ID: 900390988

View in Genome Browser
Species Human (GRCh38)
Location 1:2433834-2433856
Sequence AGGGAGTCGATGGCTCTGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 149}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900390988_900391001 8 Left 900390988 1:2433834-2433856 CCCCTCAGAGCCATCGACTCCCT 0: 1
1: 0
2: 0
3: 8
4: 149
Right 900391001 1:2433865-2433887 GTGCCCACACTGGGGGTCCCGGG 0: 1
1: 0
2: 3
3: 28
4: 211
900390988_900390999 1 Left 900390988 1:2433834-2433856 CCCCTCAGAGCCATCGACTCCCT 0: 1
1: 0
2: 0
3: 8
4: 149
Right 900390999 1:2433858-2433880 CACGGATGTGCCCACACTGGGGG 0: 1
1: 0
2: 0
3: 9
4: 99
900390988_900391006 25 Left 900390988 1:2433834-2433856 CCCCTCAGAGCCATCGACTCCCT 0: 1
1: 0
2: 0
3: 8
4: 149
Right 900391006 1:2433882-2433904 CCCGGGTGATGTTGGCCGTTTGG 0: 1
1: 0
2: 0
3: 1
4: 43
900390988_900391000 7 Left 900390988 1:2433834-2433856 CCCCTCAGAGCCATCGACTCCCT 0: 1
1: 0
2: 0
3: 8
4: 149
Right 900391000 1:2433864-2433886 TGTGCCCACACTGGGGGTCCCGG 0: 1
1: 0
2: 1
3: 24
4: 209
900390988_900390996 -1 Left 900390988 1:2433834-2433856 CCCCTCAGAGCCATCGACTCCCT 0: 1
1: 0
2: 0
3: 8
4: 149
Right 900390996 1:2433856-2433878 TCCACGGATGTGCCCACACTGGG 0: 1
1: 0
2: 1
3: 7
4: 102
900390988_900390998 0 Left 900390988 1:2433834-2433856 CCCCTCAGAGCCATCGACTCCCT 0: 1
1: 0
2: 0
3: 8
4: 149
Right 900390998 1:2433857-2433879 CCACGGATGTGCCCACACTGGGG 0: 1
1: 0
2: 0
3: 15
4: 130
900390988_900390995 -2 Left 900390988 1:2433834-2433856 CCCCTCAGAGCCATCGACTCCCT 0: 1
1: 0
2: 0
3: 8
4: 149
Right 900390995 1:2433855-2433877 CTCCACGGATGTGCCCACACTGG 0: 1
1: 0
2: 0
3: 7
4: 150
900390988_900391004 17 Left 900390988 1:2433834-2433856 CCCCTCAGAGCCATCGACTCCCT 0: 1
1: 0
2: 0
3: 8
4: 149
Right 900391004 1:2433874-2433896 CTGGGGGTCCCGGGTGATGTTGG 0: 1
1: 0
2: 0
3: 14
4: 224

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900390988 Original CRISPR AGGGAGTCGATGGCTCTGAG GGG (reversed) Intronic
900390988 1:2433834-2433856 AGGGAGTCGATGGCTCTGAGGGG - Intronic
901170719 1:7255136-7255158 AGGGAGTCGGGGGCTAGGAGAGG + Intronic
902375670 1:16028968-16028990 AAGGAGACCATGGCTCTGGGAGG + Intronic
902791946 1:18775380-18775402 AGGGAGCAGAGGGCTCTGGGAGG + Intergenic
903943954 1:26950304-26950326 AGGGAGGCTAGGGCTCAGAGAGG - Intronic
904399603 1:30247541-30247563 TGAGAATCGATGGCTCTGAATGG + Intergenic
906212161 1:44017990-44018012 AGGGACTGGATGGGTCTGAGTGG - Intronic
907423951 1:54366965-54366987 AGGGATTCGGAGGCTCTGAGAGG - Intronic
910251295 1:85201264-85201286 AGCGAGCCCATGGCTCTGGGGGG + Intergenic
910936182 1:92485689-92485711 AGGGAGCCGAGGGCGCTAAGGGG + Intronic
912801173 1:112720512-112720534 AGGGAGCCGATGGCTCTGCAGGG - Exonic
917972298 1:180216732-180216754 AGGGAGTCCCTGGCTGTCAGGGG - Intergenic
919843959 1:201629263-201629285 AGGGAGGGGCTGGCCCTGAGTGG + Intronic
922744282 1:228035584-228035606 AGGGCGGGGATGGATCTGAGCGG + Intronic
1064336778 10:14450511-14450533 AGGGAGTTGGTGGCTCTGCTGGG + Intronic
1067337506 10:45377308-45377330 AGGGAAAAGATGGCTCAGAGGGG - Intronic
1067983357 10:51113428-51113450 AGGGAGAAGATGGCTCTGGTTGG - Intronic
1072626274 10:97114235-97114257 TGGGAGTCGGTGCTTCTGAGAGG - Intronic
1073086714 10:100895774-100895796 AAGGAGTCGATGGCACAGATGGG - Intergenic
1073097417 10:100988265-100988287 GGGGAGTGGATGGGTCGGAGGGG + Exonic
1074183399 10:111082105-111082127 GGGAAGACCATGGCTCTGAGGGG + Intergenic
1076438119 10:130460106-130460128 AGGGAGGTGTGGGCTCTGAGGGG + Intergenic
1076585169 10:131542140-131542162 AGGGAGGCCCTTGCTCTGAGAGG - Intergenic
1076899993 10:133333671-133333693 TGAGAGTGGAAGGCTCTGAGGGG + Intronic
1076899999 10:133333706-133333728 TGAGAGTGGAAGGCTCTGAGGGG + Intronic
1076900005 10:133333737-133333759 TGAGAGTGGAAGGCTCTGAGGGG + Intronic
1080446881 11:32345717-32345739 AGACAGTGGAGGGCTCTGAGAGG - Intergenic
1082081829 11:48018390-48018412 GGGCAGTGGATGGCTGTGAGTGG + Intronic
1084780336 11:71404092-71404114 AGGGAGATGGAGGCTCTGAGAGG - Intergenic
1086491456 11:87360990-87361012 AGGGAGCCAAAGGCACTGAGGGG - Intergenic
1087739354 11:101869940-101869962 AGAGAGTGGTTGGCTCTGAAGGG - Intronic
1087891431 11:103542166-103542188 TGGGAGTCTATGGGTCTGTGGGG - Intergenic
1092226651 12:6752598-6752620 GGGAAGAGGATGGCTCTGAGTGG - Intronic
1092744283 12:11659110-11659132 AGGGAGTAGATGGCCCTTCGTGG + Intronic
1102413130 12:112737611-112737633 GAGGAGTCTATGGCTCAGAGGGG - Intronic
1102953925 12:117047326-117047348 AGGGAGGCGATGGCCGGGAGGGG + Intronic
1106581958 13:31026509-31026531 AGGGAGTGGATGCCTCAGAAGGG - Intergenic
1119721591 14:76895124-76895146 AGAGACTTGATGGCTCTAAGTGG - Intergenic
1121302922 14:92886197-92886219 AGGAAGTCTATCTCTCTGAGAGG + Intergenic
1128096418 15:64959887-64959909 AAGGAGTCCCTGGCTCTTAGTGG + Intergenic
1128511433 15:68316182-68316204 AGGGAGGAGATGGCCCAGAGAGG + Intronic
1129888478 15:79055310-79055332 GGGTAGTTGCTGGCTCTGAGTGG - Intronic
1130208112 15:81897229-81897251 AGGGAGTCTAAGGTTCTGAATGG + Intergenic
1130983193 15:88826983-88827005 AGGAAGACAATGGCTCAGAGAGG - Intronic
1132490812 16:229533-229555 AGGGAGGCTGAGGCTCTGAGTGG + Intergenic
1132830763 16:1926926-1926948 AGGGAGTGGAGGGCCGTGAGGGG + Intergenic
1133588009 16:7214462-7214484 AGGCAGTGGATGGATCGGAGAGG - Intronic
1133884626 16:9814673-9814695 AGGTAGTCCATGTCTTTGAGAGG - Intronic
1137943635 16:52713394-52713416 AGGAGGTGGATGGCTCTGATTGG + Intergenic
1139308187 16:66005937-66005959 AGGGAGTCAAAGGCCCAGAGTGG + Intergenic
1140969071 16:79995487-79995509 AGGGAGTGGATTCCTCAGAGAGG - Intergenic
1141485862 16:84339881-84339903 AGGGACTCAAAGGCGCTGAGAGG + Intergenic
1141799279 16:86296130-86296152 AAGTAGTCCATGTCTCTGAGAGG + Intergenic
1144678366 17:17176194-17176216 AGGGAGTCCTTGGCACTGGGAGG + Intronic
1148195830 17:45711917-45711939 AAGGAGTCCATGAATCTGAGGGG - Intergenic
1151081005 17:71328647-71328669 AGGTAGTTGATGAATCTGAGGGG + Intergenic
1151467884 17:74299480-74299502 AGGGAGTCAATGCCTGGGAGGGG + Intronic
1152595483 17:81235792-81235814 AGGCAGTAGATGCCCCTGAGGGG - Intronic
1152817987 17:82419874-82419896 AGGGAGTCCTTACCTCTGAGAGG - Exonic
1153290494 18:3497432-3497454 AAAGCATCGATGGCTCTGAGAGG + Exonic
1155318244 18:24593398-24593420 AGGGTAACTATGGCTCTGAGGGG + Intergenic
1157273588 18:46294704-46294726 AGGGAGTGGATGGGCCTCAGAGG - Intergenic
1158343592 18:56491900-56491922 AGGGAGTGGAGGGCGCTAAGAGG - Intergenic
1158638107 18:59178961-59178983 AGGGAGGGGCTGCCTCTGAGGGG - Intergenic
1159284896 18:66336562-66336584 AGGGAGCCCATGGCCCTGAAAGG - Intergenic
1160945944 19:1644175-1644197 AGCGAGTCGATGGGTGCGAGGGG - Intronic
1161053284 19:2176744-2176766 AGGGAGTCGCTGTCTCAAAGTGG - Intronic
1161059448 19:2207780-2207802 GGGGCGTTGAGGGCTCTGAGGGG - Intronic
1161526734 19:4760521-4760543 GAGGAGTCGAGGGCTCAGAGAGG - Intergenic
1161846223 19:6713322-6713344 AGGGAGAGGAGGGCTCAGAGAGG + Intronic
1161990229 19:7680656-7680678 AGGGTCTCGCTGGCTCTGGGTGG - Intronic
1162471093 19:10872202-10872224 AGGAAGTGGGGGGCTCTGAGTGG + Intronic
1162843587 19:13373951-13373973 AGGAAGACAATGGCTTTGAGGGG + Intronic
1163471487 19:17499990-17500012 AGGAAGTAGATGCCTCTGTGTGG - Intronic
1167735279 19:51290772-51290794 AGGGAGGAGATGGCTCTCTGGGG - Intergenic
926063672 2:9820679-9820701 AGGGAGACGGAGGCTCAGAGAGG - Intergenic
926167033 2:10527627-10527649 AGAGAGCCCAGGGCTCTGAGAGG + Intergenic
926351502 2:11999493-11999515 AGGGAATCTATGGCTCAGAGAGG - Intergenic
927151518 2:20198961-20198983 AGGGAGAGGGTGCCTCTGAGGGG - Intergenic
932307672 2:70715530-70715552 AGGGGGCAGGTGGCTCTGAGGGG - Intronic
937835732 2:126468771-126468793 AGGCAGTGGATGGCTCTGGTTGG - Intergenic
937934615 2:127232812-127232834 AAGGAGACGGTGGCTCAGAGAGG - Intergenic
939933399 2:148258968-148258990 AGGGAGTCAAAGGCACTCAGGGG + Intronic
945428694 2:209739137-209739159 AGGAAGCTGATGGCTCTGACTGG - Intergenic
946696175 2:222361854-222361876 ATGGAGTCCATAGCTCTGACAGG - Intergenic
946852208 2:223918755-223918777 AGGAAGGCGGTGGCTGTGAGTGG + Intronic
947643112 2:231718156-231718178 AGTGACTCGATGGCCCTGGGAGG + Intergenic
1169213960 20:3783262-3783284 AGGGAGGGGCTGGCTCTGAAAGG + Intergenic
1170597653 20:17817730-17817752 AGGGTGTGGATGGCACTGACTGG - Intergenic
1171385137 20:24764765-24764787 GGAGAGTCCAGGGCTCTGAGTGG - Intergenic
1173465040 20:43274096-43274118 AGGGAATGGATGGCTGTGGGTGG + Intergenic
1173802018 20:45899828-45899850 CTGGAGTCGCTGGCTGTGAGTGG - Exonic
1174125966 20:48306557-48306579 AGGGAGTGGAGTGCTCAGAGTGG - Intergenic
1175780399 20:61678788-61678810 AGGGAGAAGATGGCTATGGGAGG - Intronic
1175940231 20:62534402-62534424 AAGCAGCAGATGGCTCTGAGAGG + Intergenic
1177553964 21:22665877-22665899 AGGGAGTAGATGACTCAGAAAGG + Intergenic
1179286016 21:39978067-39978089 AGGGAGTCTAAGGCCCTGGGAGG + Intergenic
1183686564 22:39364336-39364358 AGGGAGGCTAAGGCTCAGAGAGG - Intronic
956840205 3:73132716-73132738 AGGAAGTGGAAGGCTTTGAGAGG - Intergenic
956979476 3:74618547-74618569 CTGGGGTGGATGGCTCTGAGAGG + Intergenic
960055762 3:113275328-113275350 AGGGAGTCTCGGGCTCTGACAGG + Intronic
961353093 3:126316423-126316445 AGGGAGTGCATGGGCCTGAGTGG + Intergenic
961353102 3:126316449-126316471 AGGGAGTCTATGGGCCGGAGTGG + Intergenic
961684695 3:128621575-128621597 GGGGAGTCAGTGACTCTGAGGGG + Intronic
962862605 3:139418749-139418771 AGGGAGCCCATTGCTCTGAAGGG - Intergenic
967761166 3:193228020-193228042 AGGGAGTTGATGCAGCTGAGGGG - Intergenic
968015477 3:195328622-195328644 AGGGGTTTTATGGCTCTGAGTGG + Intronic
969056880 4:4407782-4407804 AAGGAGTCTGTGGCTCAGAGAGG + Intronic
971219348 4:24690897-24690919 AGGGAGGAGATTGCTCTGAGAGG - Intergenic
973726363 4:53780855-53780877 AGTGAATGGATGGCTCTGATTGG - Intronic
975802954 4:78081512-78081534 AGGTAAACAATGGCTCTGAGAGG - Intronic
985177389 4:187215817-187215839 AGGGAGATGATGGCTTTGACAGG + Intergenic
986794553 5:11196655-11196677 AGGGAGTGGATGACTCCAAGAGG - Intronic
987063780 5:14268164-14268186 AGGGAGTCCATGACTCATAGTGG + Intronic
990608022 5:57429698-57429720 GGGGAGTCGAGGGCTTAGAGAGG - Intergenic
991344355 5:65646979-65647001 AGGGTGTGCATGGCTATGAGTGG - Intronic
991958395 5:72018140-72018162 AGGGAGTAGAAGGTTCTAAGAGG + Intergenic
992321360 5:75616139-75616161 GGGGAGTAGAGGGCTCTCAGAGG - Intronic
995173435 5:109144434-109144456 ACGGAGTGCAGGGCTCTGAGAGG - Intronic
996760870 5:126984557-126984579 AGAGAGTGGCTGGCTCTCAGGGG - Intronic
997786489 5:136718362-136718384 AGGGAATCAATGACCCTGAGTGG - Intergenic
999326089 5:150644623-150644645 AAGGAGACTGTGGCTCTGAGAGG + Intronic
1000326409 5:160175745-160175767 AGGGAATCGAAGCCACTGAGGGG - Intergenic
1002472515 5:179444677-179444699 AGGGAGGCGCTGGTTCTCAGGGG + Intergenic
1002481605 5:179504979-179505001 AGGGAGGCGCTGGTTCTCAGGGG - Intergenic
1003172019 6:3727332-3727354 ATGGAGTTGCTGGCTCTGAGGGG - Intronic
1005629540 6:27694398-27694420 AGGAAGTCGATGACTCTGCAGGG + Intergenic
1010723915 6:79312202-79312224 AGGGAGTCAAAGGCACTCAGGGG + Intergenic
1011729357 6:90244777-90244799 AGGGTGATGATGGCTCAGAGGGG - Intronic
1011781565 6:90795634-90795656 AGTGAGGAGATGGATCTGAGAGG + Intergenic
1015535985 6:134268198-134268220 AGGGAGTAGCTGACTGTGAGTGG + Intronic
1016555324 6:145329839-145329861 AGAGAGTGGATTGATCTGAGTGG + Intergenic
1018373721 6:163191735-163191757 AGGGACGTCATGGCTCTGAGTGG - Intronic
1018992752 6:168686535-168686557 GGGGAGTCGGTGGCTCTCACTGG + Intergenic
1021532604 7:21665120-21665142 AGGGAGTGAAAGGCACTGAGAGG - Intronic
1024430501 7:49282877-49282899 AAGCAGTCTATGGCTCTGAGAGG + Intergenic
1027787037 7:82592962-82592984 AGGGAGTCAATTGCTCTGCCTGG + Intergenic
1031514956 7:122689667-122689689 TGGGAGTTGATGGGTCTGTGAGG - Intronic
1039292136 8:36108287-36108309 AGGGAGTCCAAGTATCTGAGTGG + Intergenic
1039511058 8:38092283-38092305 AGGGAGTTGCTGGACCTGAGGGG - Intergenic
1039841006 8:41293127-41293149 AGGGAGTGCATAGCTGTGAGGGG - Intronic
1041004797 8:53487452-53487474 AGGGAGTTTATGGGTCTGTGGGG + Intergenic
1042269554 8:66941399-66941421 AGGGAGGCCAAGGCACTGAGAGG - Intergenic
1045078815 8:98602350-98602372 AGGGATTAGATGGTTCTGTGGGG - Intronic
1049391093 8:142372052-142372074 AAGGAGACGAAGGCTGTGAGAGG + Intronic
1057883410 9:98809530-98809552 AGGGAAACCAAGGCTCTGAGAGG - Intronic
1058027609 9:100159376-100159398 AGATAGTCAATGGCTCTGAGTGG + Intronic
1059955631 9:119512764-119512786 ATGGAGTGGCTGTCTCTGAGGGG + Intronic
1060967103 9:127717503-127717525 AGGGACTTGGTGGCCCTGAGAGG - Intronic
1061397977 9:130353818-130353840 AGGGTGTCGGTGGCTCTGGATGG + Intronic
1061667866 9:132170770-132170792 ACTGAGGCGATTGCTCTGAGTGG - Intronic
1062433128 9:136534898-136534920 AGGGACTCGGGGGCTCTGTGAGG - Intronic
1189143845 X:38635885-38635907 AGGTAGGCCATGGTTCTGAGTGG + Intronic
1195545601 X:106108935-106108957 AGAGAGTCAATGGCCTTGAGTGG - Intergenic
1197717333 X:129718968-129718990 AGGGAGAGGATGGCTCTGGCAGG - Intergenic
1199553208 X:149079246-149079268 TGGGAGTTTATGGGTCTGAGGGG + Intergenic
1200709868 Y:6473801-6473823 AGGCAGCTGATGGCTCTGACAGG - Intergenic
1201024245 Y:9690907-9690929 AGGCAGCTGATGGCTCTGACAGG + Intergenic