ID: 900390987

View in Genome Browser
Species Human (GRCh38)
Location 1:2433833-2433855
Sequence GGGAGTCGATGGCTCTGAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 167}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900390987_900391000 8 Left 900390987 1:2433833-2433855 CCCCCTCAGAGCCATCGACTCCC 0: 1
1: 0
2: 0
3: 15
4: 167
Right 900391000 1:2433864-2433886 TGTGCCCACACTGGGGGTCCCGG 0: 1
1: 0
2: 1
3: 24
4: 209
900390987_900390995 -1 Left 900390987 1:2433833-2433855 CCCCCTCAGAGCCATCGACTCCC 0: 1
1: 0
2: 0
3: 15
4: 167
Right 900390995 1:2433855-2433877 CTCCACGGATGTGCCCACACTGG 0: 1
1: 0
2: 0
3: 7
4: 150
900390987_900390999 2 Left 900390987 1:2433833-2433855 CCCCCTCAGAGCCATCGACTCCC 0: 1
1: 0
2: 0
3: 15
4: 167
Right 900390999 1:2433858-2433880 CACGGATGTGCCCACACTGGGGG 0: 1
1: 0
2: 0
3: 9
4: 99
900390987_900391001 9 Left 900390987 1:2433833-2433855 CCCCCTCAGAGCCATCGACTCCC 0: 1
1: 0
2: 0
3: 15
4: 167
Right 900391001 1:2433865-2433887 GTGCCCACACTGGGGGTCCCGGG 0: 1
1: 0
2: 3
3: 28
4: 211
900390987_900390998 1 Left 900390987 1:2433833-2433855 CCCCCTCAGAGCCATCGACTCCC 0: 1
1: 0
2: 0
3: 15
4: 167
Right 900390998 1:2433857-2433879 CCACGGATGTGCCCACACTGGGG 0: 1
1: 0
2: 0
3: 15
4: 130
900390987_900390996 0 Left 900390987 1:2433833-2433855 CCCCCTCAGAGCCATCGACTCCC 0: 1
1: 0
2: 0
3: 15
4: 167
Right 900390996 1:2433856-2433878 TCCACGGATGTGCCCACACTGGG 0: 1
1: 0
2: 1
3: 7
4: 102
900390987_900391006 26 Left 900390987 1:2433833-2433855 CCCCCTCAGAGCCATCGACTCCC 0: 1
1: 0
2: 0
3: 15
4: 167
Right 900391006 1:2433882-2433904 CCCGGGTGATGTTGGCCGTTTGG 0: 1
1: 0
2: 0
3: 1
4: 43
900390987_900391004 18 Left 900390987 1:2433833-2433855 CCCCCTCAGAGCCATCGACTCCC 0: 1
1: 0
2: 0
3: 15
4: 167
Right 900391004 1:2433874-2433896 CTGGGGGTCCCGGGTGATGTTGG 0: 1
1: 0
2: 0
3: 14
4: 224

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900390987 Original CRISPR GGGAGTCGATGGCTCTGAGG GGG (reversed) Intronic
900004582 1:36252-36274 GGCTGTGGGTGGCTCTGAGGGGG + Intergenic
900024304 1:206768-206790 GGCTGTGGGTGGCTCTGAGGGGG + Intergenic
900390987 1:2433833-2433855 GGGAGTCGATGGCTCTGAGGGGG - Intronic
902693246 1:18123690-18123712 GGGAGTGGAGGGATCTGAGCAGG + Intronic
904399604 1:30247542-30247564 GAGAATCGATGGCTCTGAATGGG + Intergenic
905461500 1:38125724-38125746 GGGAGTCCAGCGCTCAGAGGGGG + Intergenic
905828796 1:41047745-41047767 GGGAGTACTTGGCTGTGAGGAGG - Intronic
907377014 1:54052704-54052726 GGGAGTCGAGCACTCGGAGGAGG - Intronic
910210144 1:84783811-84783833 GGGGGTTGATGGCGCTGAAGAGG + Intergenic
910289061 1:85582199-85582221 GGGATTCGATGCCTCCGAGGTGG + Exonic
910936183 1:92485690-92485712 GGGAGCCGAGGGCGCTAAGGGGG + Intronic
912801172 1:112720511-112720533 GGGAGCCGATGGCTCTGCAGGGG - Exonic
917905968 1:179587447-179587469 GGGAGTCGATGGAACAGAGGAGG - Intergenic
920671054 1:208003853-208003875 GGGAGTCTATAGCTCCAAGGTGG - Intergenic
920787356 1:209054166-209054188 GGGAGTCTATGTCTCTGTGAAGG - Intergenic
920791279 1:209095304-209095326 GGGAGTCAATGGCACAGAGATGG - Intergenic
923723537 1:236487211-236487233 GGGAGGCGGAGGCTCAGAGGTGG - Intergenic
1064791417 10:18960882-18960904 GGCAGCCGATGGGCCTGAGGTGG + Intergenic
1066347571 10:34603700-34603722 GGGAGTAGAAGGATCAGAGGAGG + Intronic
1067337505 10:45377307-45377329 GGGAAAAGATGGCTCAGAGGGGG - Intronic
1067372511 10:45698814-45698836 GGGAGTCGATGGAATGGAGGAGG - Intergenic
1067387268 10:45827310-45827332 GGGAGTCGATGGAATGGAGGAGG + Exonic
1067418861 10:46129941-46129963 GGGAGTCGATGGAATGGAGGAGG - Intergenic
1067447009 10:46357297-46357319 GGGAGTCGATGGAATGGAGGAGG - Intergenic
1067875997 10:50008769-50008791 GGGAGTCGATGGAATGGAGGAGG - Exonic
1069688612 10:70335059-70335081 GGGAGGGCCTGGCTCTGAGGAGG + Intronic
1070134092 10:73675994-73676016 GGGAGTCGATGGAATGGAGGAGG + Exonic
1070561938 10:77574913-77574935 GGGAGCTGATGGCTTTCAGGAGG + Intronic
1074183400 10:111082106-111082128 GGAAGACCATGGCTCTGAGGGGG + Intergenic
1074450988 10:113559598-113559620 TGGCGTCCATGGGTCTGAGGTGG - Intronic
1076899988 10:133333641-133333663 GAGAGTGGAAGGCTCTGAGGCGG + Intronic
1076899994 10:133333672-133333694 GAGAGTGGAAGGCTCTGAGGGGG + Intronic
1076900000 10:133333707-133333729 GAGAGTGGAAGGCTCTGAGGGGG + Intronic
1076900006 10:133333738-133333760 GAGAGTGGAAGGCTCTGAGGGGG + Intronic
1077298221 11:1835820-1835842 GGGAGCCCAGGGCTCTGATGAGG + Intronic
1079340391 11:19606899-19606921 GTGAGTCAATGGATCTGGGGTGG - Intronic
1080418416 11:32090816-32090838 GGGACTGGAGGGCTCGGAGGAGG - Intronic
1081763829 11:45595410-45595432 GAGAGCCGATGAGTCTGAGGAGG - Intergenic
1081771166 11:45651320-45651342 GGGAGACGCTGGCAGTGAGGAGG - Intronic
1083176157 11:60951600-60951622 AGGAGTGCAGGGCTCTGAGGCGG - Exonic
1083695341 11:64438768-64438790 GGGACTGGATGGGTCTGAGCAGG + Intergenic
1084264892 11:67999792-67999814 GAGAGTCGAGGGCACTGAGATGG + Intronic
1087739353 11:101869939-101869961 GAGAGTGGTTGGCTCTGAAGGGG - Intronic
1090038363 11:123268405-123268427 GGGAAACAATGGCACTGAGGAGG - Intergenic
1091378001 12:38304-38326 GGCTGTGGGTGGCTCTGAGGGGG + Intergenic
1092226650 12:6752597-6752619 GGAAGAGGATGGCTCTGAGTGGG - Intronic
1092594578 12:9987358-9987380 GGCAGTACATGGCTCTCAGGTGG + Intronic
1094689647 12:32756045-32756067 GTAAGGCGACGGCTCTGAGGCGG - Intergenic
1095191480 12:39262918-39262940 GGGAGTCTATGTCTCTTCGGAGG - Intergenic
1098674011 12:73266358-73266380 TGGAGTCCCTGGCTCGGAGGAGG - Intergenic
1102953926 12:117047327-117047349 GGGAGGCGATGGCCGGGAGGGGG + Intronic
1102998593 12:117368051-117368073 GGGAGTCTATAGCTCTTGGGTGG + Intronic
1103514567 12:121499198-121499220 GGGAGTCGGTGGAACTGGGGAGG - Intronic
1105283393 13:18983410-18983432 AGGAGTCCATGGCTGTCAGGAGG + Intergenic
1106765154 13:32906325-32906347 GGAACACGATTGCTCTGAGGGGG + Intergenic
1112417782 13:99217869-99217891 GGGAGTCGATGGCAAGAAGGTGG - Intronic
1112669697 13:101620803-101620825 GGGAGTCTCTGGCACTGAGAAGG - Intronic
1114277981 14:21165124-21165146 GGGAAAAGATGGCTCTGGGGTGG + Intergenic
1115733014 14:36292438-36292460 GGGAGTCCATGCCTGTGTGGGGG - Intergenic
1122263297 14:100535229-100535251 GGGGGCCGCAGGCTCTGAGGTGG + Intergenic
1122345081 14:101053648-101053670 GGGAGTCGCTGGGTCTGAGCTGG + Intergenic
1126693577 15:51307210-51307232 GAGAGTTGATGGCACTGATGAGG + Intronic
1129888477 15:79055309-79055331 GGTAGTTGCTGGCTCTGAGTGGG - Intronic
1132448926 15:101954692-101954714 GGCTGTGGGTGGCTCTGAGGGGG - Intergenic
1132572594 16:650484-650506 GGGAGTCGCGGGCTGTCAGGAGG + Intronic
1132872067 16:2119715-2119737 GGGAGACCTTGGCTCTGTGGGGG - Intronic
1133002844 16:2859821-2859843 GGGACTCCATGGCTCTGAGCAGG + Intergenic
1134102163 16:11460113-11460135 TGGAGTGGGTGGCTATGAGGAGG - Intronic
1134520458 16:14917181-14917203 GGGAGACCTTGGCTCTGTGGGGG + Intronic
1134551117 16:15138793-15138815 GGGAGACCTTGGCTCTGTGGGGG - Intronic
1134708129 16:16315832-16315854 GGGAGACCTTGGCTCTGTGGGGG + Intergenic
1134715345 16:16355865-16355887 GGGAGACCTTGGCTCTGTGGGGG + Intergenic
1134951473 16:18352813-18352835 GGGAGACCTTGGCTCTGTGGGGG - Intergenic
1134959412 16:18396294-18396316 GGGAGACCTTGGCTCTGTGGGGG - Intergenic
1138330946 16:56214848-56214870 GGGAGGTGATGGCAGTGAGGGGG - Intronic
1138514695 16:57529491-57529513 GGGAGTCGAGGCCACTGAGGAGG - Intronic
1141739317 16:85880192-85880214 TGGAGGCCATGGCTCTGTGGAGG + Intergenic
1143346029 17:6249973-6249995 AGGATGCGATGGCTCTGGGGAGG - Intergenic
1144816487 17:18039122-18039144 GGAGGTTGAGGGCTCTGAGGAGG - Exonic
1147421392 17:40323736-40323758 GGGGGTCAATGGGTCGGAGGGGG + Intronic
1149896963 17:60435841-60435863 AGGAGGCGATGACTCTAAGGAGG - Intergenic
1151530563 17:74702086-74702108 GGGAGTAGAAGGGTCTCAGGTGG + Intronic
1152525706 17:80887245-80887267 GGGGTGCGCTGGCTCTGAGGGGG + Intronic
1152525721 17:80887297-80887319 GGGGTGCGCTGGCTCTGAGGGGG + Intronic
1152911117 17:83005358-83005380 GGGAGTCGAGGGCGAGGAGGAGG + Intronic
1153602343 18:6793447-6793469 GGGAATGGACGGCTTTGAGGTGG + Intronic
1153979219 18:10295046-10295068 GGGAAAGGATGGCTCTGGGGTGG + Intergenic
1157272966 18:46290657-46290679 TGGAGGCGATGGCACTGAGCTGG - Intergenic
1160049713 18:75421482-75421504 GGGAGTGGAGGGAGCTGAGGAGG + Intronic
1160636334 19:77861-77883 GGCTGTGGGTGGCTCTGAGGGGG + Intergenic
1161250177 19:3276074-3276096 GGGAGGAGCTGGCTCTGGGGTGG + Intronic
1161516981 19:4702096-4702118 GGAAGTCGATGAGTCCGAGGTGG - Exonic
1162403819 19:10461722-10461744 AGGAGTCGAGGGCTTTGGGGAGG + Intronic
1165045108 19:33098354-33098376 TTGAGTCCCTGGCTCTGAGGAGG + Intronic
1167735278 19:51290771-51290793 GGGAGGAGATGGCTCTCTGGGGG - Intergenic
1168302032 19:55410606-55410628 GCAAGTAGAGGGCTCTGAGGTGG + Intergenic
925557525 2:5147884-5147906 AGGAGTGGAAGGCTCTGATGAGG - Intergenic
926289430 2:11516911-11516933 GGGTGGCGAGGGCTGTGAGGCGG + Intergenic
928396934 2:30949823-30949845 GTGAGTAGATGGTTCTGATGTGG + Intronic
932132086 2:69197019-69197041 GGGCTTGGATGGTTCTGAGGAGG - Intronic
932435890 2:71702386-71702408 GGGAGTGGGTGGGTATGAGGGGG + Intergenic
935432491 2:102991027-102991049 GGGAGTTGAGGGCTGTGGGGTGG + Intergenic
936565147 2:113577189-113577211 GGCTGTGGGTGGCTCTGAGGGGG - Intergenic
939236368 2:139499259-139499281 GGGAGTCGATGTCTCTTTGTAGG - Intergenic
942687606 2:178549799-178549821 GGGAGAAGATGACTCTGTGGTGG - Exonic
947874427 2:233459025-233459047 CGGAGCCCATGGCTCTGATGTGG + Intronic
948157896 2:235799401-235799423 GGGAGTCGATGGAACGGAGGAGG - Exonic
948897388 2:240933801-240933823 GGGAGGAGCTGGCTCTGCGGAGG + Intronic
949049129 2:241887876-241887898 GGGATGCAGTGGCTCTGAGGGGG + Intergenic
1168790489 20:572784-572806 GGGTGCTGAAGGCTCTGAGGTGG + Intergenic
1168813123 20:719363-719385 GGCAGGTGATGGTTCTGAGGTGG - Intergenic
1171385136 20:24764764-24764786 GAGAGTCCAGGGCTCTGAGTGGG - Intergenic
1173556760 20:43971937-43971959 GGCAGTGGATGGCTGGGAGGTGG + Intronic
1173802017 20:45899827-45899849 TGGAGTCGCTGGCTGTGAGTGGG - Exonic
1174055379 20:47794804-47794826 GGGAGTCAGTGGGTGTGAGGAGG + Intergenic
1175407593 20:58745034-58745056 GGGAGAGGAAGGCTGTGAGGTGG - Intergenic
1175960461 20:62634028-62634050 GGGAGTCGGGGGCTGTGAGGCGG + Intergenic
1176078630 20:63260670-63260692 GGGCGGCGATGGCTGTGGGGTGG - Intronic
1180187778 21:46148277-46148299 GGGAGTCGGCGTCTCTGAGGAGG + Intronic
1180835175 22:18926143-18926165 GGGAGACCCTGGCTCTGGGGTGG - Intronic
1181314854 22:21964422-21964444 GGGTGACGGTGGCTCTGAGCAGG + Intronic
1182230088 22:28831336-28831358 GGGTGTTGTTGTCTCTGAGGTGG + Intergenic
1183543599 22:38443836-38443858 GGGAGACGAGAGCTCTGAGCAGG - Intronic
1183898870 22:40990492-40990514 GGGAGGAGCTGGCTCTGATGTGG + Intergenic
1184611220 22:45604962-45604984 GGGAGAAGATGGCCCTGAGCTGG - Intergenic
1184924570 22:47627815-47627837 GGGAGCTGTTGGCTCTGGGGTGG + Intergenic
1203285263 22_KI270734v1_random:151442-151464 GGGAGACCCTGGCTCTGGGGTGG - Intergenic
950270654 3:11611915-11611937 GGGAGGCAGTGGGTCTGAGGTGG + Intronic
951531624 3:23703676-23703698 GGAAGTAGATGGCTCTGAGCAGG - Intergenic
955829716 3:62988076-62988098 GGGAGGAGATGGCTTTGAGCAGG - Intergenic
957347538 3:78981722-78981744 GGAAGTCCTTGGTTCTGAGGCGG - Intronic
967761165 3:193228019-193228041 GGGAGTTGATGCAGCTGAGGGGG - Intergenic
969221854 4:5765530-5765552 GGGAGTCTATGTCTCTTTGGAGG + Intronic
969432667 4:7165093-7165115 GTGACTCGAGGGCTGTGAGGAGG + Intergenic
969432690 4:7165207-7165229 GTGACTCGAGGGCTGTGAGGAGG + Intergenic
969939852 4:10721162-10721184 GGGAGGTGGGGGCTCTGAGGAGG + Intergenic
971482258 4:27125318-27125340 GGGAGATGATGGCTCTGGAGAGG - Intergenic
976600191 4:86931323-86931345 GGGAGATGCTGGCACTGAGGAGG - Intronic
978208450 4:106107151-106107173 GGGAGTCGATGTCTCTTTGTAGG - Intronic
984252185 4:177348189-177348211 GGGATTCAGTGGGTCTGAGGAGG + Intronic
987123740 5:14792079-14792101 GAGGGTGGAGGGCTCTGAGGGGG + Intronic
990608021 5:57429697-57429719 GGGAGTCGAGGGCTTAGAGAGGG - Intergenic
992086114 5:73279744-73279766 GGGAGTGGATGGCCCAGAGATGG - Intergenic
992995807 5:82331625-82331647 AGAAGTAGATGGCTCTGTGGTGG - Intronic
995135563 5:108676047-108676069 GGGAATGGCAGGCTCTGAGGGGG + Intergenic
998107600 5:139478235-139478257 GGGAGTGGGGGTCTCTGAGGAGG - Intronic
998660161 5:144227725-144227747 AGGAGTGGATGGCTCAGAGAAGG + Intronic
1000326408 5:160175744-160175766 GGGAATCGAAGCCACTGAGGGGG - Intergenic
1000850091 5:166329321-166329343 GAGAGTTGATGGCCCAGAGGAGG - Intergenic
1001043764 5:168355606-168355628 GGGAGCAAAAGGCTCTGAGGTGG + Intronic
1001570707 5:172728738-172728760 GAGAGGCAATGGCTCTGAGCAGG + Intergenic
1006485654 6:34339025-34339047 GGGAGTTGCTGTCTCTGGGGTGG + Intronic
1007575961 6:42925394-42925416 GGGAGCCGAGGGCTCGCAGGCGG - Exonic
1010832414 6:80547093-80547115 GGGAGGTCATGGCTCTGAGATGG + Intergenic
1011729356 6:90244776-90244798 GGGTGATGATGGCTCAGAGGGGG - Intronic
1015785949 6:136921960-136921982 GAGAGCCGCTGGCTCTGTGGGGG + Intergenic
1019332480 7:467247-467269 GGGAAGTGATGGCTGTGAGGAGG - Intergenic
1022528239 7:31052094-31052116 GGGGGTCGGGGGCGCTGAGGTGG - Intergenic
1022615017 7:31920386-31920408 GGGAGCAGCTGGTTCTGAGGAGG - Intronic
1022662637 7:32381026-32381048 GGGAGAGGAAGGCACTGAGGGGG - Intergenic
1024430502 7:49282878-49282900 AGCAGTCTATGGCTCTGAGAGGG + Intergenic
1024533441 7:50411174-50411196 GGGAGTCCAGGGCTCTGGGAAGG - Intergenic
1028057273 7:86261949-86261971 GGGAGTAGTGGGATCTGAGGTGG + Intergenic
1031514955 7:122689666-122689688 GGGAGTTGATGGGTCTGTGAGGG - Intronic
1032306155 7:130733904-130733926 TGGAGCCGCTGGCTCGGAGGTGG - Exonic
1032784830 7:135192815-135192837 AGGGGTCCTTGGCTCTGAGGTGG + Intronic
1033916872 7:146336945-146336967 GGGAGAGGATGGGTCTGAGATGG + Intronic
1047633118 8:126729752-126729774 GGAAGTCGAAGCCTCTGATGAGG + Intergenic
1049414208 8:142487973-142487995 GGGAGTGGGGGGCGCTGAGGAGG + Intronic
1049887277 9:36035-36057 GGCTGTGGGTGGCTCTGAGGGGG + Intergenic
1052176487 9:25469617-25469639 GGGAGTCGAAGTCTCTTTGGAGG + Intergenic
1053197203 9:36128409-36128431 GGGATTTGCTGGCTCTGAAGTGG + Intergenic
1054734385 9:68735751-68735773 GGGAGTAGGGGGTTCTGAGGTGG + Intronic
1055200106 9:73648949-73648971 GGGAGTCGATGGAATGGAGGAGG - Intergenic
1057869881 9:98709245-98709267 GGGAGGCGCTGGCGCTGCGGCGG + Intergenic
1059363272 9:113764831-113764853 GGGAGTCATTGGCTTAGAGGTGG + Intergenic
1188529039 X:31117742-31117764 GTGTGTGGATGACTCTGAGGAGG - Intronic
1193278854 X:79624825-79624847 GGCAGACAATGGCTCTGATGAGG - Intergenic
1199478258 X:148270013-148270035 TAGAATCGATGGGTCTGAGGTGG - Intergenic
1200250985 X:154553616-154553638 AGGTGCCGATGGCACTGAGGTGG - Intronic
1202249318 Y:22853423-22853445 GTGAGTTGAGGGCTTTGAGGGGG + Intergenic
1202402304 Y:24487171-24487193 GTGAGTTGAGGGCTTTGAGGGGG + Intergenic
1202468476 Y:25182913-25182935 GTGAGTTGAGGGCTTTGAGGGGG - Intergenic