ID: 900390989

View in Genome Browser
Species Human (GRCh38)
Location 1:2433835-2433857
Sequence GAGGGAGTCGATGGCTCTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 136}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900390989_900390999 0 Left 900390989 1:2433835-2433857 CCCTCAGAGCCATCGACTCCCTC 0: 1
1: 0
2: 1
3: 7
4: 136
Right 900390999 1:2433858-2433880 CACGGATGTGCCCACACTGGGGG 0: 1
1: 0
2: 0
3: 9
4: 99
900390989_900390995 -3 Left 900390989 1:2433835-2433857 CCCTCAGAGCCATCGACTCCCTC 0: 1
1: 0
2: 1
3: 7
4: 136
Right 900390995 1:2433855-2433877 CTCCACGGATGTGCCCACACTGG 0: 1
1: 0
2: 0
3: 7
4: 150
900390989_900391000 6 Left 900390989 1:2433835-2433857 CCCTCAGAGCCATCGACTCCCTC 0: 1
1: 0
2: 1
3: 7
4: 136
Right 900391000 1:2433864-2433886 TGTGCCCACACTGGGGGTCCCGG 0: 1
1: 0
2: 1
3: 24
4: 209
900390989_900391004 16 Left 900390989 1:2433835-2433857 CCCTCAGAGCCATCGACTCCCTC 0: 1
1: 0
2: 1
3: 7
4: 136
Right 900391004 1:2433874-2433896 CTGGGGGTCCCGGGTGATGTTGG 0: 1
1: 0
2: 0
3: 14
4: 224
900390989_900390998 -1 Left 900390989 1:2433835-2433857 CCCTCAGAGCCATCGACTCCCTC 0: 1
1: 0
2: 1
3: 7
4: 136
Right 900390998 1:2433857-2433879 CCACGGATGTGCCCACACTGGGG 0: 1
1: 0
2: 0
3: 15
4: 130
900390989_900391001 7 Left 900390989 1:2433835-2433857 CCCTCAGAGCCATCGACTCCCTC 0: 1
1: 0
2: 1
3: 7
4: 136
Right 900391001 1:2433865-2433887 GTGCCCACACTGGGGGTCCCGGG 0: 1
1: 0
2: 3
3: 28
4: 211
900390989_900390996 -2 Left 900390989 1:2433835-2433857 CCCTCAGAGCCATCGACTCCCTC 0: 1
1: 0
2: 1
3: 7
4: 136
Right 900390996 1:2433856-2433878 TCCACGGATGTGCCCACACTGGG 0: 1
1: 0
2: 1
3: 7
4: 102
900390989_900391006 24 Left 900390989 1:2433835-2433857 CCCTCAGAGCCATCGACTCCCTC 0: 1
1: 0
2: 1
3: 7
4: 136
Right 900391006 1:2433882-2433904 CCCGGGTGATGTTGGCCGTTTGG 0: 1
1: 0
2: 0
3: 1
4: 43

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900390989 Original CRISPR GAGGGAGTCGATGGCTCTGA GGG (reversed) Intronic
900055908 1:630478-630500 GAGGGTGATGATGGCTATGATGG - Intergenic
900390989 1:2433835-2433857 GAGGGAGTCGATGGCTCTGAGGG - Intronic
901529591 1:9844590-9844612 GAAGGAGCCGCTGGCTGTGATGG + Intergenic
904208549 1:28870959-28870981 GTAGGAGTTGATGGTTCTGAAGG + Intergenic
904306270 1:29592285-29592307 GAGGGGGGCCATGGCTATGACGG - Intergenic
910251294 1:85201263-85201285 GAGCGAGCCCATGGCTCTGGGGG + Intergenic
910663531 1:89699824-89699846 GGCAGAGTAGATGGCTCTGAAGG - Intronic
910936181 1:92485688-92485710 GAGGGAGCCGAGGGCGCTAAGGG + Intronic
912801174 1:112720513-112720535 GAGGGAGCCGATGGCTCTGCAGG - Exonic
914373426 1:147050968-147050990 GAGGGTCTCGATGGCGCGGATGG - Intergenic
917972299 1:180216733-180216755 GAGGGAGTCCCTGGCTGTCAGGG - Intergenic
919764913 1:201120769-201120791 CAGGGAACCCATGGCTCTGAAGG + Intronic
920166550 1:204040318-204040340 GGGTGAGTTGATGGCTCTGCTGG + Intergenic
922470884 1:225876390-225876412 AAGGGGGCAGATGGCTCTGATGG - Intronic
1062814477 10:489641-489663 TAGGGACACGGTGGCTCTGACGG + Intronic
1062814489 10:489690-489712 TAGGGACACGGTGGCTCTGACGG + Intronic
1062814501 10:489739-489761 TAGGGACACGGTGGCTCTGACGG + Intronic
1062814513 10:489788-489810 TAGGGACACGGTGGCTCTGACGG + Intronic
1062814559 10:489985-490007 CAGGGACACGGTGGCTCTGACGG + Intronic
1062814604 10:490182-490204 CAGGGACACGGTGGCTCTGACGG + Intronic
1064336777 10:14450510-14450532 CAGGGAGTTGGTGGCTCTGCTGG + Intronic
1067662859 10:48249563-48249585 GAGGGAGAAGATGACGCTGAAGG + Intronic
1068702751 10:60037301-60037323 GAGGAATTCGAAGCCTCTGAAGG - Intronic
1073086715 10:100895775-100895797 AAAGGAGTCGATGGCACAGATGG - Intergenic
1076067274 10:127458730-127458752 GAGCCAGTGGATGGCACTGAGGG + Intergenic
1076438118 10:130460105-130460127 GAGGGAGGTGTGGGCTCTGAGGG + Intergenic
1076697357 10:132253394-132253416 GAGGGAGTCGAGGGAGCTGGAGG + Intronic
1076697365 10:132253423-132253445 GAGGGAGTCGAGGGAGCTGGAGG + Intronic
1076697370 10:132253442-132253464 GAGGGAGTCGAGGGAACTGGAGG + Intronic
1076697378 10:132253471-132253493 GAGGGAGTCGAGGGAGCTGGAGG + Intronic
1076697383 10:132253490-132253512 GAGGGAGTCGAGGGAGCTGAGGG + Intronic
1076697396 10:132253537-132253559 GAGGGAGTCGAGGGAGCTGGAGG + Intronic
1076697401 10:132253556-132253578 GAGGGAGTCGAGGGAGCTGGAGG + Intronic
1077288200 11:1776944-1776966 GAGGATGTCAATGTCTCTGAAGG + Intergenic
1077923208 11:6656181-6656203 GAGGGAGACCAGGGCACTGAGGG - Intergenic
1080399979 11:31925180-31925202 GATGGATTTGATGGCTATGAAGG + Intronic
1084665623 11:70574666-70574688 GAAGGAGGGGCTGGCTCTGATGG + Intronic
1086598422 11:88603246-88603268 GAGGGAGGAGATGCCTCAGAAGG - Intronic
1087739355 11:101869941-101869963 TAGAGAGTGGTTGGCTCTGAAGG - Intronic
1088824703 11:113483836-113483858 GAGTCAGTCCCTGGCTCTGAGGG - Intergenic
1090659817 11:128873733-128873755 GAGGGTGTTTATGGTTCTGAAGG + Intergenic
1092497673 12:9012769-9012791 GAGGGAGCCCATTGCCCTGAAGG + Intergenic
1092925811 12:13271032-13271054 GAGGCAGTAGATGGCTCTCTTGG + Intergenic
1095037839 12:37411182-37411204 GAGCGAGTTGAGGCCTCTGATGG + Intergenic
1099779354 12:87173933-87173955 GTGGGAGTCTAAGTCTCTGAAGG - Intergenic
1102072332 12:110031168-110031190 GAGGGAGTAGATGTCTGTGTTGG + Intronic
1102413131 12:112737612-112737634 GGAGGAGTCTATGGCTCAGAGGG - Intronic
1103059703 12:117848586-117848608 GAGGGAGACCGTGGCTCAGAGGG + Intronic
1103805772 12:123571545-123571567 GAGGGATGCAATGGCTCTAATGG + Intergenic
1104785167 12:131444336-131444358 GAGGGACTCGGGGGCCCTGATGG - Intergenic
1106581959 13:31026510-31026532 AAGGGAGTGGATGCCTCAGAAGG - Intergenic
1109363484 13:61326094-61326116 GAGGGAGTCTAAGTCTCTGTAGG - Intergenic
1113449580 13:110397735-110397757 GAGGGAGTGGGTGGGTATGAGGG + Intronic
1118726801 14:68634590-68634612 GAGGGTTTCGGTGGCTCTGTAGG - Intronic
1128072125 15:64804346-64804368 GAGGAAGTGGCTGGGTCTGAGGG - Intergenic
1135184847 16:20306674-20306696 GAGGCAGGCAATGGCTCAGATGG + Intergenic
1138699671 16:58849077-58849099 GAGGGAGTCTATGCCCCTCAAGG - Intergenic
1140452972 16:75086541-75086563 GAGGGAGTCTGTGTCTTTGAGGG + Intronic
1141327392 16:83074710-83074732 GTGTGAGACGATGGCTATGAAGG - Intronic
1148643174 17:49203513-49203535 GAGGGAAAGGATGGCTCAGATGG + Intronic
1149565570 17:57638496-57638518 GAGGGAGCCGTTGACTCTGCTGG + Intronic
1151081004 17:71328646-71328668 GAGGTAGTTGATGAATCTGAGGG + Intergenic
1152044818 17:77928995-77929017 AAGGGAGTAGCTGGCTTTGATGG + Intergenic
1155318243 18:24593397-24593419 GAGGGTAACTATGGCTCTGAGGG + Intergenic
1161059449 19:2207781-2207803 GGGGGCGTTGAGGGCTCTGAGGG - Intronic
1161687165 19:5708491-5708513 GAGGGAGTTGATGGAGCTGGTGG - Intronic
1163711848 19:18851784-18851806 GAGGAAGCAGCTGGCTCTGAAGG + Intronic
1166190342 19:41172701-41172723 GAGGGAGTGTATGGCGCTGGAGG - Intergenic
1166505403 19:43368411-43368433 CAGGGACTTCATGGCTCTGATGG + Intergenic
1167981164 19:53276865-53276887 GAAAGAGTCAGTGGCTCTGATGG - Intergenic
927214774 2:20662072-20662094 GAGAGGGTGGATGGCTCTGCAGG + Intergenic
932697564 2:73969488-73969510 GGGGGAGGGGGTGGCTCTGAGGG - Intergenic
938087356 2:128410197-128410219 GTGGGAGTAGATGCCTCTGAGGG + Intergenic
944445292 2:199782841-199782863 GAAGGAGTGGCTGGATCTGAAGG - Intronic
946296043 2:218784109-218784131 GAGGGAGAAGATGACTCTGAGGG + Intronic
947539853 2:230968929-230968951 GAGGGAGAAGATGGCTCCCATGG + Intergenic
948262359 2:236613582-236613604 GAGGGACTCGATGCCTGGGAGGG + Intergenic
1169226158 20:3858260-3858282 GAGGGCGTCGAAGGCTCTCAGGG - Intronic
1171023363 20:21607256-21607278 GAGGGAAACGGTGGCTCAGAAGG - Intergenic
1171349909 20:24494375-24494397 GTGGGAGTGGATGGCTCAGGAGG + Intronic
1173122713 20:40308323-40308345 GTGGGAGGCAATTGCTCTGAAGG + Intergenic
1173737254 20:45370932-45370954 GAGGGAGTAGAGGGAGCTGAGGG + Intronic
1174387543 20:50196294-50196316 GATGGAGTCAAGGGCTCTGCAGG + Intergenic
1175788550 20:61727130-61727152 GATGGTGATGATGGCTCTGATGG - Intronic
1175788567 20:61727301-61727323 GATGGTGATGATGGCTCTGATGG - Intronic
1175880734 20:62257236-62257258 GAGGATGTTGATGGCTCTGGTGG + Intronic
1176257325 20:64159131-64159153 GTGGGAGTTGCTGGCTCTGCTGG - Intronic
1179551277 21:42145561-42145583 GATGGAGGTGAAGGCTCTGATGG + Intergenic
1180078247 21:45473958-45473980 GAGGAAGGCGATGACTCAGATGG + Exonic
1183351627 22:37337781-37337803 GAGGGAGGAGGTGGCTCTGCTGG - Intergenic
1185144585 22:49124082-49124104 GATGGAATGGATGGCACTGAAGG - Intergenic
956825956 3:72997002-72997024 GAGGGAGGCGGAGGCTGTGAGGG + Exonic
961901397 3:130215684-130215706 GAGGGAGTTGATGGCTTGCATGG + Intergenic
962862606 3:139418750-139418772 AAGGGAGCCCATTGCTCTGAAGG - Intergenic
964436317 3:156657698-156657720 GTGGAAGTAGCTGGCTCTGATGG - Intergenic
964751776 3:160060357-160060379 GAGGGATGCGAGGGCTTTGAGGG - Intergenic
965963265 3:174454258-174454280 GTGGGAGTCTAAGTCTCTGAAGG - Intronic
967055248 3:185824787-185824809 GAGGGTCTCGATGGCGCGGATGG + Exonic
968050486 3:195651652-195651674 GAGGGAGGCGGAGGCTGTGAGGG - Intergenic
968096836 3:195937207-195937229 GAGGGAGGCGGAGGCTGTGAGGG + Intergenic
968105339 3:195996702-195996724 GAGGGAGGCGGAGGCTGTGAGGG + Intergenic
968303627 3:197634279-197634301 GAGGGAGACGGAGGCTGTGAGGG + Intergenic
968956027 4:3720056-3720078 GAGGGAGTCGACAGCACTGCAGG - Intergenic
974998507 4:69193076-69193098 GAGTGATTAGATGGCTCTGGAGG - Intronic
978737580 4:112101476-112101498 GAGGGAGACAATGACTTTGAGGG + Intergenic
981126228 4:141110076-141110098 GAGGCATCTGATGGCTCTGAAGG + Intronic
982450129 4:155543182-155543204 GAGAGAGTGGCTGGCTATGATGG + Intergenic
984206432 4:176792702-176792724 GAGGGGGACGAGGGCTCTGGCGG - Exonic
985507233 5:290335-290357 GAGGGAGGCGGAGGCTGTGAGGG - Intronic
988039812 5:25874612-25874634 GTGGGAGTCCATTGCCCTGAAGG - Intergenic
1000326410 5:160175746-160175768 GAGGGAATCGAAGCCACTGAGGG - Intergenic
1003172020 6:3727333-3727355 GATGGAGTTGCTGGCTCTGAGGG - Intronic
1005327781 6:24719839-24719861 GAGTGAGTCGCTGCCGCTGAAGG - Exonic
1005629539 6:27694397-27694419 GAGGAAGTCGATGACTCTGCAGG + Intergenic
1006424314 6:33954704-33954726 GAGGGAGGCCATGGCGCTGGGGG - Intergenic
1006670968 6:35729359-35729381 GTGGGAGTAGATGGCAGTGAAGG - Intergenic
1007169552 6:39853002-39853024 GAGGGAGGCTATGGCTATGGGGG + Intronic
1007734742 6:43973495-43973517 GAGGAAGTGGTAGGCTCTGAAGG - Intergenic
1008486396 6:52040797-52040819 GATGGAGTAGATGGTTGTGATGG - Intronic
1011729358 6:90244778-90244800 GAGGGTGATGATGGCTCAGAGGG - Intronic
1017665438 6:156715990-156716012 AAGGGAGTGGCAGGCTCTGAGGG + Intergenic
1023886115 7:44357831-44357853 GTGGGAGTCTATGTCTCTGGAGG + Intergenic
1024241995 7:47442861-47442883 GGGGGTGTTGATGCCTCTGATGG - Intronic
1025176032 7:56802945-56802967 GAGGCAGGAGATGGCCCTGAAGG + Intergenic
1025695762 7:63773477-63773499 GAGGCAGGAGATGGCCCTGAAGG - Intergenic
1030487555 7:110189418-110189440 GAGGGAGGAGAAGGCTATGAAGG + Intergenic
1035044419 7:155954315-155954337 GAGGGCTCCGAGGGCTCTGAGGG + Intergenic
1037765396 8:21769382-21769404 GAGGGAGCTGATGGCTTTGCAGG - Intronic
1041623899 8:60003011-60003033 GTGGGAGTCTAAGTCTCTGAAGG - Intergenic
1048205917 8:132415141-132415163 GAGGCAGTAGATGGTTCAGAGGG - Intronic
1048343827 8:133561397-133561419 GAGGCAGTGGAGGGTTCTGATGG - Intronic
1049268933 8:141684011-141684033 GAGGCAGTGGGTGTCTCTGAAGG - Intergenic
1049373497 8:142278621-142278643 AAGGGTGACGCTGGCTCTGAGGG - Intronic
1057913907 9:99041072-99041094 GAGGGAGTCCCAGGCTCTGCAGG + Intronic
1060434939 9:123585138-123585160 GAAGGAGTTGGAGGCTCTGATGG - Intronic
1186915059 X:14209884-14209906 GAGAGAGTTGATGGTTCTTAAGG + Intergenic
1189248595 X:39582297-39582319 GAGGAAGTGGATGGCCCTGAGGG + Intergenic
1189275089 X:39779624-39779646 GGGGGAGTCTCTGGCACTGATGG - Intergenic
1189965280 X:46366229-46366251 GAGGTAGTCCAAGGCCCTGAAGG - Intergenic
1191214148 X:57918733-57918755 GAGGGAGTCTCTGGGTCAGAGGG - Intergenic
1194169784 X:90566708-90566730 GAGGCAGTGGATCGCTCTGTGGG + Intergenic
1198761970 X:140041718-140041740 GAGGGAATGGAGGGCTCAGAGGG - Intergenic
1200023234 X:153229600-153229622 GAGGGAATTGATGGAGCTGATGG - Intergenic
1200516024 Y:4144481-4144503 GAGGCAGTGGATCGCTCTGTGGG + Intergenic
1201143102 Y:11044753-11044775 GAGGGAGCCATTGGCTCTGTGGG - Intergenic