ID: 900390984

View in Genome Browser
Species Human (GRCh38)
Location 1:2433826-2433848
Sequence GATGGCTCTGAGGGGGTTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 0, 2: 3, 3: 13, 4: 239}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900390984_900390995 6 Left 900390984 1:2433826-2433848 CCCCAAACCCCCTCAGAGCCATC 0: 1
1: 0
2: 3
3: 13
4: 239
Right 900390995 1:2433855-2433877 CTCCACGGATGTGCCCACACTGG 0: 1
1: 0
2: 0
3: 7
4: 150
900390984_900391001 16 Left 900390984 1:2433826-2433848 CCCCAAACCCCCTCAGAGCCATC 0: 1
1: 0
2: 3
3: 13
4: 239
Right 900391001 1:2433865-2433887 GTGCCCACACTGGGGGTCCCGGG 0: 1
1: 0
2: 3
3: 28
4: 211
900390984_900391000 15 Left 900390984 1:2433826-2433848 CCCCAAACCCCCTCAGAGCCATC 0: 1
1: 0
2: 3
3: 13
4: 239
Right 900391000 1:2433864-2433886 TGTGCCCACACTGGGGGTCCCGG 0: 1
1: 0
2: 1
3: 24
4: 209
900390984_900391004 25 Left 900390984 1:2433826-2433848 CCCCAAACCCCCTCAGAGCCATC 0: 1
1: 0
2: 3
3: 13
4: 239
Right 900391004 1:2433874-2433896 CTGGGGGTCCCGGGTGATGTTGG 0: 1
1: 0
2: 0
3: 14
4: 224
900390984_900390998 8 Left 900390984 1:2433826-2433848 CCCCAAACCCCCTCAGAGCCATC 0: 1
1: 0
2: 3
3: 13
4: 239
Right 900390998 1:2433857-2433879 CCACGGATGTGCCCACACTGGGG 0: 1
1: 0
2: 0
3: 15
4: 130
900390984_900390996 7 Left 900390984 1:2433826-2433848 CCCCAAACCCCCTCAGAGCCATC 0: 1
1: 0
2: 3
3: 13
4: 239
Right 900390996 1:2433856-2433878 TCCACGGATGTGCCCACACTGGG 0: 1
1: 0
2: 1
3: 7
4: 102
900390984_900390999 9 Left 900390984 1:2433826-2433848 CCCCAAACCCCCTCAGAGCCATC 0: 1
1: 0
2: 3
3: 13
4: 239
Right 900390999 1:2433858-2433880 CACGGATGTGCCCACACTGGGGG 0: 1
1: 0
2: 0
3: 9
4: 99
900390984_900390991 -9 Left 900390984 1:2433826-2433848 CCCCAAACCCCCTCAGAGCCATC 0: 1
1: 0
2: 3
3: 13
4: 239
Right 900390991 1:2433840-2433862 AGAGCCATCGACTCCCTCCACGG 0: 1
1: 0
2: 0
3: 4
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900390984 Original CRISPR GATGGCTCTGAGGGGGTTTG GGG (reversed) Intronic
900390984 1:2433826-2433848 GATGGCTCTGAGGGGGTTTGGGG - Intronic
900743038 1:4342257-4342279 GCTGGCTCCGAGGGGGATTCTGG - Intergenic
900780295 1:4613617-4613639 GATGGCTTTGTGGGGTTTAGCGG - Intergenic
901691141 1:10974031-10974053 CAGAGCTCTTAGGGGGTTTGGGG + Intronic
901930174 1:12592063-12592085 GTTTGCTGTGAGGGGGTATGGGG + Intronic
902147865 1:14418906-14418928 GATGGCTGGATGGGGGTTTGTGG + Intergenic
902860344 1:19240608-19240630 GAAGGCTCTCAGGAGGTTGGAGG - Intronic
904808448 1:33147721-33147743 GCTGGCACTGTGGGGGTTGGAGG + Exonic
906637856 1:47421571-47421593 GATGGTGCTGAGCTGGTTTGAGG + Intergenic
907287306 1:53390122-53390144 GCTGGATTTGAGTGGGTTTGGGG + Intergenic
907384913 1:54119869-54119891 GATGGCTGTGATGGTGTGTGTGG - Intergenic
908466961 1:64405810-64405832 GCTGTCTCTGAGGGTGTTTCTGG - Intergenic
910114049 1:83713082-83713104 GATGGCTCTTGGGGGGTGTCGGG - Intergenic
910933518 1:92465957-92465979 TATGTCTCTGAGGGTGTTTCTGG + Intergenic
913592118 1:120340476-120340498 GATTGCTCTCAGGCGATTTGGGG - Intergenic
913651238 1:120914670-120914692 GATTGCTCTCAGGCGATTTGGGG + Intergenic
914169871 1:145214397-145214419 GATTGCTCTCAGGCGATTTGGGG - Intergenic
914196934 1:145452465-145452487 GAAGGCCCTGTGGGGGTCTGTGG - Intergenic
914196950 1:145452515-145452537 GAAGGCCCTGTGGGGGTCTGTGG - Intergenic
914524989 1:148458361-148458383 GATTGCTCTCAGGCGATTTGGGG - Intergenic
914598686 1:149177470-149177492 GATTGCTCTCAGGCGATTTGGGG + Intergenic
914641412 1:149608774-149608796 GATTGCTCTCAGGCGATTTGGGG + Intergenic
915099830 1:153491225-153491247 GCTGACTGTGAGGGGCTTTGTGG - Intergenic
917931984 1:179828920-179828942 GCTGGGCCTGAGGGGCTTTGTGG - Intergenic
921919846 1:220655558-220655580 AATGGATCTGAGGTGGTATGAGG - Intronic
922423850 1:225476291-225476313 CATGGCTGTGAGGGTGTTTCTGG + Intergenic
924854341 1:247860827-247860849 GATGGCTCTGAGGTGCTCTTGGG - Intronic
1062904321 10:1169749-1169771 GAAGGCACTGGGGGGGTGTGGGG - Intergenic
1063636714 10:7788830-7788852 GATGCCTCTGAGGGTGGTTTTGG + Intronic
1063926446 10:10982354-10982376 CATGCCTCTGTGGGGGTTTGGGG - Intergenic
1064425597 10:15226504-15226526 GATGGCTGTGGTGGGGATTGGGG - Intronic
1064739743 10:18420655-18420677 TATGTCTGTGAGGGTGTTTGGGG - Intronic
1065864491 10:29902105-29902127 GATGGCTCTAAGGAGGTTGAAGG + Intergenic
1069574649 10:69517769-69517791 GAGGGCTCTGCCAGGGTTTGAGG + Intergenic
1075302780 10:121340379-121340401 GAGGCCACTGAGGGGGGTTGGGG - Intergenic
1076398289 10:130157580-130157602 CATGGCTGTGAGGGTGTTTTGGG - Intronic
1076404340 10:130201976-130201998 GGTGGATCTGAGGGGGTGAGGGG + Intergenic
1077305890 11:1868554-1868576 GCTGGCCCTGAGGGGGCTGGGGG + Intronic
1077317454 11:1925772-1925794 GAAGGCTGTGAGGGGGCCTGGGG - Intronic
1077874702 11:6294221-6294243 TATGGATCTGACAGGGTTTGGGG + Intergenic
1078129894 11:8604771-8604793 TATGGCTCTTTGGGGGTGTGGGG + Intergenic
1078507608 11:11964502-11964524 GATGGCGCTGAGGGAGCCTGCGG - Exonic
1078927402 11:15886966-15886988 GGTGGCTCAGAGGGTGTTTGGGG - Intergenic
1081914215 11:46720392-46720414 GCAGGCTCTGGGGAGGTTTGTGG - Intronic
1083289666 11:61682812-61682834 GATGGTTCTGCGGGAGGTTGAGG + Intronic
1084464319 11:69313345-69313367 GCTGGCTCTGGGGAGGTGTGGGG + Intronic
1085726831 11:78961906-78961928 GATGTCTCTCATGGGGGTTGGGG + Intronic
1086406383 11:86502757-86502779 GATGGCTCAGGGGAGGTTTGGGG + Intronic
1086959400 11:92967337-92967359 GAAGGCTCTGAGGGTGATTATGG - Intergenic
1087891256 11:103540843-103540865 TATGTCTGTGAGGGTGTTTGTGG + Intergenic
1088918619 11:114245485-114245507 GATGGCTCTGAGGGGTTTTTAGG - Intronic
1089058504 11:115607224-115607246 GATGGTCATGAGGGGGTCTGGGG - Intergenic
1089622174 11:119728532-119728554 GATGGCTCGGATGGGGCTTGCGG - Exonic
1090845738 11:130528407-130528429 GATGGATGTGTGTGGGTTTGAGG + Intergenic
1091676673 12:2496091-2496113 AATGGCTCTGAGGGAGGTTTGGG - Intronic
1092975579 12:13741520-13741542 TCTGGATCTCAGGGGGTTTGGGG + Intronic
1093032859 12:14304880-14304902 GATGTCTCTGAGGGTATTGGAGG - Intergenic
1093954945 12:25205672-25205694 GTTAGCTCTGTGGGGGTGTGGGG + Intronic
1094166803 12:27451573-27451595 GAAGGCTGTGAGGTGCTTTGTGG - Intergenic
1096542173 12:52314061-52314083 GATGGCTCTGAAGGGGACCGAGG - Intergenic
1098205105 12:68100923-68100945 GATGGCTGGGGAGGGGTTTGGGG - Intergenic
1098707754 12:73712920-73712942 GATGGCTCTGAAACAGTTTGGGG - Intergenic
1101121148 12:101581469-101581491 GCTGGCTCTGTGTGGGTGTGAGG - Intronic
1102208070 12:111104360-111104382 GATGGCTCATGGGAGGTTTGTGG + Intronic
1102457976 12:113082545-113082567 GAGGGCTGGGAGGTGGTTTGGGG - Intronic
1102628368 12:114254750-114254772 GATGGCACTGGGAGAGTTTGGGG + Intergenic
1105209070 13:18247338-18247360 AGTGGCTCTCAGGGGATTTGAGG - Intergenic
1105414494 13:20197392-20197414 GATGGCTCTGAAAGCGTTTAAGG - Intergenic
1107101687 13:36599996-36600018 GCTGGCCCTTAGGGGGATTGGGG + Intergenic
1113098305 13:106689736-106689758 AATGGGTCAGAGGAGGTTTGAGG + Intergenic
1113741707 13:112716016-112716038 GCTGGCTCTGTGGGGGCCTGGGG + Intronic
1115372491 14:32633683-32633705 GATGGCTGTGAGTGGGTTGCGGG - Intronic
1117288591 14:54310694-54310716 GATGGCGCACAGGAGGTTTGAGG + Intergenic
1119371641 14:74150532-74150554 GATGGCTGGGAGGGGGCCTGAGG + Intronic
1119654316 14:76406260-76406282 GATGTCTCTGAGGGTCTCTGAGG + Intronic
1119696786 14:76719714-76719736 CATGGCTCTGGGGAGGTATGGGG - Intergenic
1120883739 14:89435406-89435428 GAAGGCTCTGAGGGCCTGTGGGG - Intronic
1122115211 14:99524021-99524043 GGTGGCTCTGATGGGGTGGGGGG - Intronic
1123688050 15:22813836-22813858 GATGGCTCTGAGGCGCTGGGAGG + Intronic
1123872027 15:24585556-24585578 GATGGCTGTTCTGGGGTTTGTGG + Intergenic
1124002428 15:25770329-25770351 GATGGCCCTGAGGGGCTTCACGG + Intronic
1125506412 15:40270262-40270284 GAGGGCTGTGAGGGGGGTGGAGG - Intronic
1127358219 15:58221967-58221989 GATGACTCTGGGGGGGTCTCAGG - Intronic
1128760088 15:70210621-70210643 GAAGGCACTGAGGGGCTGTGTGG + Intergenic
1129714295 15:77838042-77838064 CATAGCTCTGAGGGGGTTGGGGG - Intergenic
1131112101 15:89770869-89770891 GCTGGCTCTAAGGAGGTTGGGGG + Intronic
1132020100 15:98353543-98353565 GCTGGCTCTGAGGGAGAGTGAGG - Intergenic
1132747767 16:1444081-1444103 GAGGGTCCTGCGGGGGTTTGGGG - Intronic
1132951864 16:2567340-2567362 GAGGGCTCTGTGGGGGTGAGAGG + Intronic
1132962486 16:2632830-2632852 GAGGGCTCTGTGGGGGTGAGAGG - Intergenic
1133002893 16:2860023-2860045 CAGGACTCAGAGGGGGTTTGGGG + Intergenic
1134323944 16:13189682-13189704 GATGGCTCAGAGTTAGTTTGGGG + Intronic
1135603652 16:23804329-23804351 CTAGTCTCTGAGGGGGTTTGTGG - Intergenic
1135956241 16:26958847-26958869 GATGGCTCTGGGAAGGCTTGGGG - Intergenic
1138250270 16:55496836-55496858 GATGTTTCTGGGTGGGTTTGGGG + Intronic
1138471429 16:57241131-57241153 AATGGGTCTCAGTGGGTTTGGGG + Intergenic
1140921843 16:79545604-79545626 GATGCCTCTGTGGGGGGGTGGGG - Intergenic
1141930834 16:87201727-87201749 GGTGGTTCTGATGGGTTTTGAGG - Intronic
1142883749 17:2900076-2900098 GATGGCTGGGAGCGGGTGTGGGG + Intronic
1143655819 17:8293008-8293030 GATACCTCTGTGGGGGTTGGGGG - Intronic
1144515607 17:15915861-15915883 GGTGGCTGTGAGGGCGTTTCTGG - Intergenic
1144574020 17:16417729-16417751 GATGGCTCTGAGGCGGACAGAGG + Exonic
1145887253 17:28391042-28391064 CACAGCTCTGAGGGGGTGTGAGG + Intronic
1146633453 17:34487097-34487119 GCTGGCTCTGCGGGGGTCTCAGG - Intergenic
1147911502 17:43858722-43858744 GATGGAATTGAAGGGGTTTGGGG + Intronic
1150149079 17:62794175-62794197 GATGGTTGTGATGGTGTTTGTGG - Intronic
1150977167 17:70101171-70101193 GATGTCTCTACTGGGGTTTGGGG + Intronic
1151314125 17:73311542-73311564 GGTGCCGCTGAGGGGGTTGGGGG - Intronic
1151514089 17:74580978-74581000 GATGGGACTGAGGGTATTTGGGG + Intronic
1152211900 17:79006927-79006949 AATGGCTCTGAGGGTGTTGCCGG - Intronic
1203164815 17_GL000205v2_random:84164-84186 AATGCTTCTGAGGGGCTTTGTGG + Intergenic
1154279548 18:12990749-12990771 GATGGCGGTGATGGGTTTTGTGG + Intergenic
1154973542 18:21434588-21434610 TATGGCTTTGAGGGGGTCTGTGG + Intronic
1157293899 18:46428066-46428088 GAGGGCTTGGAGGGGGTCTGTGG + Intronic
1159898100 18:74016022-74016044 TATGTCTGTGAGGGGGTTTATGG + Intergenic
1160398782 18:78593450-78593472 GCTGGCTCTGAGGCTGTGTGTGG - Intergenic
1160831342 19:1106099-1106121 GATGGCTCTGGGGGGGCTTGGGG + Intronic
1160948571 19:1654787-1654809 CATGGGTCTGAGGGTGTCTGTGG + Intergenic
1161266825 19:3367966-3367988 GCTGGTGCTGAGGGGGTCTGAGG + Intronic
1161766669 19:6212361-6212383 GATGTCTCTGCGGTGGTGTGGGG - Intergenic
1161821728 19:6534116-6534138 GAGGGCGGTGAGGGGGTTGGAGG - Intronic
1163747121 19:19055191-19055213 GAGGGCTCTGAGGGAGAATGTGG - Intronic
1164340429 19:24390578-24390600 GATCGCTCTGAGGTGTATTGTGG + Intergenic
1165429983 19:35766999-35767021 GCTGGGTCTGAGGGGGACTGAGG + Intronic
1165441592 19:35831428-35831450 GAAGGCTCTGAGGGAGGTTTGGG - Intronic
1165827343 19:38712855-38712877 GGAGGCTCTGAGGGATTTTGGGG + Intronic
1166513772 19:43430123-43430145 GCTGGCTTTGAGGGTGTCTGGGG - Intergenic
1166567941 19:43776487-43776509 CAGGGCGCTGAGGGGGTTGGAGG + Intronic
1167488201 19:49775795-49775817 GAAGGCTCTGAAGGCCTTTGCGG + Intronic
1167589084 19:50393227-50393249 GAAGGGTATGAGGGGGTTTCTGG - Intronic
1167649796 19:50723069-50723091 GATGGTTCTGAGCGGGTTCCTGG + Intergenic
1167792333 19:51689970-51689992 GATGGGGCTGCGGGGCTTTGAGG + Intergenic
1167798385 19:51725385-51725407 AATGGCTGTGAGGGGGGATGAGG - Intergenic
1167832832 19:52040417-52040439 GAAGGCTCTGTGGGTGTCTGAGG - Intronic
1168409764 19:56132369-56132391 GAGGGCTCTGCCGGGGGTTGGGG - Intergenic
1168696808 19:58408465-58408487 GCTGGCTTTGGGGCGGTTTGCGG - Intronic
925539981 2:4956481-4956503 GTTGGCTCTGAGGGCGCTGGGGG + Intergenic
926272906 2:11380021-11380043 GAGGGCTCTGCTGTGGTTTGGGG - Intergenic
927326002 2:21806014-21806036 GCTGTGTCTGAAGGGGTTTGAGG + Intergenic
927895109 2:26776470-26776492 GTTGGCACTGAGGGTGTGTGTGG + Exonic
930348222 2:50213857-50213879 GGTGACTCTGCTGGGGTTTGTGG - Intronic
931006448 2:57855425-57855447 CATGGCTCTGAGGAGGCTTCAGG + Intergenic
931614385 2:64141324-64141346 GATGGCACTGAGGTGGCTTTAGG - Intronic
932587928 2:73043966-73043988 GGTGGCATTGAGGGGGTGTGTGG - Intronic
933383273 2:81578332-81578354 GATGGCTAGGAGAGAGTTTGTGG + Intergenic
935129062 2:100247741-100247763 GATGGGTCTTTGGGGGTTTGTGG - Intergenic
937039968 2:118813589-118813611 GTTAGCTCAGAGGGGGTGTGGGG - Intergenic
937835832 2:126469547-126469569 GCTGGATCTGAGGGGGCTGGAGG - Intergenic
938118241 2:128616628-128616650 GATGGCTCTGAGGTAGATTTTGG + Intergenic
940290691 2:152074903-152074925 GATGGCAGTGAGGGTGGTTGTGG - Intronic
947744783 2:232501996-232502018 GCTGGCTCTGGGGGTCTTTGAGG - Intergenic
948813579 2:240498515-240498537 GGTGGAGCTGAGGGGGTGTGCGG + Intronic
948839493 2:240642082-240642104 GGGGGCTCTGAGGGGGGTTGTGG + Intergenic
948909376 2:240995429-240995451 GTTGGCCCTGAGGGAGTGTGGGG - Intergenic
1169195572 20:3680622-3680644 GAGGGCTCTGAGTGGATGTGGGG + Intronic
1171290242 20:23979052-23979074 AGTGGCTCTCAGGGGATTTGAGG - Intergenic
1172847565 20:37938882-37938904 GAGGCCTCTGATGAGGTTTGGGG + Intronic
1174106395 20:48165369-48165391 GATGGCTCTGGGTGGGTTTGCGG + Intergenic
1174254335 20:49243135-49243157 GGTGGCTCTGAGAGGGGTGGGGG - Intronic
1174405991 20:50303797-50303819 GATGGATTTGAGGGAGGTTGAGG + Intergenic
1175339802 20:58221398-58221420 GACGTCTCAGAGGGCGTTTGTGG - Exonic
1176103121 20:63373470-63373492 AGTGGCTCTGAGAGGTTTTGTGG + Intronic
1176336809 21:5606635-5606657 ACTGGATCTGAGGGGCTTTGTGG - Intergenic
1176390948 21:6214313-6214335 ACTGGATCTGAGGGGCTTTGTGG + Intergenic
1176406935 21:6374923-6374945 AATGCTTCTGAGGGGCTTTGTGG - Intergenic
1176470471 21:7101861-7101883 ACTGGATCTGAGGGGCTTTGTGG - Intergenic
1176494032 21:7483639-7483661 ACTGGATCTGAGGGGCTTTGTGG - Intergenic
1176506610 21:7654744-7654766 ACTGGATCTGAGGGGCTTTGTGG + Intergenic
1178510655 21:33202349-33202371 CATGGCACTGAGTGGGTTAGAGG - Intergenic
1179338990 21:40486561-40486583 GAAGGCCCTCAGGGGGTCTGGGG + Intronic
1179920998 21:44507367-44507389 AAGGGCGCTGAGGGGTTTTGTGG - Intronic
1179922558 21:44515027-44515049 GAGGGGTCTGCGGGGGTGTGGGG - Intronic
1180767186 22:18351960-18351982 AGTGGCTCTCAGGGGATTTGAGG + Intergenic
1180779124 22:18510419-18510441 AGTGGCTCTCAGGGGATTTGAGG - Intergenic
1180811844 22:18767739-18767761 AGTGGCTCTCAGGGGATTTGAGG - Intergenic
1181197999 22:21201981-21202003 AGTGGCTCTCAGGGGATTTGAGG - Intergenic
1181401747 22:22653824-22653846 AGTGGCTCTCAGGGGATTTGAGG + Intergenic
1181647807 22:24243281-24243303 AGTGGCTCTCAGGGGATTTGAGG - Intronic
1181703703 22:24634918-24634940 AGTGGCTCTCAGGGGATTTGAGG + Intergenic
1183041701 22:35184823-35184845 GATAGCTCTGCGGGGGGCTGGGG - Intergenic
1183931798 22:41239709-41239731 GGAGGCTCTGAGGGGTTTTTGGG - Intronic
1184937392 22:47735121-47735143 GCTGGCTATGAAGAGGTTTGTGG - Intergenic
1184983733 22:48115069-48115091 CAGGGCTGTGTGGGGGTTTGGGG - Intergenic
1203228807 22_KI270731v1_random:92854-92876 AGTGGCTCTCAGGGGATTTGAGG + Intergenic
952086845 3:29832863-29832885 GCTGGCTTGGAGGGGGCTTGAGG - Intronic
953408537 3:42673414-42673436 GGTGGCTCTGAGGCTCTTTGGGG - Intergenic
953779169 3:45851069-45851091 GCTGGCTATGATGGGGTGTGGGG - Intronic
955291101 3:57692997-57693019 GATGGCTTTGAGGGGCCCTGCGG - Exonic
959116323 3:102182979-102183001 GAGGCCTCTCAGGGGGTTGGGGG + Intronic
961151024 3:124637919-124637941 GATGAGTCTGAGCAGGTTTGGGG + Intronic
961831094 3:129623426-129623448 CAGGGCTGTGAGGGGCTTTGGGG - Intergenic
962007175 3:131360995-131361017 CAGAGGTCTGAGGGGGTTTGAGG + Intergenic
962009540 3:131380711-131380733 CAGAGGTCTGAGGGGGTTTGAGG + Intergenic
967867559 3:194203080-194203102 GATGCCTCTGAGAGGTTCTGAGG + Intergenic
969624699 4:8296571-8296593 GAGGCCTCTGAGGGGCTTTCAGG + Intronic
970431098 4:15989939-15989961 GATGGCTGTGAGTGGGCATGGGG + Intronic
971213141 4:24639381-24639403 GTTGGCTCTGGGGGTGGTTGTGG - Intergenic
972787117 4:42336696-42336718 GATGGCTGTGTTGGGTTTTGGGG + Intergenic
976095893 4:81507794-81507816 GATGGGTCTGTGAGTGTTTGGGG - Intronic
977826809 4:101542371-101542393 GAAATCACTGAGGGGGTTTGCGG + Intronic
979218288 4:118192797-118192819 GAAGAGGCTGAGGGGGTTTGGGG + Intronic
982209607 4:153023747-153023769 GATGGCTCAGAGGTGCTCTGTGG - Intergenic
982374780 4:154677778-154677800 GAAGACACTGAGGGGCTTTGGGG + Intronic
986799198 5:11241978-11242000 CATGGCTCTGAAGGGGATGGGGG + Intronic
987044506 5:14094641-14094663 GATGAGTTTTAGGGGGTTTGGGG - Intergenic
987123742 5:14792086-14792108 GAGGGCTCTGAGGGGGTACAGGG + Intronic
989983486 5:50668387-50668409 GATTGCTCTCAGGCGATTTGGGG + Intronic
991050895 5:62271989-62272011 GATGGCTCTGATGTCTTTTGGGG - Intergenic
992869528 5:80992330-80992352 GATGCCCCTGAGTGGGATTGGGG - Intronic
993574626 5:89586480-89586502 GATTGCTCTGTTGGAGTTTGGGG - Intergenic
999940940 5:156542214-156542236 GATGGATCTGTGGGTTTTTGTGG + Intronic
1000257911 5:159558449-159558471 TTTGGCTCTGCAGGGGTTTGGGG + Intergenic
1001848412 5:174941702-174941724 GATGACTGTGAAGGTGTTTGAGG - Intergenic
1002823735 6:753937-753959 GATGGCATGGAAGGGGTTTGGGG - Intergenic
1003130662 6:3392749-3392771 GATGGCTCTGAGGATGTGGGAGG + Intronic
1003172018 6:3727324-3727346 GCTGGCTCTGAGGGGCATTTAGG - Intronic
1006150190 6:31982945-31982967 GAGGGCTCGGAGGGGGTTAAAGG - Intronic
1006156491 6:32015683-32015705 GAGGGCTCGGAGGGGGTTAAAGG - Intronic
1006449939 6:34099905-34099927 GATGGCTCTGGCGGGTGTTGGGG - Intronic
1011880731 6:92022176-92022198 GATGGCTCTGAAGGACTTTCTGG + Intergenic
1016572676 6:145532481-145532503 GATGGCTCTCTGGGGGTGGGGGG + Intronic
1018029492 6:159830821-159830843 GTTGGCTCTGGCTGGGTTTGTGG + Intergenic
1018712787 6:166508649-166508671 GATGGCTCTGGTGGGTTTGGAGG + Intronic
1018719044 6:166558443-166558465 TATGTCTGTGAGGGTGTTTGTGG - Intronic
1023052387 7:36264417-36264439 GATGGCTCTGTGCGGGTGGGAGG - Intronic
1024025170 7:45403948-45403970 AATGGCTGTGAGGGGGTAGGGGG - Intergenic
1024048197 7:45599586-45599608 GGGGGCTGTGAGGAGGTTTGTGG + Intronic
1029458427 7:100682541-100682563 GATGGCCCTGAGGGGGAAGGTGG - Intronic
1032595149 7:133232551-133232573 GAGGGTTCTGAGGGGGTGTTAGG - Intergenic
1032716322 7:134512013-134512035 GATGCTTCTGAGGTGGTTGGAGG - Intergenic
1033110140 7:138565983-138566005 GCTTGCTCTGAGGGGGTGTTGGG + Intronic
1035879477 8:3229157-3229179 GATGACCTTGAGGGGGTTTGTGG - Intronic
1049360639 8:142211124-142211146 GCTGGCTTTGTGGGGGTTTCAGG + Intergenic
1049763254 8:144340261-144340283 AATGGCTCTGGTGGGGTTGGGGG + Intergenic
1051556127 9:18384558-18384580 GATGCCTATGAGGGTGTTTTTGG - Intergenic
1051736912 9:20209727-20209749 TTTGACTTTGAGGGGGTTTGTGG - Intergenic
1052712150 9:32069982-32070004 GATGGCTCTCAGTGGGATGGGGG - Intergenic
1053073899 9:35116499-35116521 GAGGGCTCTGAGCCGGGTTGGGG + Intergenic
1054450800 9:65402760-65402782 CATGGCTCTAAGGGTGTCTGGGG - Intergenic
1056762759 9:89426695-89426717 GTGGCCTCTGAGGGGCTTTGGGG - Intronic
1059424251 9:114210899-114210921 GGTGGCTCTGGGCTGGTTTGGGG + Intronic
1060720270 9:125971984-125972006 AATGGCTCTGATGGGGTGTTGGG - Intergenic
1061420303 9:130469941-130469963 GCTGGCTCTGAGGGGCTGGGTGG + Intronic
1062085976 9:134648669-134648691 GGAGGCTGTGAGGTGGTTTGGGG + Intronic
1062536178 9:137022018-137022040 AATGGCTCAGATGGGGTGTGGGG + Intronic
1062697784 9:137884327-137884349 GAAGGCCCTGTGGGGGTCTGTGG + Intronic
1062697800 9:137884377-137884399 GAAGGCCCTGTGGGGGTCTGTGG + Intronic
1203424844 Un_GL000195v1:28267-28289 AATGGATCTGAGGGGCTTTGTGG + Intergenic
1203443525 Un_GL000219v1:33395-33417 AATGGTTCTGAGGGGCTTTCTGG + Intergenic
1203514333 Un_KI270741v1:152304-152326 AATGGTTCTGAGGGGCTTTCTGG + Intergenic
1186501059 X:10050760-10050782 GATGGATATGAGGGGGTTGGAGG + Intronic
1187975229 X:24698433-24698455 GATGGCTCTGAGGGGATTATTGG - Intronic
1189238489 X:39507272-39507294 GATTGCTCTGAGGCAGTTTGGGG + Intergenic
1190914646 X:54802140-54802162 GTTGGCTTTGAGGGGGTGGGAGG + Intergenic
1190998466 X:55635903-55635925 GATATCTCTGATGTGGTTTGAGG + Intergenic
1196584638 X:117416100-117416122 GAGGCCTCTTTGGGGGTTTGTGG - Intergenic