTGGG + Intergenic
1095574692 12:43722907-43722929 ACTAAGGGTGTTTGGGCAGCAGG - Intergenic
1096154768 12:49335909-49335931 TCTGAGCTGGGTTGGGGAGAGGG + Intronic
1096237974 12:49942650-49942672 TCTGAGGGGGTTGGGGGAAGGGG + Intergenic
1096254834 12:50056686-50056708 TCTGAGAGGCCTTGGGGAGGGGG - Intergenic
1096845651 12:54405096-54405118 TCAGAAGGGATTTGGGGAGAGGG - Intronic
1097172490 12:57125043-57125065 TCTGAGGAGGGTAGAGGAGCAGG + Intronic
1099624132 12:85046997-85047019 TCTCATGGGGTTGGGGGAGGGGG + Intronic
1102320441 12:111928920-111928942 TCAGAGGGGATATGTGGAGCTGG - Intergenic
1103820305 12:123692505-123692527 TCTGATGGTTTTTGGGGAGTGGG + Intronic
1104061312 12:125270775-125270797 TCTGTGGGGGTTGGGGGGGCGGG + Intronic
1104639894 12:130460799-130460821 TCTGAGGGGGTGTCGGGAGCAGG + Intronic
1104694456 12:130852784-130852806 TCTGCTGGGGTCTGGAGAGCTGG - Intergenic
1104794686 12:131509278-131509300 TCTGAGCAGGTCTGGGAAGCAGG + Intergenic
1105898521 13:24738556-24738578 CCTGAGGGAGTCAGGGGAGCAGG - Intergenic
1105952582 13:25244155-25244177 GCTGGGAGGGTTTGGGGTGCGGG + Intergenic
1107372369 13:39766705-39766727 TCTGTGGGAGCTTGGGGAGGGGG - Intronic
1107560709 13:41554681-41554703 TCTGAGGGGGGTTCATGAGCTGG - Intergenic
1108126450 13:47249618-47249640 GCTGAGGGGTTTTTGGGAGGTGG - Intergenic
1108396745 13:49997228-49997250 TCTGCGTGGGTTGGGGGGGCTGG + Intronic
1108550593 13:51539827-51539849 TCTGATCAGATTTGGGGAGCGGG - Intergenic
1108695708 13:52900675-52900697 TCTAACTGGGTTTGGGCAGCAGG - Intergenic
1109418956 13:62084765-62084787 TCTGGGGGGATTTGGGGTGATGG - Intergenic
1109993565 13:70091187-70091209 TCTTTTGGGGTTTTGGGAGCTGG + Intronic
1110510992 13:76350273-76350295 TCTGTTGGGGGTTGGGGGGCTGG - Intergenic
1111005681 13:82245065-82245087 TCTGATTGGATTTGGGGAGTTGG + Intergenic
1111109165 13:83684884-83684906 GCTGATTGGGGTTGGGGAGCAGG + Intergenic
1111131020 13:83975737-83975759 TCTGAGTGTGTTTGGAGACCTGG + Intergenic
1111888163 13:94049295-94049317 TCAGTGGGGGGTTGGGGAGGAGG - Intronic
1112167154 13:96931756-96931778 CCTCAGGGGGTTTGGGAAGAGGG + Intergenic
1112543145 13:100337008-100337030 TCTGTCGGGGTTGGGGGAGAGGG + Intronic
1113547623 13:111166365-111166387 TCTGAGGGTGTTTGGGCAGAGGG + Intronic
1114696346 14:24630819-24630841 CATGTGGGGGTTTGGGGAGGTGG + Intergenic
1115731282 14:36272305-36272327 TCTGGGGAGCTTTGGGGAGCAGG - Intergenic
1117293562 14:54357353-54357375 TCTGAGCTGGTTGGAGGAGCAGG - Intergenic
1117389543 14:55249859-55249881 TCTGAGGGGGTATTGAGTGCTGG - Intergenic
1118033690 14:61842770-61842792 TGTTAGGGGGTGGGGGGAGCGGG + Intergenic
1118094128 14:62517490-62517512 TGTCATGGGGTTGGGGGAGCAGG - Intergenic
1119325367 14:73756885-73756907 TCTGAGGAGGTTCCAGGAGCAGG + Intronic
1119788395 14:77329048-77329070 CCTGAGGGGGTTTGGCGAAGGGG + Intronic
1119889348 14:78171234-78171256 TTTGAGGGGGTGTGAGGAGGTGG + Intergenic
1121473798 14:94175354-94175376 CCTCAAGGGGATTGGGGAGCTGG - Intronic
1122173797 14:99901172-99901194 ACTGAGGGGTTCTGGGAAGCAGG - Intronic
1122415864 14:101549207-101549229 GCTGTGGGGGTCTGGGGAGTGGG - Intergenic
1122581324 14:102773480-102773502 TCGAAGGGGGTTCAGGGAGCTGG - Intergenic
1125280145 15:38034570-38034592 TCTGGGGGTGGTTGGGGAGGTGG - Intergenic
1125449760 15:39796042-39796064 TTTGAGGTGGTTTGAGGAGGGGG - Intergenic
1128256289 15:66199499-66199521 TCTGGGCTGGCTTGGGGAGCAGG - Intronic
1129119857 15:73389683-73389705 AATGCGGGGGTTGGGGGAGCAGG - Intergenic
1129255251 15:74330639-74330661 TGTTAGGTGGGTTGGGGAGCTGG - Intronic
1129265569 15:74391561-74391583 CCTGTGGGACTTTGGGGAGCAGG - Intergenic
1129714291 15:77838036-77838058 TCTGAGGGGGTTGGGGGGGCGGG - Intergenic
1129891785 15:79076430-79076452 TCTGAGAGGGCATGAGGAGCAGG - Intronic
1130613362 15:85380919-85380941 GCTGCGGGGGTTTCGGGGGCGGG + Intronic
1130842024 15:87709711-87709733 CCTGTGGGGGTTTGGGCAGGTGG + Intergenic
1131551932 15:93364742-93364764 TGTGAGGGAGTTGGAGGAGCAGG + Intergenic
1131718912 15:95145854-95145876 TCTGAGAGGGTTTGTGGTGTCGG + Intergenic
1131856206 15:96598480-96598502 TGTGAGGGGAGTTGGGGAGGGGG + Intergenic
1132247558 15:100309446-100309468 ACTGAGGGGGCTTGGGCAGGGGG - Intronic
1132652741 16:1028922-1028944 TCTGTGCGGGTGTGGGGGGCCGG + Intergenic
1133326934 16:4947585-4947607 TCTGAGGGTGGTTGAGGACCCGG + Intronic
1136007444 16:27340762-27340784 TAAGAGGGGGTTGGGGAAGCTGG + Intronic
1136417154 16:30111291-30111313 TCTGAGGGGAGCTGGGGAGCTGG + Intronic
1136913927 16:34163668-34163690 TCGGAGGGGTGTTGGGGAGGAGG - Intergenic
1137088034 16:36153497-36153519 TGTGGTGGGGTTGGGGGAGCGGG - Intergenic
1137606629 16:49791038-49791060 TCTGTGAGGCTTTGGGGAGGAGG - Intronic
1138054359 16:53816489-53816511 TGTGAGGGGGGGTGGGGAGTGGG - Intronic
1138252317 16:55510441-55510463 TCTGCGGGGGTTGGGGGGGTGGG + Intronic
1138319645 16:56101259-56101281 GCTGAGGGGTTGTGGGGAGAGGG - Intergenic
1138417454 16:56879520-56879542 TCTGTGGGGATTTGGGGCTCAGG - Exonic
1138459757 16:57141209-57141231 TCTGAGGGGGTTTGGGCCCCAGG + Intronic
1139690888 16:68641376-68641398 TCTGAGTGGGTTTGGTGAATGGG + Intronic
1140456875 16:75110884-75110906 GCTGGGGTGGTTTGGGGAGAGGG + Exonic
1140628989 16:76829346-76829368 TCTGCGGGGGTCGGGGGTGCTGG - Intergenic
1140847541 16:78904667-78904689 TTTGAGAGAGGTTGGGGAGCAGG + Intronic
1141487033 16:84347280-84347302 TCTCCGGGGTTTTGGGAAGCAGG - Intergenic
1141492262 16:84382131-84382153 TGTCAGGGGGTGTGGGGAGAGGG - Intronic
1143584832 17:7845903-7845925 TGTGAAGGGGGTAGGGGAGCAGG - Exonic
1143762499 17:9115591-9115613 TCTGAGTGTGTTTGTGAAGCTGG - Intronic
1143871456 17:9959762-9959784 GCTCACGGGGTTGGGGGAGCGGG - Intronic
1146032235 17:29376166-29376188 GCTGGGGTTGTTTGGGGAGCGGG + Intergenic
1146294797 17:31641151-31641173 TCTCAGGGGGAGTGGGGGGCGGG - Intergenic
1146311636 17:31773326-31773348 TCAGAGGCTGTTTAGGGAGCTGG - Intergenic
1146935662 17:36811187-36811209 CCTGATGGAGTGTGGGGAGCAGG - Intergenic
1146969118 17:37058063-37058085 GCTGAGGGGGGTGGGGGAGCAGG + Intergenic
1147192807 17:38747546-38747568 GCTGAGGTGGTTCGGGGAGGGGG + Intronic
1147538495 17:41336035-41336057 TCTCAGGGGCTGTGGGCAGCAGG - Intergenic
1147636420 17:41967045-41967067 GCGGAGGGGTTTTGGGGTGCCGG + Intronic
1148228517 17:45916462-45916484 AGAGAGGGGGTTTGGGCAGCAGG - Intronic
1148239000 17:45987816-45987838 CCTGTGGGGATTTGGAGAGCTGG + Intronic
1148864959 17:50623677-50623699 TAGGAGGGGGTCTGGGCAGCCGG - Intronic
1149385729 17:56141670-56141692 TGTGTGGGGGGTGGGGGAGCAGG + Intronic
1149548518 17:57522325-57522347 TCTGGGGGAGTTTGGAGAGCTGG + Intronic
1150329394 17:64282750-64282772 GCTCAGTGGGTTTGGGGACCTGG + Intergenic
1150576825 17:66438003-66438025 TCTGGTGGGGTTTGGGGGGTGGG + Intronic
1151598469 17:75091835-75091857 TCTGAGGGGGTTGGGGGGCCAGG + Intronic
1152873571 17:82772702-82772724 TCAGTGGTGGTTTGGGGTGCTGG + Intronic
1152927042 17:83092146-83092168 TCAGAGGGGGTTCTGTGAGCAGG + Intronic
1152938793 17:83154980-83155002 TCTGAGGGTCTATGGGGAGGTGG - Intergenic
1152938808 17:83155029-83155051 TCTGAGGGTCTATGGGGAGGTGG - Intergenic
1153534614 18:6087492-6087514 TCTGAGTGGAGGTGGGGAGCTGG + Intronic
1154329491 18:13418105-13418127 TCAGAGGGCGGGTGGGGAGCGGG - Intronic
1155082443 18:22424076-22424098 TCTGTGGAGGTTGGGGGAGCTGG + Intergenic
1155323671 18:24644516-24644538 TTTGAGGGGGGTTGGGGAGATGG - Intergenic
1156042072 18:32834270-32834292 TCTGATGGATTTTGGGGTGCAGG + Intergenic
1156266822 18:35496719-35496741 TTGGATGGGGGTTGGGGAGCAGG + Intronic
1156425447 18:37006664-37006686 TGTCATGGGGTTGGGGGAGCGGG - Intronic
1157282720 18:46356722-46356744 TCAGAAGGGCTTTGGGGAGGTGG - Intronic
1157579260 18:48764009-48764031 GCTGATGGGGGGTGGGGAGCAGG - Intronic
1158084566 18:53635500-53635522 CCTGTCGGGGGTTGGGGAGCTGG + Intergenic
1158476062 18:57780496-57780518 GGTGAGGGGGTGTGGAGAGCAGG + Intronic
1160177905 18:76611164-76611186 TGTGAGGGCGTGTGGGGAGTGGG - Intergenic
1160310699 18:77787215-77787237 TCCGAGGTGGGTTGTGGAGCTGG + Intergenic
1160579094 18:79873525-79873547 TGTGAGGGGCGTCGGGGAGCCGG + Intronic
1160772532 19:839385-839407 GGGGAGGGAGTTTGGGGAGCGGG + Intergenic
1160941107 19:1620910-1620932 TCTGTGAGGGTTTGGGGGGAGGG - Intronic
1161059465 19:2207822-2207844 ACTGAGGGGCCTTGAGGAGCTGG - Intronic
1161113254 19:2481551-2481573 CTTGAAGGGGTCTGGGGAGCTGG - Intergenic
1161648517 19:5469575-5469597 CCTGAGGGGGTCTGGGGAAGGGG + Intergenic
1162158789 19:8697149-8697171 TCAGAGGTGGTCTGGGGAGGGGG + Intergenic
1162911470 19:13850211-13850233 TCCTAAGGGATTTGGGGAGCTGG - Intergenic
1163829496 19:19540990-19541012 TGTGAGGGGGTTGGGGAAGAAGG + Intronic
1164330176 19:24246877-24246899 TCTGAGGGCGTTTGGTGACGTGG - Intergenic
1165230684 19:34384682-34384704 TCTCAGGAGGTCTGAGGAGCTGG + Intronic
1165711354 19:38013018-38013040 TCTGAGGGGCTTTGGGCATCTGG + Intronic
1166373863 19:42316265-42316287 TCTGAGGGGGTAGGGGGTGGGGG + Intronic
1167271585 19:48509313-48509335 GCTGAGGGGGCATGGGGAGGAGG + Intronic
1167392102 19:49202265-49202287 TCTGGTTGGGTTTGGGGAGAAGG - Intronic
1167530759 19:50014762-50014784 TCTGAGGGGAAATGGGGACCTGG + Intronic
924988264 2:289427-289449 TCGCAGGGGGTCTGGGGAGGGGG - Intergenic
926029711 2:9575552-9575574 TTTGGGGGGGGTTGGGGAGGAGG - Intergenic
926330694 2:11822821-11822843 TCTGAGAGGGTTTGGCTAGGTGG + Intronic
926904469 2:17792972-17792994 ACTGAGGGGGGTTTGGGAGGAGG - Intronic
927864689 2:26580888-26580910 TCAGAAGGGGAGTGGGGAGCCGG + Intergenic
928077885 2:28281599-28281621 TCTGATGGTGAATGGGGAGCAGG + Intronic
928232255 2:29508541-29508563 TGTCATGGGGTGTGGGGAGCGGG + Intronic
929921174 2:46172510-46172532 CCTGGGAGGGTTTGAGGAGCAGG + Intronic
930024196 2:47020489-47020511 GATGAGGGTGTCTGGGGAGCTGG - Intronic
930109691 2:47668003-47668025 TCTGAGGGAGGTAAGGGAGCAGG + Intergenic
931577887 2:63738852-63738874 TCGGGGGGATTTTGGGGAGCTGG - Intronic
931967699 2:67551622-67551644 ACTGAGGGGCATTGGAGAGCAGG - Intergenic
932573682 2:72951278-72951300 TCTGAGCGGGGTTGGGAAGATGG - Intronic
934602242 2:95666483-95666505 TCTGGGGTGGTTTGGGGATTAGG + Intergenic
935327359 2:101948908-101948930 GCTGAGGGGGTTTGGAGGGAAGG + Intergenic
936032863 2:109086258-109086280 TCTGAGGTTGTTGGGGGAGGGGG + Intergenic
936535601 2:113308638-113308660 TCTGGGGTGGTTTGGGGATTAGG + Intergenic
937003918 2:118493767-118493789 TCTGTGGGGGGTTGGGAAGGGGG + Intergenic
937347064 2:121132600-121132622 TCTGTGGGGGTTGGGGGTGCAGG + Intergenic
938863985 2:135399201-135399223 TCGGAAGGGGCCTGGGGAGCTGG - Intronic
939018655 2:136932403-136932425 ACTGTGGGGGTTTGGGGCACTGG + Intronic
941069022 2:160935485-160935507 GCTTAGGTGATTTGGGGAGCTGG + Intergenic
942411603 2:175715109-175715131 TGTCATGGGGTTTGGGGAGAAGG + Intergenic
943255839 2:185591936-185591958 TGTCATGGGGTGTGGGGAGCGGG - Intergenic
943760008 2:191597567-191597589 TCTCAGGGTTTTTGGGGAGAGGG + Intergenic
944308256 2:198202255-198202277 TGTCATGGGGTGTGGGGAGCGGG + Intronic
945218887 2:207464415-207464437 TGTGAGGGGGTGAGGGAAGCAGG + Intergenic
945811893 2:214559017-214559039 TCTGATGGGGTGGGGGGAGGGGG - Intronic
946446182 2:219741483-219741505 TAGGAGGGGGTTTGGGGGACTGG + Intergenic
947530458 2:230905847-230905869 TTTGAGGGGGTGTGGATAGCAGG - Intergenic
947565187 2:231189119-231189141 TGGGAGGGGTTTTGGGGAGGCGG - Intergenic
947611177 2:231526020-231526042 TCAGATGGGCCTTGGGGAGCTGG - Intronic
947663923 2:231891013-231891035 TCTGAGCGAGTTTGGCGCGCAGG + Intergenic
947916784 2:233837842-233837864 CCTGGGGGAGTGTGGGGAGCAGG - Intronic
948135387 2:235632486-235632508 CCTGATGGGCTTTGGTGAGCTGG + Intronic
948797270 2:240411481-240411503 CCTGAGGGGGTCTGGGGGACAGG + Intergenic
949073627 2:242041297-242041319 TCTGAGGAGGGTTAGGGGGCTGG + Intergenic
1169192525 20:3667282-3667304 TCTGGTGGGGTTTGGGGCGTGGG - Intergenic
1170520254 20:17177864-17177886 TGAGAGGGGGCTTGGGGAACTGG - Intergenic
1170833486 20:19863493-19863515 TCTGAAGGGGGTGAGGGAGCTGG - Intergenic
1171767108 20:29296516-29296538 TCAGAGGGGTGTTGGGGAGGAGG + Intergenic
1171908839 20:30922239-30922261 TCAGAGGGGTGTTGGGGAGGAGG - Intergenic
1171971157 20:31566127-31566149 CCAGAAGGGGTTTGGGGTGCTGG + Intronic
1171971402 20:31567218-31567240 TCTCAGGGAGCTTTGGGAGCAGG + Intronic
1172323078 20:34012198-34012220 CCTGAGGTGGTTGGGAGAGCTGG + Intronic
1172324642 20:34024963-34024985 GCTGAGGGGTTAGGGGGAGCTGG + Intronic
1172871906 20:38141385-38141407 CCTGAGGGGGATAGGGGGGCGGG + Exonic
1174085645 20:48005668-48005690 TAGGAGAGGCTTTGGGGAGCAGG + Intergenic
1175668704 20:60882628-60882650 GCTGAGGGGGTGTGGGAAGCAGG - Intergenic
1175998344 20:62821244-62821266 TCCATGGGAGTTTGGGGAGCTGG + Intronic
1176069659 20:63219490-63219512 TCTGAGGGGTTTGGGGGTGGTGG - Intergenic
1178236968 21:30854205-30854227 TCTCATGGGGTTGGGGGAGAGGG + Intergenic
1179480122 21:41671678-41671700 CCTGTGGGGGTTTGGAGAGGAGG + Intergenic
1179922557 21:44515021-44515043 TCTGCGGGGGTGTGGGGTGCAGG - Intronic
1180903112 22:19388897-19388919 TCTGAGAGGGTCTATGGAGCAGG + Intronic
1180976365 22:19850984-19851006 TCTGCTGGAGTTGGGGGAGCTGG + Exonic
1181016983 22:20076312-20076334 TCTGAAGGGGTTTGAGGAAAGGG + Intergenic
1182457848 22:30463339-30463361 AGTGAGGGGGTTGGGGGACCGGG - Intronic
1183041699 22:35184817-35184839 TCTGCGGGGGGCTGGGGAGGAGG - Intergenic
1183270387 22:36858548-36858570 TCTTGGGGGGTTGGGGGGGCCGG + Intergenic
1184226183 22:43130027-43130049 TGTGGTGGGGATTGGGGAGCAGG + Intergenic
1184354459 22:43969665-43969687 TCTGAGCGAGTATGGGGAGAAGG + Intronic
1184453357 22:44595846-44595868 TCAGAGGGGCTTTGGGGATGGGG - Intergenic
1184568997 22:45310307-45310329 CCTGAGGGGGTCTCGGGGGCAGG - Intronic
1184711038 22:46249752-46249774 TGAGCGGGGGGTTGGGGAGCGGG + Intronic
1185171698 22:49298098-49298120 TCAGAGGGTGTCTGGGGAGAGGG + Intergenic
949981049 3:9501855-9501877 ACTGAGGGGGCCTGGGGAGCTGG + Exonic
950263732 3:11560170-11560192 TCTTGGTGGGTTAGGGGAGCAGG - Intronic
951694667 3:25433834-25433856 TTTAAAGGGGTTTGGGGAGTGGG - Intronic
951821243 3:26814461-26814483 CCTGTCGGGGGTTGGGGAGCTGG + Intergenic
952478530 3:33735909-33735931 TTAGAGGGGCTTTGGGAAGCAGG - Intergenic
953455972 3:43042770-43042792 GCTGATGGGCTTTGAGGAGCTGG - Intronic
955223791 3:57044681-57044703 TTTGGGGAGGTTTGGGGAGAAGG + Intronic
955506607 3:59639122-59639144 TTGCAGGGGGCTTGGGGAGCAGG + Intergenic
956163268 3:66377041-66377063 TCTGAGTAGGTATGGGGAGGGGG + Intronic
957525159 3:81371082-81371104 TGTGAGGGGGATTTGGGAGGAGG + Intergenic
960171328 3:114464984-114465006 TGTGTGGGGGTTGGGGGAGAAGG - Intronic
960568030 3:119156204-119156226 TCTCAGGCTGGTTGGGGAGCGGG - Intronic
961088550 3:124090645-124090667 TCTCAGGGTGTTGGGGGAGGTGG + Intronic
961173348 3:124814946-124814968 GCTGATGGGGAGTGGGGAGCAGG - Intronic
961798324 3:129425608-129425630 CCTGAGGAGGTTTGGTGGGCAGG - Intronic
962258229 3:133886549-133886571 TCTGAGCAGGGATGGGGAGCTGG + Intronic
963870496 3:150409598-150409620 TAGGAGGAGGTTTGGGGAGACGG - Exonic
965179352 3:165381986-165382008 TTTTTGGGGGTTTGGGGAGGAGG + Intergenic
965883163 3:173411693-173411715 GATGAGGGGGTTTGGAGGGCGGG - Intronic
967075672 3:185999816-185999838 TCTGGGGGGGTGGGGGGAGATGG - Intergenic
967311790 3:188113205-188113227 TCTGGAGGGGATTGGGGAGCAGG - Intergenic
968936275 4:3612129-3612151 GCAGAGTGGGCTTGGGGAGCAGG - Intergenic
969239385 4:5888819-5888841 TCTGCGGGGGTGTGGGGGGAGGG + Intronic
970199820 4:13592802-13592824 TCTGGGGAGGTTTGGGGAGTGGG - Intronic
970224916 4:13847901-13847923 TCTGAGGTGGTTAGGGCAGAAGG - Intergenic
971408484 4:26344736-26344758 TTTGAGGTGGGGTGGGGAGCAGG - Intronic
972725496 4:41743625-41743647 TCTGCAGGGTTTGGGGGAGCTGG + Intergenic
974624433 4:64403775-64403797 ACTGAGGGGGCATGGGGAGGAGG + Intronic
976330217 4:83823052-83823074 CCTGAGGTGGGGTGGGGAGCTGG - Intergenic
976939809 4:90685986-90686008 ATTGAGTGGGTTTGGTGAGCTGG + Intronic
978365651 4:107978766-107978788 TCTGAGTTGGTTTGGTGACCAGG + Intergenic
981391168 4:144193502-144193524 TGTCATGGGGTTGGGGGAGCGGG - Intergenic
982215664 4:153080757-153080779 TCTGAGTGTGTTTGGGTTGCAGG - Intergenic
984412318 4:179409552-179409574 TCTGGGGGGGTTGTGGGAGAGGG - Intergenic
984888084 4:184468721-184468743 CCTGAGGGAGGCTGGGGAGCAGG + Intronic
985783458 5:1882434-1882456 TCCCCGGGGGTTTGGGGAGCAGG + Intronic
985823126 5:2174156-2174178 TCTGCTGGGGTTGGGGGAGAAGG + Intergenic
986297332 5:6449857-6449879 TGTGGGGGGGGTTGGGGAGGTGG - Intronic
986351700 5:6886176-6886198 ACTCAGGGGGTTGGGGGAGTGGG - Intergenic
986512707 5:8525146-8525168 TCAGAGGGCTTTTGGAGAGCTGG + Intergenic
986964423 5:13253464-13253486 TTTGAGGGGGATTGTGGAGAAGG - Intergenic
987348942 5:17004267-17004289 TGTGTGGGTGTTTGGGGAGGGGG - Intergenic
988457625 5:31400652-31400674 TTTGAGAGGGCATGGGGAGCAGG - Exonic
991456828 5:66812766-66812788 TGTCAGTGGGTTTTGGGAGCTGG + Intronic
991941221 5:71854008-71854030 TGTGATGGGGTGGGGGGAGCGGG + Intergenic
993546363 5:89218026-89218048 TTTTAGGGGGTTTGGGGGGAAGG - Intergenic
994130006 5:96216298-96216320 AATGTGGGGGTTAGGGGAGCTGG - Intergenic
995199448 5:109410204-109410226 CCTGAGGGAGATGGGGGAGCAGG - Intergenic
996688471 5:126310885-126310907 TCTGAAGGGGTTGGGTGACCTGG - Intergenic
997274455 5:132573160-132573182 TCTCATGTGGTTTGGGGGGCAGG + Intronic
997445279 5:133935728-133935750 TCAGTGGGGGTTTGGGGAGGAGG - Intergenic
997589716 5:135065242-135065264 TATGAGGGGACATGGGGAGCGGG + Intronic
997884310 5:137616573-137616595 TCTGAGGGTGTGTTGTGAGCAGG - Intergenic
998022874 5:138786013-138786035 TTGTGGGGGGTTTGGGGAGCAGG - Intronic
998799927 5:145858701-145858723 TCTTAAGGGGCTTGGGGAGTGGG + Intergenic
998868812 5:146532510-146532532 TCTGAGGGGGTTGGGACAGAGGG - Intergenic
999478673 5:151925044-151925066 CCTGAGGGGGTTAGGGGCGAGGG + Intergenic
1000345606 5:160311691-160311713 TCTGAGCGGAATTGGGGGGCGGG - Intronic
1001628020 5:173153133-173153155 TCTGAGGGACTTTGTGCAGCTGG + Intronic
1002716981 5:181234056-181234078 TCTGGGATGGTGTGGGGAGCTGG + Intronic
1003020900 6:2508619-2508641 TCTGAGTGGGAGTGGGGAGAAGG - Intergenic
1004106922 6:12674411-12674433 CCAGAGTGGGTTTGGGGAGTGGG + Intergenic
1005041504 6:21604469-21604491 TCTGAGGGGGATTGGCAAACAGG - Intergenic
1006405726 6:33843678-33843700 TCTGATGGGGTTTGGCCAGTGGG + Intergenic
1007107755 6:39295319-39295341 GCTGGTGGGGTGTGGGGAGCAGG + Intergenic
1007387340 6:41528705-41528727 TCAGAGTGGGTTTGGAGAGAGGG + Intergenic
1007400146 6:41598710-41598732 TCTGGGTGAGTTTGGGGGGCAGG + Intronic
1007745532 6:44040906-44040928 TCTGAGGGGATTTGGAGGGCCGG - Intergenic
1010661213 6:78572621-78572643 TCTGTGGGGGGTGGGGGTGCTGG + Intergenic
1010897466 6:81382147-81382169 GCTTAGGGGGTTTGGGGAGAAGG + Intergenic
1011735928 6:90310723-90310745 TCAGTGGGGGATTGGGGAGATGG + Intergenic
1012226642 6:96711344-96711366 TCTGTTGGGGTGTGGGGTGCAGG + Intergenic
1012956434 6:105575946-105575968 TCTGAGGGGGTCATGGGAGTAGG - Intergenic
1013254037 6:108365865-108365887 TTTGAGGGGGTGTGGGAAGCGGG + Intronic
1013828603 6:114245538-114245560 GCAGAAGTGGTTTGGGGAGCTGG + Intronic
1014753317 6:125276752-125276774 TCTGGGGAGGTCTGAGGAGCAGG - Intronic
1015025406 6:128526176-128526198 TCTGAGGGGGGCTGGGGGACTGG + Intergenic
1018922120 6:168182654-168182676 TCGGAGGGGATTTTGGGAACTGG - Intergenic
1019299397 7:295851-295873 TCTGCCTGGGTTTGGGGATCAGG + Intergenic
1020048272 7:5060801-5060823 TCTGTTGGTGTTTGGGGTGCTGG + Intronic
1020106339 7:5423870-5423892 TTGGAGGGGGTTGGGGGAGGGGG + Intronic
1022092144 7:27114441-27114463 TGGGTGGGGGTGTGGGGAGCTGG + Intronic
1022423509 7:30246224-30246246 TCAGAGGGGGCTGAGGGAGCAGG + Intergenic
1022717697 7:32913778-32913800 TTTGGTGGGGTTTGGGGAGCAGG + Intergenic
1023537200 7:41225908-41225930 TCTCAGGAGCTCTGGGGAGCTGG + Intergenic
1023620532 7:42067457-42067479 TCTGATGGGGAGTGGGGAGAGGG - Intronic
1023845473 7:44117715-44117737 TCCGAGGAGGCTGGGGGAGCAGG + Exonic
1023845881 7:44120020-44120042 TCTGGGCAGGTTTGGGGAACAGG + Intronic
1023965473 7:44961449-44961471 ACTGAGGGGGTTGAGGGGGCTGG + Intergenic
1024332582 7:48170962-48170984 TCTGGGGGAGTTTGGGGAATGGG - Intergenic
1024669922 7:51585067-51585089 TCTGAGGGGTTGTGGGGTGCCGG + Intergenic
1025256864 7:57389804-57389826 GGTGAGGGGGTATGGGGAGTAGG - Intergenic
1025298295 7:57794575-57794597 TCTGAGGTGGTTTGGGTCACCGG - Intergenic
1025785221 7:64637749-64637771 TCTGAGGGGGTTTGTCCAGAAGG + Intergenic
1025834980 7:65085765-65085787 TCTGAAGTAGTTTGGGGGGCAGG + Intergenic
1025904751 7:65775244-65775266 TCTGAAGTAGTTTGGGGGGCAGG + Intergenic
1026087191 7:67271933-67271955 TGTCAGGGGGTGGGGGGAGCGGG + Intergenic
1026689907 7:72542766-72542788 TGTCAGGGGGTGGGGGGAGCGGG - Intergenic
1026741950 7:72984454-72984476 TCTATGAGAGTTTGGGGAGCGGG - Intergenic
1026801795 7:73404880-73404902 TCTATGAGAGTTTGGGGAGCGGG - Intergenic
1026913576 7:74106787-74106809 TCTGAGGGGTTGAGGGGAGCTGG + Intronic
1027101785 7:75380623-75380645 TCTATGAGAGTTTGGGGAGCGGG + Intergenic
1028330519 7:89585071-89585093 TCTGAGAGGCATTGGGGCGCAGG - Intergenic
1028827868 7:95294469-95294491 TATGATGGGGGATGGGGAGCTGG + Intronic
1029491986 7:100875561-100875583 TCTGAGGGGGCCTGGGGACCGGG - Exonic
1029640217 7:101815766-101815788 GGTGGGGGGGTTGGGGGAGCAGG + Intergenic
1030361082 7:108596067-108596089 TCTTCCAGGGTTTGGGGAGCAGG + Intergenic
1031265857 7:119579096-119579118 TCTGAAGGGGTAAGGGGACCAGG - Intergenic
1031510019 7:122638253-122638275 TCTCAGGATGTTGGGGGAGCAGG - Intronic
1032000929 7:128264912-128264934 TCTGGGAGGGTCTGGGGAGCTGG + Intergenic
1032215338 7:129952866-129952888 TCAGAGGGTGAGTGGGGAGCAGG - Exonic
1032485122 7:132280196-132280218 TCTGAGGAGGGAGGGGGAGCTGG - Intronic
1033907037 7:146218129-146218151 TCTCACGTGGTTTGGGGATCAGG - Intronic
1034670394 7:152853319-152853341 TCTTAGGGGGATTTGGCAGCAGG + Intronic
1035376473 7:158410167-158410189 GCAGAGAGGGTTTGGGGAGGTGG - Intronic
1036215722 8:6878176-6878198 TCTGATGGGGTTTCTGGAACAGG + Intergenic
1036741050 8:11361989-11362011 GCTGAGGAGGTTTCAGGAGCTGG - Intergenic
1038118411 8:24583673-24583695 TCTGAGTGGGTATGGTGAGAAGG + Intergenic
1039170939 8:34744031-34744053 TGCCAGGGGGTTGGGGGAGCGGG + Intergenic
1039249163 8:35642896-35642918 TCTGGGGTGGGTTGGGGAGAAGG - Intronic
1039283492 8:36012044-36012066 CCTGTTGGGGGTTGGGGAGCTGG + Intergenic
1039790590 8:40872648-40872670 TCTGAGGGGGTGTGGAGTGAGGG - Intronic
1040902797 8:52434015-52434037 TATGTTGGGGTCTGGGGAGCCGG - Intronic
1042542235 8:69918921-69918943 TTTGTGGGGGTTTGGGGCGGTGG + Intergenic
1042764750 8:72308769-72308791 GCAGTGGGGGTGTGGGGAGCAGG + Intergenic
1044775715 8:95685476-95685498 TCTGAGGGGAGTTGGTGGGCAGG + Intergenic
1045190631 8:99879494-99879516 TTTGTGGGGGTTTGGGGGCCTGG - Intronic
1048896471 8:138996992-138997014 GCTTAGGGGGTTGGGGGAGATGG - Intergenic
1049610580 8:143553071-143553093 CCCGAGGGGGTCTGGGGTGCCGG - Intergenic
1050133606 9:2439216-2439238 GCTGTGGGGGATTGGGGAGTGGG + Intergenic
1050619249 9:7435279-7435301 TCTCAGTGGGTGTGGGGAGGAGG - Intergenic
1053299280 9:36937113-36937135 TGTGAGGGTGTAGGGGGAGCTGG - Intronic
1053461915 9:38277982-38278004 TGGGAGGGGGCTTGGGGAGGAGG - Intergenic
1054374171 9:64437199-64437221 TCAGAGGGGGCTTGGTCAGCTGG + Intergenic
1056394289 9:86167563-86167585 TCTGACTCAGTTTGGGGAGCAGG + Intergenic
1056997283 9:91474695-91474717 TCTGAAGGGGTTAGGTGAGGTGG + Intergenic
1057430882 9:94992702-94992724 TCTTTGGGGGTAAGGGGAGCTGG + Intronic
1057591551 9:96377432-96377454 ACTGTCAGGGTTTGGGGAGCTGG - Intronic
1057748624 9:97772186-97772208 TCTGATGGGGGTTGGGGCGATGG + Intergenic
1058833190 9:108837631-108837653 AGTGATGGGGTTTGGAGAGCTGG + Intergenic
1058951949 9:109912186-109912208 TTTGATGGGGTTTGGGAAGGAGG + Intronic
1059342009 9:113602558-113602580 TCTGTGGGGGTGTGGGGGGCTGG + Intergenic
1059367028 9:113794316-113794338 GCAGAGGGAGTTTGGGGATCTGG - Intergenic
1060481364 9:124018388-124018410 AGTGAGGGGGTTCGGGGCGCCGG + Intronic
1060555710 9:124506366-124506388 TCTCAGGGGTTTGGGGGTGCGGG - Intronic
1060667861 9:125443693-125443715 GCTGGGGGGGCTGGGGGAGCTGG - Intronic
1061028443 9:128065668-128065690 TCAGTGGGGGTTGGGGGAGTTGG - Intronic
1061263709 9:129493952-129493974 GCGGAGGGGGGTTGGGGGGCAGG + Intergenic
1061491784 9:130948932-130948954 TCTGAGGGGCTCTGGGGTGGTGG + Intergenic
1062031649 9:134364672-134364694 GCTTAGGGGGTGTGGGGAGCTGG - Intronic
1062129906 9:134886599-134886621 TCTGAGGGGGGTTTGGGAAGTGG + Intronic
1062216403 9:135392052-135392074 GGTGAGGGGGTGTGGGGAGAGGG - Intergenic
1062277704 9:135738575-135738597 TCTGAGAGGGCTGAGGGAGCCGG - Intronic
1062518214 9:136946493-136946515 CCTGAGTGGGTTTGAGCAGCGGG + Exonic
1062612244 9:137380446-137380468 CCGGAGGGGGGTTGGGGTGCGGG - Intronic
1062612339 9:137380646-137380668 CCAGAGGGGGGTTGGGGAGGAGG - Intronic
1185820821 X:3202587-3202609 TGAGAAGGGGTTTGGGGTGCAGG + Intergenic
1186293238 X:8121870-8121892 GCTGAGGGGGATGGGGGAGGGGG - Intergenic
1186874504 X:13803792-13803814 CATGAGGGGGTTTGGGGAAGGGG - Intronic
1189259613 X:39669144-39669166 GGTGAGGGGGTTGGGGAAGCAGG - Intergenic
1192203337 X:69081046-69081068 GCTGTGGGGGTTTGGGGAGGAGG - Intergenic
1192219009 X:69184415-69184437 GCAGAGGGGGTCAGGGGAGCAGG - Intergenic
1195320904 X:103721404-103721426 TATGTGGGGGTGTGGGGAGTGGG - Intronic
1196251317 X:113463479-113463501 TCTGAGAAGGGTTGGGGGGCTGG - Intergenic
1197201677 X:123754033-123754055 TATGAGGGGGGATGGTGAGCGGG - Intergenic
1197700831 X:129598232-129598254 TTTGATGGGGTTTGGGCAGGTGG - Intergenic
1197742116 X:129903165-129903187 TTTGGGGGGGTTGGGGGAGACGG - Intergenic
1199554296 X:149089791-149089813 TGTCGTGGGGTTTGGGGAGCGGG + Intergenic
1199595552 X:149503775-149503797 CATGAGGGGGTTCAGGGAGCAGG + Intronic
1199846315 X:151695036-151695058 GCCGAGGGGGTTGGGAGAGCGGG - Intergenic