ID: 900391113

View in Genome Browser
Species Human (GRCh38)
Location 1:2434361-2434383
Sequence CCGTGGGGCCCCTTCTCTCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 0, 2: 5, 3: 22, 4: 199}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900391107_900391113 -8 Left 900391107 1:2434346-2434368 CCCCAGCTCCTTGTGCCGTGGGG 0: 1
1: 0
2: 0
3: 13
4: 175
Right 900391113 1:2434361-2434383 CCGTGGGGCCCCTTCTCTCCCGG 0: 1
1: 0
2: 5
3: 22
4: 199
900391110_900391113 -10 Left 900391110 1:2434348-2434370 CCAGCTCCTTGTGCCGTGGGGCC 0: 1
1: 1
2: 0
3: 11
4: 145
Right 900391113 1:2434361-2434383 CCGTGGGGCCCCTTCTCTCCCGG 0: 1
1: 0
2: 5
3: 22
4: 199
900391109_900391113 -9 Left 900391109 1:2434347-2434369 CCCAGCTCCTTGTGCCGTGGGGC 0: 1
1: 0
2: 0
3: 10
4: 135
Right 900391113 1:2434361-2434383 CCGTGGGGCCCCTTCTCTCCCGG 0: 1
1: 0
2: 5
3: 22
4: 199
900391104_900391113 5 Left 900391104 1:2434333-2434355 CCTGGGAAGGTGGCCCCAGCTCC 0: 1
1: 0
2: 6
3: 41
4: 431
Right 900391113 1:2434361-2434383 CCGTGGGGCCCCTTCTCTCCCGG 0: 1
1: 0
2: 5
3: 22
4: 199
900391102_900391113 15 Left 900391102 1:2434323-2434345 CCGTTTACAACCTGGGAAGGTGG 0: 1
1: 0
2: 1
3: 15
4: 153
Right 900391113 1:2434361-2434383 CCGTGGGGCCCCTTCTCTCCCGG 0: 1
1: 0
2: 5
3: 22
4: 199
900391098_900391113 24 Left 900391098 1:2434314-2434336 CCTTCACAGCCGTTTACAACCTG 0: 1
1: 0
2: 0
3: 10
4: 112
Right 900391113 1:2434361-2434383 CCGTGGGGCCCCTTCTCTCCCGG 0: 1
1: 0
2: 5
3: 22
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900391113 Original CRISPR CCGTGGGGCCCCTTCTCTCC CGG Intronic
900161562 1:1226570-1226592 GCGTAGGGCCCCGTCCCTCCAGG - Intronic
900205686 1:1431101-1431123 ACGTGGGGCCTCTTCTGTCCTGG - Intergenic
900391113 1:2434361-2434383 CCGTGGGGCCCCTTCTCTCCCGG + Intronic
900791812 1:4685731-4685753 CCATGGGGGACCTTCTTTCCAGG + Intronic
902580867 1:17406639-17406661 CCCTGGGGCCACATGTCTCCTGG + Intergenic
903005093 1:20293173-20293195 CCCTGTGGCCCCTACTCACCTGG + Intronic
903322246 1:22550205-22550227 CCGTGGGGCCGCTGCTTTCACGG - Intergenic
906146438 1:43563496-43563518 TCCTGGGGCTCCTTCTGTCCTGG - Intronic
912956091 1:114154839-114154861 CGGTGGGGCCCCTTCTGTGTGGG + Intergenic
913680320 1:121184050-121184072 CCGTCCCGCCCCTTTTCTCCCGG + Exonic
914032155 1:143971701-143971723 CCGTCCCGCCCCTTTTCTCCCGG + Exonic
914157290 1:145096266-145096288 CCGTCCCGCCCCTTTTCTCCCGG - Exonic
915165313 1:153945153-153945175 CCTTGGGGCTCCTACTCCCCGGG - Intronic
915416265 1:155745607-155745629 CCGTGGAGCCCCGCCTCTCGCGG + Intergenic
916106898 1:161439776-161439798 CTGAGGGGCCACTTCTCTCTCGG - Intergenic
920467632 1:206202585-206202607 CCGTCCCGCCCCTTTTCTCCCGG + Exonic
921968199 1:221116148-221116170 CTGTAGGGCCCCTTCCTTCCTGG + Intergenic
922098483 1:222462439-222462461 CCGTGGGATGCCTTCCCTCCTGG + Intergenic
922619924 1:226983126-226983148 CCGCAGGGCACCCTCTCTCCTGG + Intronic
1068762884 10:60732985-60733007 CCTCGGGCCCCCCTCTCTCCTGG + Intronic
1069822199 10:71235017-71235039 CAGGGGGGCCCCTCCTCCCCCGG + Intronic
1071371104 10:84952530-84952552 TCATGAGTCCCCTTCTCTCCAGG - Intergenic
1071520912 10:86331024-86331046 CCCTGGTGGCCCTTCTCTCATGG - Intronic
1072630295 10:97140727-97140749 CCGAGGAGCCCGTTCTCCCCTGG - Intronic
1072631208 10:97147820-97147842 CTGTGGGGCCCCTGCTCACAGGG + Intronic
1075814382 10:125253639-125253661 AGGTGTGGCCCCTTCTCTCTCGG + Intergenic
1076348062 10:129794264-129794286 CTGTGTGGCCCCTTCGGTCCTGG - Intergenic
1076379844 10:130017440-130017462 CCGTGGTGCCCATTCTGTGCCGG + Intergenic
1076380094 10:130019079-130019101 CAGTGGGGCCCCCACTCACCTGG + Intergenic
1076751675 10:132546535-132546557 CCGTGCTCCCCCTTCTCTCTTGG + Intronic
1076979624 11:197610-197632 CCGTGGGGCCCCCATGCTCCTGG + Exonic
1077100423 11:819973-819995 CCGCGGGGCCCCTCCGCTCACGG - Intronic
1077106507 11:844649-844671 GGGTGGGGGCCCCTCTCTCCTGG + Intronic
1077370678 11:2180310-2180332 CCGGGTGGCCCCCTCTCTCGAGG + Intergenic
1077464239 11:2726040-2726062 GCCTGGGGCCCCTTCTCTGCCGG - Intronic
1077508663 11:2943860-2943882 CCGTGGGCTGCCTTCTCTCTGGG - Intergenic
1078581624 11:12543447-12543469 CCTTGAGGCCTCTTCTGTCCTGG - Intergenic
1081522804 11:43899159-43899181 CCTAGGGGCCCCACCTCTCCAGG + Intronic
1081668513 11:44930455-44930477 CCCTGAGCCCTCTTCTCTCCAGG + Exonic
1083615224 11:64022786-64022808 CAGTGAGGCCCCTGCTCCCCTGG - Intronic
1083795558 11:65014580-65014602 GCGTGGGGCCGCTGCCCTCCCGG + Intronic
1084683641 11:70681218-70681240 GCGTGGGGTCCCTTTTCTCTTGG + Intronic
1089583192 11:119494408-119494430 CTGTGCTGCCCCTGCTCTCCAGG + Intergenic
1094843590 12:34351942-34351964 CCGTGGGGCCCAGTCACTCCGGG + Intergenic
1097007015 12:55927040-55927062 GCGCGGAGCCGCTTCTCTCCGGG - Intronic
1102199652 12:111048542-111048564 GCAAGGGGCGCCTTCTCTCCTGG + Intronic
1103961345 12:124610968-124610990 TGTTGGGGCCCCTGCTCTCCAGG + Intergenic
1104405275 12:128511656-128511678 CCTTGGGGTCCTGTCTCTCCTGG + Intronic
1104594558 12:130112327-130112349 CCGGGAGGGCCCGTCTCTCCAGG - Intergenic
1104604914 12:130180763-130180785 CCATGGGGCCCCCACTCTCCTGG + Intergenic
1104781037 12:131420678-131420700 CAGTGGGGCCCATGCACTCCAGG - Intergenic
1106132615 13:26952479-26952501 CCATCTGGCCCCTTCTCTCCAGG - Intergenic
1108020920 13:46127040-46127062 CCGGGGGGGCCCATCTCTTCTGG - Exonic
1113464467 13:110503954-110503976 CCCTGGGGCCCCATCTCCCCCGG - Exonic
1119877998 14:78076797-78076819 GCCCGGGGCCCCCTCTCTCCAGG + Intergenic
1121440377 14:93945093-93945115 CAGTGGGGCTCCTTCTCTCCTGG + Intronic
1122959240 14:105087085-105087107 GCTCGGGGCCGCTTCTCTCCTGG + Intergenic
1125675241 15:41498703-41498725 GCCTGGGGGCCCTTCTCTACTGG - Intronic
1128835633 15:70807193-70807215 CCCAGGGGCCTCTTCTCTACAGG + Intergenic
1132829334 16:1919734-1919756 CCGTGTGGCCCCCTCTGGCCAGG - Intergenic
1133824047 16:9261285-9261307 TGGTGGGGCCCAGTCTCTCCAGG + Intergenic
1134827837 16:17298654-17298676 CAGTGGAGCCCCTTCCCTGCCGG - Intronic
1136497264 16:30651883-30651905 CCCGGGGGCCCCTTCTCCCCTGG + Exonic
1137247374 16:46716899-46716921 CCTGGGTGCCCCCTCTCTCCAGG - Intronic
1137617026 16:49854744-49854766 CCCCGGGGCCTCTACTCTCCAGG + Intronic
1137675600 16:50302280-50302302 CCGGGGGGCTCCTCCTCTCCAGG + Intronic
1139526167 16:67518206-67518228 GCGTGGGGCACCGTCTCTCCAGG - Intergenic
1139634859 16:68252244-68252266 CCTGGAGGCCCATTCTCTCCAGG - Intronic
1141538655 16:84700489-84700511 CTCTGGGGCCCCTGCGCTCCAGG - Intronic
1141631796 16:85291783-85291805 CCGTGGGGCCCATAACCTCCTGG + Intergenic
1141755022 16:85985152-85985174 CAGTGAGGCCCCGTCTCCCCAGG - Intergenic
1142031509 16:87840757-87840779 CCCTGCGGCCCCTTTCCTCCAGG - Intronic
1142114404 16:88348756-88348778 CCCTGGGACCCCAACTCTCCAGG + Intergenic
1142233507 16:88910793-88910815 ACGTGGGGCCCCTTCTTGGCAGG + Intronic
1142985098 17:3690684-3690706 TCCAGGTGCCCCTTCTCTCCTGG - Intronic
1144141041 17:12348256-12348278 CTGAGAGCCCCCTTCTCTCCAGG + Intergenic
1144960505 17:19041738-19041760 CCATGGGACCCCCTCACTCCTGG - Intronic
1144974655 17:19132786-19132808 CCATGGGACCCCCTCACTCCTGG + Intronic
1146054828 17:29575811-29575833 CCGTGTGGCGGCTTCCCTCCTGG + Exonic
1147648769 17:42050344-42050366 CAGGGGAGCCCCTTCTCACCAGG - Intronic
1148913174 17:50954224-50954246 CCTCGGGGTCCCATCTCTCCAGG - Intergenic
1149865311 17:60148314-60148336 CCCAGGGCCCCCCTCTCTCCTGG + Intergenic
1151586465 17:75011873-75011895 CCGAGGGACCCCCTCTCTCCTGG + Intergenic
1151994217 17:77598344-77598366 CCGTGGGTCCCCACCTCTCCTGG - Intergenic
1152181162 17:78822631-78822653 CTCTGGGGCCTCTTCTCACCCGG + Intronic
1152403162 17:80081854-80081876 CCCTGTGGCTCCTTGTCTCCAGG + Exonic
1152627136 17:81393069-81393091 CCGTGGGGCCCAGTCTCTCCTGG - Intergenic
1152739941 17:82014442-82014464 CCGTGGTGCCTTCTCTCTCCCGG + Intronic
1155237609 18:23836689-23836711 CCCTGGGGCCCTTTCTCTCGAGG + Intronic
1160682198 19:416994-417016 CCTTGGGTCCCCCTCTCGCCTGG - Exonic
1161038430 19:2097763-2097785 CCTGGGGACCCCTTCCCTCCGGG + Intronic
1161327850 19:3672025-3672047 CCGCTGGGGCCCCTCTCTCCTGG + Intronic
1161723328 19:5915386-5915408 TCCCTGGGCCCCTTCTCTCCTGG + Exonic
1161828739 19:6587689-6587711 CCGTTGGCCCTCTTCTCTCTAGG + Intronic
1163020973 19:14480567-14480589 CCGGGGTGCCCCGTCTCCCCAGG + Intronic
1163884523 19:19954106-19954128 CTGTGGGGCCCCAGCTTTCCAGG + Intergenic
1163915035 19:20233777-20233799 CTGTGGGGCCCCAGCTTTCCAGG + Intergenic
1163939857 19:20481546-20481568 CTGTGGGGCCCCAGCTTTCCAGG - Intergenic
1163948539 19:20563201-20563223 CTGTGGGGCCCCAGCTTTCCAGG + Intronic
1164095519 19:22006540-22006562 CTGTGGGGCCCCAGCTTTCCAGG + Intronic
1164114988 19:22211225-22211247 CTGTGGGGCCCCAGCTTTCCAGG + Intergenic
1164576291 19:29407226-29407248 CTGTGTGGCCCCTTCCATCCTGG + Intergenic
1165363673 19:35351462-35351484 CCCAGGAGCCCCTCCTCTCCGGG + Intergenic
1165811788 19:38616207-38616229 CTGTGGGGCTGGTTCTCTCCAGG - Exonic
1166333217 19:42090533-42090555 CCATGTGTCCCCTTCTCCCCTGG - Exonic
1167035672 19:46993846-46993868 CCATAGGCCACCTTCTCTCCCGG + Intronic
1167072125 19:47227570-47227592 CCGTGGAGCCCCATCCCTGCCGG - Intronic
1167775229 19:51550231-51550253 TCCTGGGGACCCTTCTCTACTGG + Intergenic
1167890528 19:52536106-52536128 CCGTGGGGACCCCACTTTCCAGG - Intronic
932075319 2:68656908-68656930 CTGTGTGTCCCCTTCTTTCCTGG - Intergenic
932433416 2:71688830-71688852 CTGTTGGGCCACTTCCCTCCAGG - Intergenic
932740264 2:74285754-74285776 TCGTGGGGCCCCGCCTCACCTGG + Exonic
937100131 2:119262123-119262145 CCGTGAGTCCCCTTCGCTACTGG + Intronic
937356346 2:121200329-121200351 CCGTGGGGACCCTGCTGTGCAGG + Intergenic
937886629 2:126903750-126903772 CCAGGGCACCCCTTCTCTCCAGG - Intergenic
939606928 2:144264889-144264911 CCATTGCGCTCCTTCTCTCCTGG - Intronic
942279143 2:174343391-174343413 CCGTGGGGACACGTCCCTCCAGG + Intergenic
943763066 2:191631052-191631074 CCGTGAGGTCCCTGCACTCCAGG - Intergenic
948271926 2:236680965-236680987 CCGATGGGCCCCATCACTCCTGG - Intergenic
948429602 2:237911359-237911381 CCATCGGGCCCCTGCCCTCCTGG + Intronic
948449494 2:238060575-238060597 CCGCGCGGCCCCGGCTCTCCCGG + Intronic
948456486 2:238106838-238106860 CCGTGGGGCTCCTTCGCATCTGG - Intronic
1168805565 20:670458-670480 CCGAGGGACCCCATCTCTCCCGG + Intronic
1169912684 20:10660157-10660179 CCCAGGAGTCCCTTCTCTCCTGG - Intronic
1172714266 20:36951354-36951376 TCGTGGGGCCCCCTCCCTCAGGG + Intronic
1172841241 20:37903630-37903652 CCGGGTGCCCCCTTCTCTGCAGG - Intronic
1172876338 20:38166530-38166552 CCGTGGGCCTCTGTCTCTCCGGG - Intronic
1172939342 20:38643953-38643975 CCGTGCCGCCCCTGCTCTCCAGG + Intronic
1173947172 20:46960850-46960872 CTGTGGGGCCCCTTCCCTGCTGG + Intronic
1174142052 20:48422061-48422083 CTGTAGGGTCCCTGCTCTCCTGG + Intergenic
1175880791 20:62257623-62257645 CCTTGAGGTCCCTCCTCTCCTGG + Intronic
1176000390 20:62828947-62828969 CCGTTGGGGCCCTTCTCTCCCGG - Exonic
1176030288 20:63008301-63008323 CCTCGGGGCCCCTGCGCTCCTGG - Intergenic
1176159940 20:63642758-63642780 CCCTGGGGACCCTCCGCTCCTGG - Intronic
1176218243 20:63958188-63958210 CAGTGGGGCCCCTTCTCCCTGGG + Exonic
1176375869 21:6086655-6086677 CCTTGGGGCTCCTGCTCTCGGGG + Intergenic
1176413544 21:6461734-6461756 CCCTGGAGCCCCTTATCTCAAGG + Intergenic
1179369644 21:40792715-40792737 ATGTGGGTCCCCTCCTCTCCAGG - Intronic
1179505020 21:41834528-41834550 CCGCCGGGCCCCCCCTCTCCAGG + Intronic
1179609946 21:42543754-42543776 CCGGGGAGCCGGTTCTCTCCTGG + Intronic
1179689041 21:43070057-43070079 CCCTGGAGCCCCTTATCTCAAGG + Intronic
1179747605 21:43451589-43451611 CCTTGGGGCTCCTGCTCTCGGGG - Intergenic
1180159347 21:45992170-45992192 CCGGGGGGCCCAGGCTCTCCCGG - Exonic
1180333619 22:11555828-11555850 CCGTGGGGCCTCTTATCAGCTGG + Intergenic
1181115750 22:20631816-20631838 CCCTGGAGCCCCTTCACCCCTGG + Intergenic
1182301288 22:29338704-29338726 CCGTGGTCTCCCTTCCCTCCAGG + Intronic
1183546198 22:38455785-38455807 CCGTGCGGCCCCCTCTGTCTCGG + Intergenic
1184089181 22:42283508-42283530 CCCTCGGGCCCCTCCTCTCCCGG + Intronic
1184398692 22:44260972-44260994 CAGTGGCACCCCTTCCCTCCCGG - Intronic
1184554877 22:45227715-45227737 CAGTGGGGCCCGTTCTCTCCCGG - Intronic
951476657 3:23113563-23113585 CCATGGCTCCCCTTCTCCCCCGG + Intergenic
951476927 3:23117072-23117094 CCCTGGGACCCCTTACCTCCTGG - Intergenic
952826704 3:37530501-37530523 CCCTGGGGCCACCTATCTCCAGG - Intronic
954849317 3:53587033-53587055 CCGTGGGGCCCCATCTCAGTGGG + Intronic
956459166 3:69454368-69454390 CCGTGGGAGCCCCTCTCTCTGGG + Intronic
956939140 3:74136614-74136636 GCCTGAGGCCCCTTCTATCCTGG + Intergenic
968615534 4:1575932-1575954 CCCTGGGGCCACTTCACCCCGGG - Intergenic
968662394 4:1804129-1804151 CTGCTGGGCTCCTTCTCTCCAGG + Intronic
968844586 4:3033305-3033327 CCCTGGGGCCCCTTTTCTAATGG + Intronic
969289324 4:6228544-6228566 CAATGGGGCCCCTGCTGTCCTGG + Intergenic
971225589 4:24748717-24748739 ACATGGGGTCCCTTCTCTTCCGG - Intergenic
972237472 4:37150683-37150705 CAGTGGGTTCCCTTCTCGCCTGG + Intergenic
973176272 4:47209903-47209925 CTGTTGTGCCCCTTCCCTCCTGG + Intronic
977970795 4:103211610-103211632 CTCTGGGGACCCTTCACTCCAGG - Intergenic
979349550 4:119628501-119628523 CCGTGGGTCCTCTTCTTACCTGG + Exonic
981348253 4:143699968-143699990 CGGTGGGGGCCCCTCTCCCCAGG - Exonic
983519351 4:168690659-168690681 CCGTGGGGCACCCCCTCTGCAGG + Exonic
985064256 4:186105345-186105367 CAGTGGGGACCCTGCTCTCTTGG + Intronic
985634357 5:1028613-1028635 CCGTGGGGTCCCTGCTGACCTGG + Intronic
985908870 5:2863802-2863824 CGGTGGGACCCCAGCTCTCCTGG - Intergenic
992646416 5:78815905-78815927 TCCTGGGGCCCCTTCTTTCTTGG + Intronic
997211555 5:132079906-132079928 CTGTGGGCCCCCTCCTCCCCAGG - Intergenic
999663348 5:153888497-153888519 CCGTTGGGCCCCACATCTCCTGG - Intergenic
999772845 5:154788405-154788427 CTGTGAGGCCACTGCTCTCCTGG - Intronic
1000350597 5:160349637-160349659 CCCTTGGGCCCCTTCTTGCCTGG + Exonic
1001963655 5:175895325-175895347 CCCTGGGACCCCTTTTCTGCTGG - Intergenic
1002523475 5:179803753-179803775 CCGTGGGGCCCTTTATCTCCTGG - Intronic
1002867043 6:1130793-1130815 GCAAAGGGCCCCTTCTCTCCAGG - Intergenic
1004312171 6:14555291-14555313 CCTGGGGGCCTCCTCTCTCCAGG + Intergenic
1004662360 6:17721641-17721663 CCATGTGGCCCCTTCAATCCAGG + Intergenic
1005559174 6:27020219-27020241 TCCTGGGGCCGCTTCTCCCCCGG - Intergenic
1007351862 6:41279295-41279317 GCGTGGGGCCACTTCTACCCTGG + Intronic
1007397500 6:41586048-41586070 CCCTGGAGGCCCTTCTCCCCTGG + Intronic
1007737096 6:43988365-43988387 CAGGGGAGCCCCTTATCTCCTGG - Intergenic
1016871327 6:148819985-148820007 CCATGGGGGCCTCTCTCTCCGGG + Intronic
1017138325 6:151167687-151167709 CCGTGGGCACCACTCTCTCCCGG - Intergenic
1018940743 6:168307828-168307850 CAGTGGGCCACCTGCTCTCCTGG + Exonic
1019444831 7:1065977-1065999 CGGCGGGGCCCCTGCTCTCCTGG - Intronic
1019600602 7:1881798-1881820 CCATGGTGCCCCCTCACTCCAGG + Intronic
1025155961 7:56606109-56606131 CCCTGGCCCCCCTTCTTTCCTGG + Intergenic
1025928880 7:65979813-65979835 AGGTGGGGCCCCTGCCCTCCCGG - Exonic
1026735542 7:72946378-72946400 CCCTGGGGCCCTTTCCCTTCTGG + Intronic
1026785880 7:73301308-73301330 CCCTGGGGCCCTTTCCCTTCTGG + Intergenic
1027108184 7:75418630-75418652 CCCTGGGGCCCTTTCCCTTCTGG - Exonic
1029597453 7:101545370-101545392 CCGGGGCGCCCCATCTCTCCAGG - Exonic
1033573449 7:142656757-142656779 CTGTGGGGCCTTTTATCTCCTGG + Intergenic
1034415049 7:150959845-150959867 CCGTATGGCCCTTCCTCTCCGGG + Intronic
1035079212 7:156202333-156202355 CCTTGGGGCCATCTCTCTCCTGG - Intergenic
1035260563 7:157659209-157659231 CCCTGCGGCCCCCACTCTCCAGG + Intronic
1040474585 8:47764789-47764811 CCGTGTGCCCCCTCCTCTGCGGG - Intergenic
1040758494 8:50809143-50809165 TCTTGGGACCCCTTCCCTCCAGG - Intergenic
1041713769 8:60915207-60915229 CCTTGGGCCTCCTTCTCTCCTGG + Intergenic
1044604905 8:94039932-94039954 CCGCGGGCCCTCTCCTCTCCTGG - Intergenic
1045991550 8:108314493-108314515 CCCTGGGCCCACTACTCTCCAGG - Intronic
1049335336 8:142081565-142081587 CCGTGGTGCCCATTCTCTGATGG - Intergenic
1049393243 8:142382740-142382762 CTACCGGGCCCCTTCTCTCCTGG - Intronic
1049411480 8:142475712-142475734 CCCACGGGCCCCTCCTCTCCAGG - Intronic
1049531987 8:143159563-143159585 CCGCGGGCCCCCTACTCACCGGG + Exonic
1049604731 8:143524048-143524070 CCAGGTGGCCCCGTCTCTCCCGG + Intronic
1050560930 9:6834000-6834022 CCATGAGGCCACTTCTGTCCTGG - Intronic
1051513521 9:17906007-17906029 TCGTGGGTCCCCGTCACTCCCGG + Intergenic
1053428975 9:38029261-38029283 CTATGGGGCCATTTCTCTCCAGG + Intronic
1056715378 9:89024207-89024229 CCTTGAAGCCCTTTCTCTCCTGG + Intronic
1058432013 9:104928092-104928114 CCGAGCCGACCCTTCTCTCCCGG - Exonic
1060401983 9:123354729-123354751 CCTTGAGGCCTGTTCTCTCCAGG - Intergenic
1060435044 9:123586017-123586039 CCTTGGGGCCCCTTCTTGCTTGG + Intronic
1060936985 9:127521697-127521719 CCGGGTGGCCCCTTCTCCCCAGG - Intronic
1061188849 9:129070418-129070440 CCCAGGGGCCCATTCTCTCGGGG - Exonic
1061503205 9:131015399-131015421 CCCTGTGGCCCCTTGTCCCCGGG + Intronic
1062681909 9:137786726-137786748 CCGTGTGGCCTCATCTCTCCCGG + Intronic
1186452859 X:9687837-9687859 CCGTGGGATCCCTTCACCCCAGG + Intronic
1188832750 X:34920311-34920333 CCCTGGGATACCTTCTCTCCAGG + Intergenic
1189006513 X:37000259-37000281 CTGGGGGGCCCCTTCCCACCTGG - Intergenic
1190376794 X:49796191-49796213 CCTTGGGGGCCTTTCTCTCAGGG + Intergenic
1196255374 X:113511954-113511976 CCGTGGGGCCCCTTTTATAAGGG - Intergenic
1198260470 X:134960565-134960587 CAGAGGGGCCCCTTGCCTCCCGG - Intergenic
1199643210 X:149882579-149882601 TTGTGGGGTCCCTTCTTTCCAGG - Intronic