ID: 900390986

View in Genome Browser
Species Human (GRCh38)
Location 1:2433828-2433850
Sequence TCGATGGCTCTGAGGGGGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 75}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900390986_900391004 23 Left 900390986 1:2433828-2433850 CCAAACCCCCTCAGAGCCATCGA 0: 1
1: 0
2: 0
3: 8
4: 75
Right 900391004 1:2433874-2433896 CTGGGGGTCCCGGGTGATGTTGG 0: 1
1: 0
2: 0
3: 14
4: 224
900390986_900390999 7 Left 900390986 1:2433828-2433850 CCAAACCCCCTCAGAGCCATCGA 0: 1
1: 0
2: 0
3: 8
4: 75
Right 900390999 1:2433858-2433880 CACGGATGTGCCCACACTGGGGG 0: 1
1: 0
2: 0
3: 9
4: 99
900390986_900390996 5 Left 900390986 1:2433828-2433850 CCAAACCCCCTCAGAGCCATCGA 0: 1
1: 0
2: 0
3: 8
4: 75
Right 900390996 1:2433856-2433878 TCCACGGATGTGCCCACACTGGG 0: 1
1: 0
2: 1
3: 7
4: 102
900390986_900390998 6 Left 900390986 1:2433828-2433850 CCAAACCCCCTCAGAGCCATCGA 0: 1
1: 0
2: 0
3: 8
4: 75
Right 900390998 1:2433857-2433879 CCACGGATGTGCCCACACTGGGG 0: 1
1: 0
2: 0
3: 15
4: 130
900390986_900391000 13 Left 900390986 1:2433828-2433850 CCAAACCCCCTCAGAGCCATCGA 0: 1
1: 0
2: 0
3: 8
4: 75
Right 900391000 1:2433864-2433886 TGTGCCCACACTGGGGGTCCCGG 0: 1
1: 0
2: 1
3: 24
4: 209
900390986_900390995 4 Left 900390986 1:2433828-2433850 CCAAACCCCCTCAGAGCCATCGA 0: 1
1: 0
2: 0
3: 8
4: 75
Right 900390995 1:2433855-2433877 CTCCACGGATGTGCCCACACTGG 0: 1
1: 0
2: 0
3: 7
4: 150
900390986_900391001 14 Left 900390986 1:2433828-2433850 CCAAACCCCCTCAGAGCCATCGA 0: 1
1: 0
2: 0
3: 8
4: 75
Right 900391001 1:2433865-2433887 GTGCCCACACTGGGGGTCCCGGG 0: 1
1: 0
2: 3
3: 28
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900390986 Original CRISPR TCGATGGCTCTGAGGGGGTT TGG (reversed) Intronic
900390986 1:2433828-2433850 TCGATGGCTCTGAGGGGGTTTGG - Intronic
913701908 1:121382481-121382503 TAGAGGGCTGTGAGGTGGTTAGG - Intronic
920211280 1:204330682-204330704 TCAAAGGCTCTGAGGGGATCTGG - Intronic
920489331 1:206401201-206401223 TAGAGGGCTGTGAGGCGGTTAGG - Intronic
920882246 1:209890863-209890885 TTGGTGGCTCTGAGGGGTTTGGG + Intergenic
1065926790 10:30441653-30441675 TCGATGGCTCTGGGGGGCTGCGG + Intronic
1066066315 10:31763655-31763677 GCTATGGCTCAGAGGGGTTTGGG - Intergenic
1068029732 10:51691717-51691739 TCGAAGGCTAGGAGGAGGTTAGG + Intronic
1068882092 10:62061263-62061285 TTGATGGCTCTGAGGCCATTTGG + Intronic
1070521715 10:77259641-77259663 GCGAAGGCTCTGTGGTGGTTGGG - Intronic
1074183401 10:111082111-111082133 ACCATGGCTCTGAGGGGGTGAGG + Intergenic
1075788447 10:125066275-125066297 TCTCTGGCTCTGCTGGGGTTAGG - Intronic
1076900008 10:133333743-133333765 TGGAAGGCTCTGAGGGGGGAAGG + Intronic
1078129892 11:8604769-8604791 TCTATGGCTCTTTGGGGGTGTGG + Intergenic
1083052788 11:59792023-59792045 TAGATGGCTATGTGGGGGTGGGG + Intronic
1091107582 11:132937213-132937235 TGGCTGGCTCTGAGGGAGCTGGG - Intronic
1091399076 12:171923-171945 TAGGTGGCACTGGGGGGGTTTGG - Intronic
1097723685 12:63050630-63050652 TCCATGGATCTGATGAGGTTGGG - Intergenic
1102163205 12:110786010-110786032 TTGATGGCTCTCAGGGGGACAGG + Intergenic
1106031747 13:26010982-26011004 TCGATGGCCCTGAGGGAGCTAGG + Intronic
1111656821 13:91164435-91164457 TAGAAGTCTCTGATGGGGTTAGG - Intergenic
1122115213 14:99524023-99524045 TGGGTGGCTCTGATGGGGTGGGG - Intronic
1122260855 14:100521901-100521923 TAGGTGGCTCTGGGGGTGTTAGG - Intronic
1129227719 15:74179652-74179674 TCCGTGGCGCTGAGGGGGTGAGG + Intronic
1129714297 15:77838044-77838066 CACATAGCTCTGAGGGGGTTGGG - Intergenic
1132973039 16:2698233-2698255 AGGATGGCTCTGAGGAAGTTGGG + Intronic
1133009430 16:2902467-2902489 TCTGTGGCTCTGCGGGGGATGGG - Intergenic
1134134741 16:11670900-11670922 TGAATGGCTCTGACGGGGTGGGG + Intronic
1142327152 16:89423140-89423162 TCCTGGGCTCTGAGGGTGTTGGG - Intronic
1143543185 17:7581527-7581549 CCCAGGGCACTGAGGGGGTTGGG + Exonic
1143655821 17:8293010-8293032 TCGATACCTCTGTGGGGGTTGGG - Intronic
1146412517 17:32599441-32599463 TGGATGGCTTTGAGGGGTTCAGG - Intronic
1146922247 17:36721510-36721532 TAGATGGGTCTGAGGGGATGGGG - Intergenic
1148232492 17:45945133-45945155 TCGGTGGCACTGGGTGGGTTTGG - Intronic
1152382086 17:79947313-79947335 TCTAAGGCTCAGAGGGGGCTGGG + Intronic
1156494443 18:37516749-37516771 TAGCTGGCTCTGAGGGCCTTGGG + Intronic
1156824867 18:41418880-41418902 TCTATGGCTCAGAGGTGGATTGG - Intergenic
1160831340 19:1106097-1106119 AAGATGGCTCTGGGGGGGCTTGG + Intronic
927662275 2:25003067-25003089 TCCAGGGATATGAGGGGGTTGGG - Intergenic
929047023 2:37800080-37800102 TAGATGGCTGTTTGGGGGTTGGG - Intergenic
936704671 2:115058053-115058075 GCGATTGCTCTGCGGGGCTTAGG + Intronic
940920157 2:159297109-159297131 TAGATGCGTCAGAGGGGGTTGGG + Intergenic
947439976 2:230110860-230110882 TGGATGACTCTGAGGGGTTCAGG + Intergenic
947534023 2:230929637-230929659 TTGATGGCCCTGATGGGGCTTGG + Intronic
948354757 2:237369119-237369141 TCGACAGCTCTGAGGGAGTTAGG - Exonic
948355654 2:237374968-237374990 TTGATGGCTCTGAGGGCGTCAGG - Exonic
948827001 2:240577701-240577723 TGGATGGCTCTGCGCAGGTTGGG - Exonic
1171986619 20:31665443-31665465 TAAATGGCTCTTAGGGGGTAGGG + Exonic
1176285388 21:5016537-5016559 TCGCTGACTCTGCGAGGGTTTGG + Intergenic
1179871793 21:44246938-44246960 TCGCTGACTCTGCGAGGGTTTGG - Intronic
1181617169 22:24062825-24062847 TGTAGGGCTCTGAGGGGCTTAGG + Intronic
956390581 3:68769030-68769052 TTTATGGCTCGGAGGAGGTTGGG - Intronic
958785855 3:98595270-98595292 TGGATGCCTGTGATGGGGTTGGG + Intergenic
958816000 3:98916256-98916278 TCTGTGGCTCTGAGGGGCCTGGG - Intergenic
959116321 3:102182977-102182999 TGGAGGCCTCTCAGGGGGTTGGG + Intronic
964916509 3:161848049-161848071 TGGATGGCTTTGAGGAGGTTTGG + Intergenic
966932662 3:184685884-184685906 TCTTTGGCTCTGAAGGGGTGAGG + Intergenic
970356776 4:15262065-15262087 TGGATGACTTTGAGGGGTTTAGG + Intergenic
975087422 4:70359105-70359127 TCACTGGCTCTGAGGGACTTAGG - Intergenic
975089195 4:70380919-70380941 TCATTGGCTCTGAGGGATTTAGG - Intronic
982096406 4:151927362-151927384 TGGAGGGCTGTGTGGGGGTTAGG - Intergenic
992097508 5:73376645-73376667 TCGGTGGCGGGGAGGGGGTTGGG - Intergenic
992793314 5:80232950-80232972 GCCAGGGCTCTGAGGGAGTTTGG + Intronic
996688472 5:126310893-126310915 TTGATGTGTCTGAAGGGGTTGGG - Intergenic
1001315485 5:170638567-170638589 TTGATGCCTCTCAGGGGGATAGG + Intronic
1001684176 5:173580787-173580809 TCGATGGCACCAAGGGGGATGGG + Intergenic
1005829167 6:29656945-29656967 TCCATTGCTCTGGGGGGGTGGGG + Intergenic
1006152250 6:31995814-31995836 TCCAGGGTTCTGAGGGGGTCAGG + Intronic
1006158553 6:32028552-32028574 TCCAGGGTTCTGAGGGGGTCAGG + Intronic
1007177055 6:39904057-39904079 TCCCTGCCCCTGAGGGGGTTAGG - Exonic
1013356580 6:109350671-109350693 TCTCTGGCTCTGAGGAGGCTGGG + Intergenic
1017603592 6:156109844-156109866 TTGCTAGCTCTGAGAGGGTTGGG - Intergenic
1018406048 6:163483706-163483728 AGGATGACTCTGAGGGGTTTAGG - Intronic
1021376428 7:19913532-19913554 TGGATGACTTTGAGGGGGTCAGG - Intergenic
1035475530 7:159141384-159141406 ACGGTGGCTCAGAGGGGGATGGG + Intronic
1035882480 8:3257528-3257550 TCGATGGCACTGAGAGTGCTGGG + Intronic
1037726114 8:21483770-21483792 TCGGTGGGTGTGAGGGGGATGGG - Intergenic
1048203463 8:132396392-132396414 TTCATGGCTCTGAGGAGGTCGGG - Intronic
1048973381 8:139657565-139657587 TCTCTGGCTCTGGGGGGTTTTGG - Intronic
1052729178 9:32265222-32265244 GAGATGGCTCTGTGGGAGTTGGG - Intergenic
1054847597 9:69812938-69812960 ACGATGGCCATGAGGTGGTTTGG - Intergenic
1186738780 X:12495384-12495406 TAGCTGGAACTGAGGGGGTTAGG + Intronic
1189238487 X:39507270-39507292 CCGATTGCTCTGAGGCAGTTTGG + Intergenic
1193518788 X:82503598-82503620 ATGATGGCCCTGATGGGGTTTGG + Intergenic