ID: 900390996

View in Genome Browser
Species Human (GRCh38)
Location 1:2433856-2433878
Sequence TCCACGGATGTGCCCACACT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 102}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900390980_900390996 19 Left 900390980 1:2433814-2433836 CCCCTGCCGGCTCCCCAAACCCC 0: 1
1: 0
2: 1
3: 54
4: 531
Right 900390996 1:2433856-2433878 TCCACGGATGTGCCCACACTGGG 0: 1
1: 0
2: 1
3: 7
4: 102
900390983_900390996 13 Left 900390983 1:2433820-2433842 CCGGCTCCCCAAACCCCCTCAGA 0: 1
1: 0
2: 4
3: 36
4: 417
Right 900390996 1:2433856-2433878 TCCACGGATGTGCCCACACTGGG 0: 1
1: 0
2: 1
3: 7
4: 102
900390986_900390996 5 Left 900390986 1:2433828-2433850 CCAAACCCCCTCAGAGCCATCGA 0: 1
1: 0
2: 0
3: 8
4: 75
Right 900390996 1:2433856-2433878 TCCACGGATGTGCCCACACTGGG 0: 1
1: 0
2: 1
3: 7
4: 102
900390989_900390996 -2 Left 900390989 1:2433835-2433857 CCCTCAGAGCCATCGACTCCCTC 0: 1
1: 0
2: 1
3: 7
4: 136
Right 900390996 1:2433856-2433878 TCCACGGATGTGCCCACACTGGG 0: 1
1: 0
2: 1
3: 7
4: 102
900390984_900390996 7 Left 900390984 1:2433826-2433848 CCCCAAACCCCCTCAGAGCCATC 0: 1
1: 0
2: 3
3: 13
4: 239
Right 900390996 1:2433856-2433878 TCCACGGATGTGCCCACACTGGG 0: 1
1: 0
2: 1
3: 7
4: 102
900390981_900390996 18 Left 900390981 1:2433815-2433837 CCCTGCCGGCTCCCCAAACCCCC 0: 1
1: 0
2: 1
3: 40
4: 511
Right 900390996 1:2433856-2433878 TCCACGGATGTGCCCACACTGGG 0: 1
1: 0
2: 1
3: 7
4: 102
900390985_900390996 6 Left 900390985 1:2433827-2433849 CCCAAACCCCCTCAGAGCCATCG 0: 1
1: 0
2: 0
3: 8
4: 78
Right 900390996 1:2433856-2433878 TCCACGGATGTGCCCACACTGGG 0: 1
1: 0
2: 1
3: 7
4: 102
900390988_900390996 -1 Left 900390988 1:2433834-2433856 CCCCTCAGAGCCATCGACTCCCT 0: 1
1: 0
2: 0
3: 8
4: 149
Right 900390996 1:2433856-2433878 TCCACGGATGTGCCCACACTGGG 0: 1
1: 0
2: 1
3: 7
4: 102
900390990_900390996 -3 Left 900390990 1:2433836-2433858 CCTCAGAGCCATCGACTCCCTCC 0: 1
1: 0
2: 2
3: 19
4: 175
Right 900390996 1:2433856-2433878 TCCACGGATGTGCCCACACTGGG 0: 1
1: 0
2: 1
3: 7
4: 102
900390987_900390996 0 Left 900390987 1:2433833-2433855 CCCCCTCAGAGCCATCGACTCCC 0: 1
1: 0
2: 0
3: 15
4: 167
Right 900390996 1:2433856-2433878 TCCACGGATGTGCCCACACTGGG 0: 1
1: 0
2: 1
3: 7
4: 102
900390982_900390996 17 Left 900390982 1:2433816-2433838 CCTGCCGGCTCCCCAAACCCCCT 0: 1
1: 0
2: 1
3: 27
4: 342
Right 900390996 1:2433856-2433878 TCCACGGATGTGCCCACACTGGG 0: 1
1: 0
2: 1
3: 7
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900390996 Original CRISPR TCCACGGATGTGCCCACACT GGG Intronic
900390996 1:2433856-2433878 TCCACGGATGTGCCCACACTGGG + Intronic
902341392 1:15785756-15785778 TCCATGGCTGTGCCCCAACTGGG - Intronic
903461675 1:23525017-23525039 CCCAGGGAGGTGCCCACAGTGGG + Intronic
904316499 1:29669594-29669616 CCCAGGGCTGTTCCCACACTAGG - Intergenic
918175768 1:182043707-182043729 TCCCAGGTTGTACCCACACTAGG - Intergenic
918238623 1:182603001-182603023 TCCACGGATGAGGGCACACAGGG - Intronic
922112011 1:222568601-222568623 TCCACATCTGTGCCAACACTTGG - Intronic
923380327 1:233411184-233411206 TCAACAGATGGGCCCAAACTTGG - Intergenic
1063255024 10:4317929-4317951 TCCACAATTTTGCCCACACTTGG + Intergenic
1065900082 10:30198534-30198556 TCCAAGGATGTGCAAACAGTAGG + Intergenic
1069248910 10:66244483-66244505 TCCAGTGATGTGGCCACAGTGGG + Intronic
1072265939 10:93728094-93728116 TCCAGGACTGTGCCCACCCTTGG + Intergenic
1074357169 10:112796629-112796651 TCCAAGGACTTGCCCACACCAGG - Intronic
1076354023 10:129839488-129839510 TCCACAGATGAGGCCACACGGGG - Intronic
1080760859 11:35247653-35247675 TGGAAGGAGGTGCCCACACTAGG + Intergenic
1081834815 11:46144756-46144778 TCCAGGGCTGTGCCCCCAATGGG - Intergenic
1084753578 11:71220711-71220733 TCCATGGATTTCCCCACTCTAGG - Intronic
1086581921 11:88409179-88409201 TCAACGGATTTGGCCATACTGGG - Intergenic
1086613378 11:88784345-88784367 TCCACTTATGTGCCCACCATAGG + Intronic
1087425073 11:97975276-97975298 TCCACTGATGTGGCTACCCTCGG + Intergenic
1089248017 11:117136745-117136767 TTCACGGATGGGCACACTCTTGG - Intergenic
1089258697 11:117207816-117207838 TTCACGGATGGGCACACTCTTGG + Intronic
1089561210 11:119344131-119344153 TACCCAGATGTTCCCACACTGGG - Intronic
1089635050 11:119806734-119806756 TGCACTCATGAGCCCACACTGGG - Intergenic
1090979209 11:131702186-131702208 ACCAGGGATCGGCCCACACTTGG + Intronic
1091583613 12:1803418-1803440 TCCCCAGATGCGCCCACACCAGG + Intronic
1094311370 12:29087126-29087148 TCCACGCATGTGCCCATAGCTGG + Intergenic
1094774189 12:33704004-33704026 TCCACAGCTTTGCCAACACTGGG + Intergenic
1095252047 12:39990476-39990498 AAGAAGGATGTGCCCACACTTGG + Intronic
1096474682 12:51901093-51901115 TCCAGGTCTGTGCCCAGACTGGG + Intergenic
1101919297 12:108919426-108919448 CCCACACCTGTGCCCACACTTGG + Intronic
1103629863 12:122251292-122251314 TCCACGGCTGCACCCACCCTGGG - Intronic
1109739458 13:66533042-66533064 GCCACTTATGTGCCCACACTGGG + Intronic
1109834606 13:67840847-67840869 TCCATGGATGTACCTACAGTAGG - Intergenic
1111859824 13:93688708-93688730 TCTACGAATTTGCCCACTCTAGG - Intronic
1112133870 13:96553646-96553668 TGCACAGATGTGCCCACATTTGG + Intronic
1112441987 13:99431289-99431311 CCCACGGATGTGCCCTCTTTGGG - Intergenic
1121856091 14:97271443-97271465 ACCACGGATGGCCTCACACTTGG - Intergenic
1125723578 15:41856834-41856856 TCCCCGGGTGGGCCCACACCTGG + Exonic
1127322384 15:57859452-57859474 TCTACTGCTGTGCCCACACTAGG - Intergenic
1129412348 15:75356884-75356906 TCCAGCGATGGGCCCACACCTGG + Exonic
1132236713 15:100227562-100227584 TCCAGCGATGTGCCATCACTGGG - Intronic
1133460410 16:5982234-5982256 TCCAGGGATGTTCCCACCATAGG + Intergenic
1137580792 16:49632400-49632422 TCCCCAGGTGTGCCCACACAGGG + Intronic
1139587420 16:67913042-67913064 TACAGGCATGTGCCCACACCTGG - Intronic
1141388636 16:83646097-83646119 TTCACGTATGGTCCCACACTAGG - Intronic
1145311038 17:21701191-21701213 GCCACTGATGTGCCCACCCCCGG - Intronic
1145992055 17:29085260-29085282 GCCAGGGAGGTGGCCACACTTGG + Intronic
1148935433 17:51161227-51161249 TCCACGGATGGTCCCAGGCTTGG - Exonic
1152271081 17:79325232-79325254 TCCAGGGATGAGCCCACCCAGGG - Intronic
1153871147 18:9321574-9321596 TCCATGAATGTGTCAACACTCGG + Intergenic
1159564087 18:70028292-70028314 TCGGTGGATGTGGCCACACTAGG + Intronic
1160294236 18:77622888-77622910 TCCACGGCTCTGCTCACACTTGG + Intergenic
1160583745 18:79901545-79901567 CCCACGGAGGGGCCCTCACTGGG + Intergenic
1161943258 19:7419025-7419047 ACCCCAGATGTACCCACACTCGG + Intronic
1161943265 19:7419055-7419077 ACCCCAGATGTACCCACACTCGG + Intronic
1161943272 19:7419084-7419106 TACCCTGATGTACCCACACTTGG + Intronic
1161943278 19:7419114-7419136 ACCCCAGATGTACCCACACTCGG + Intronic
1161943293 19:7419174-7419196 ACCCCAGATGTACCCACACTCGG + Intronic
1161943300 19:7419203-7419225 TACCCCGATGTACCCACACTCGG + Intronic
1161943307 19:7419232-7419254 TACCCCGATGTACCCACACTCGG + Intronic
1161943316 19:7419262-7419284 ACCCCAGGTGTGCCCACACTCGG + Intronic
1161943338 19:7419320-7419342 CACCCGGGTGTGCCCACACTTGG + Intronic
1164522777 19:28991504-28991526 TACACGTATGATCCCACACTTGG + Intergenic
1167326926 19:48832441-48832463 CCCAGGGCTGTGCCCTCACTTGG - Intronic
1168648542 19:58077548-58077570 TCCTGGGATGGGGCCACACTTGG - Intronic
926694608 2:15762597-15762619 TCCACTGGTGTGCCCAGCCTTGG + Intergenic
930147174 2:48019159-48019181 TCCAGGGATTTATCCACACTTGG - Intergenic
931706660 2:64951850-64951872 TCCAGGGATGGGGCTACACTAGG + Intergenic
931969195 2:67567161-67567183 CCCACTGATCTACCCACACTGGG - Intergenic
934515586 2:94984480-94984502 TCTATGGATTTGCCCACTCTAGG - Intergenic
948133079 2:235615207-235615229 TCCAGGGACGTCCCCACCCTCGG + Intronic
948314662 2:237018167-237018189 GCCACGGATGTTCCCACTGTTGG - Intergenic
1170383971 20:15795800-15795822 CCAACGGATGTTCCCACAGTCGG - Intronic
1175413307 20:58785477-58785499 TCCAGGGAAATGCCCACACTGGG - Intergenic
1175894606 20:62330577-62330599 ACCACCCATGTGCCCACGCTGGG - Exonic
1176264191 20:64200158-64200180 GACACGGATGTGCCTACACCTGG + Intronic
1179997236 21:44979661-44979683 GCCACGGATAACCCCACACTTGG - Intergenic
1180057517 21:45366659-45366681 TCCAGGGAGGTGCTCCCACTGGG + Intergenic
1182549486 22:31093248-31093270 TCCACGGAGGAGCCCAGAATAGG + Intronic
1184255981 22:43287215-43287237 TCCTCCTCTGTGCCCACACTGGG - Intronic
949684365 3:6551282-6551304 TCCACTAATGAGGCCACACTGGG - Intergenic
950335381 3:12188876-12188898 TCCAAGGATCTGCCCTCACGCGG - Intronic
950550398 3:13662645-13662667 CCCACGGCTGTGCCCACGCTAGG + Intergenic
953610307 3:44442460-44442482 TCCACGCACTTACCCACACTTGG + Exonic
957351807 3:79033235-79033257 TCCACAAATGTGCCAACAATTGG - Intronic
966567978 3:181404238-181404260 TCCACGAATGTGCACGTACTGGG - Intergenic
966923809 3:184631518-184631540 TCCCCGGATTTGCCCAATCTGGG - Intronic
967389691 3:188943372-188943394 TCCCCGGATGTGTCCTCTCTCGG - Intergenic
982649561 4:158070282-158070304 TCCAAGGATGTGAAGACACTGGG + Intergenic
990440812 5:55843073-55843095 TGCATGCATGTGCCCACACATGG + Intergenic
997459269 5:134041354-134041376 TCCATGGATGTGCCCCTCCTGGG - Intergenic
998282534 5:140825563-140825585 TACAGGCATGTGCCCACACCTGG + Intronic
998641624 5:144018288-144018310 TCCAGGCATCTGCCCACTCTGGG + Intergenic
1005854253 6:29848577-29848599 TCTGCAGCTGTGCCCACACTTGG - Intergenic
1006345552 6:33478966-33478988 ACCAGTGATGTGCACACACTGGG - Intergenic
1011197617 6:84798319-84798341 TCCACAGATGTGTCCACAGAAGG - Intergenic
1011816954 6:91203129-91203151 TCTACGAATGTGACCACTCTAGG + Intergenic
1019198298 6:170295304-170295326 TGCACAGATGTGTTCACACTCGG + Intronic
1022107935 7:27210199-27210221 TCCAGGGATTTGCCCGCATTAGG + Intergenic
1022840429 7:34158966-34158988 TTCACGGAAGTGCCCACAAGGGG - Intergenic
1032297398 7:130652224-130652246 TCCACAGATGTGGCCTTACTAGG + Intronic
1035124912 7:156601545-156601567 TCCATGAATATGCCCACACTAGG + Intergenic
1038506956 8:28092798-28092820 TCCCCGGATGTGACGACCCTGGG + Intronic
1041089273 8:54287147-54287169 TCCATGGATGTGACCTCTCTAGG + Intergenic
1041784878 8:61620874-61620896 TCCACAGATCTTCCCACTCTTGG + Intronic
1043087231 8:75849727-75849749 TACGCGGGTGTGCACACACTCGG - Intergenic
1053476994 9:38389576-38389598 TCCAGGGATGTGTTTACACTGGG - Intergenic
1060207589 9:121691309-121691331 TCCCCGGATGTCCCCACACTAGG - Intronic
1061869988 9:133515399-133515421 ACCAGGGCTGTGCCCACGCTGGG - Intronic
1192386401 X:70675946-70675968 TCCACGGATTTGACTACTCTAGG + Intronic