ID: 900391807

View in Genome Browser
Species Human (GRCh38)
Location 1:2436916-2436938
Sequence CACCCAGCTGAGGCCTCCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 353
Summary {0: 1, 1: 1, 2: 3, 3: 40, 4: 308}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900391799_900391807 5 Left 900391799 1:2436888-2436910 CCCATCTGGTTAGAGTGTCCCAA 0: 1
1: 0
2: 0
3: 7
4: 61
Right 900391807 1:2436916-2436938 CACCCAGCTGAGGCCTCCTGGGG 0: 1
1: 1
2: 3
3: 40
4: 308
900391800_900391807 4 Left 900391800 1:2436889-2436911 CCATCTGGTTAGAGTGTCCCAAG 0: 1
1: 0
2: 0
3: 15
4: 98
Right 900391807 1:2436916-2436938 CACCCAGCTGAGGCCTCCTGGGG 0: 1
1: 1
2: 3
3: 40
4: 308

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900391807 Original CRISPR CACCCAGCTGAGGCCTCCTG GGG Intronic
900291695 1:1926423-1926445 CACCCAGCTCAGGCGGCCTGCGG - Intronic
900357631 1:2272407-2272429 CCCCCAGCGGAGGGCTCCTGTGG - Intronic
900391807 1:2436916-2436938 CACCCAGCTGAGGCCTCCTGGGG + Intronic
900548237 1:3240700-3240722 CAGCAAGCTGAGCCCCCCTGGGG + Intronic
901497211 1:9629064-9629086 CACCCCAGTGAGGCCACCTGAGG + Intergenic
903017273 1:20369153-20369175 CACCCAGCTGGGGCCTAAGGTGG - Intergenic
903646178 1:24897619-24897641 CTCCCAGAAGTGGCCTCCTGTGG - Intergenic
903648494 1:24909129-24909151 CACCCTCCTGCGGCCTGCTGAGG + Intronic
905548866 1:38819993-38820015 CACTCAGCTTAGGCCTCCGCGGG - Intergenic
906478143 1:46183668-46183690 CACCCACCTGAGGCCCCATTTGG - Intronic
907248694 1:53123641-53123663 CATCCAGCTGTGCCCTCCTCTGG - Intronic
907323324 1:53619272-53619294 CACCAGGCTGAGGGCTCCTGAGG - Intronic
907351851 1:53838338-53838360 GACCCAGCAGGGTCCTCCTGGGG - Exonic
907595838 1:55719092-55719114 CACCCTTCTGAGGTCTCATGTGG + Intergenic
908254809 1:62294461-62294483 CACCCAGCTGATGCCTGCAGAGG - Intronic
908527392 1:65001330-65001352 CCGCCAGCAGAGGCCTCCTGCGG + Intergenic
908831660 1:68185088-68185110 CACCCAGCTGATGTCTGCTGTGG - Intronic
913959504 1:143327762-143327784 CACCCAGGTCAGGGCTCCAGGGG + Intergenic
914053863 1:144153335-144153357 CACCCAGGTCAGGGCTCCAGGGG + Intergenic
914125283 1:144813030-144813052 CACCCAGGTCAGGGCTCCAGGGG - Intergenic
915006338 1:152640608-152640630 CCTTCAGCTGTGGCCTCCTGTGG + Intergenic
916174123 1:162023724-162023746 CAGCCACCTGAGCCCTCCTGCGG - Exonic
917665889 1:177225094-177225116 TACCCAGCTGAGGACTTCTTGGG - Intronic
917972545 1:180218180-180218202 CAGCCAGCTGGGCCCTCCTCTGG - Intergenic
918041558 1:180916901-180916923 CACCCAGCAGGGCCGTCCTGGGG - Exonic
918313902 1:183306804-183306826 CACCCAGCTGGTGACACCTGGGG - Intronic
920066425 1:203272916-203272938 CACCCAGGTGCGGACTCCTGCGG + Intronic
920215579 1:204359758-204359780 CCCCCAGCTCAGGCCAGCTGGGG + Exonic
920403096 1:205689462-205689484 CACCCAGCTGATGCGGCCTCAGG - Intergenic
920835323 1:209505624-209505646 AGCCCAGCTGAGGCCTCCACTGG - Intergenic
923180030 1:231508774-231508796 CACCAGGCTGAGGCCTCCGCTGG - Intergenic
923746098 1:236701500-236701522 AGCCCGGCTGAGTCCTCCTGCGG + Intronic
1062840625 10:667323-667345 GACCTGGCTGAGGCCTCCTGGGG + Intronic
1063291369 10:4753422-4753444 AAACCAGCTCAGGCCACCTGGGG + Intergenic
1063939339 10:11110758-11110780 CCCCCGGATGAGGCCTCCCGTGG - Intronic
1065554945 10:26905825-26905847 CCCCGAGCTGTGGGCTCCTGTGG + Intergenic
1065915802 10:30354162-30354184 CACTCAGCTCAGGGCCCCTGGGG - Intronic
1067008686 10:42690520-42690542 CAGCCAGCTGTGGCCACCTGTGG - Intergenic
1067238287 10:44469762-44469784 CACCCGGCTGAGGTCTTCTCTGG - Intergenic
1067279605 10:44861284-44861306 AACCCTGCTCAGGGCTCCTGTGG + Intergenic
1067539992 10:47144200-47144222 AACCCAGCTGAAGGCCCCTGGGG - Intergenic
1067775563 10:49162699-49162721 CACCCAGCAGAGGGCCCCTGAGG + Intronic
1068008838 10:51422326-51422348 CACCTAGCTGTGGCATCCTATGG - Intronic
1069959295 10:72070222-72070244 GACCCAGCTGGGGCCTCCGGAGG - Intronic
1070575152 10:77672039-77672061 GACCCAGCACTGGCCTCCTGCGG - Intergenic
1070687959 10:78503806-78503828 CACCCAGCAGAAGTCTCCAGAGG + Intergenic
1074032356 10:109701571-109701593 CACCCACCTGTGGCCTGGTGGGG + Intergenic
1074534558 10:114319602-114319624 CACCCATCTGGGGACTCCAGTGG + Intronic
1075949928 10:126468421-126468443 CAACCTGCTGAAGCCTCCTCTGG - Intronic
1076653130 10:132003731-132003753 CAGCCAGCTGAGGGTGCCTGGGG - Intergenic
1076837355 10:133027894-133027916 AGCCCAGATGTGGCCTCCTGGGG + Intergenic
1076866625 10:133169565-133169587 CCCGCAGCAGAGGCCTCCTGGGG - Intronic
1080503050 11:32888290-32888312 CCCCCTGCTGTGGGCTCCTGTGG - Intergenic
1081390634 11:42524748-42524770 CGTCCAGCTGTGGCCTGCTGAGG - Intergenic
1081742266 11:45448944-45448966 CACACAGCTGAGGCCCACTCTGG + Intergenic
1081802753 11:45870950-45870972 CAACCTCCTGTGGCCTCCTGTGG + Intronic
1082767646 11:57181774-57181796 CACCCAGTTGAGGTCCCCTAGGG - Exonic
1082987120 11:59178704-59178726 TACACAGCTCAGGCTTCCTGAGG + Intronic
1083245976 11:61428891-61428913 CACCCACCTTTGGCTTCCTGGGG + Intronic
1083475552 11:62912803-62912825 CCCTCAGCTGTGGCCTCCAGGGG + Intronic
1083729481 11:64645039-64645061 CACCCAGAGGAGGCTTCCGGTGG + Intronic
1083860070 11:65415625-65415647 CCCACAGCTGAGGCTTCATGTGG + Intergenic
1084318295 11:68358564-68358586 ATCCCAGCTCAGGCATCCTGAGG + Intronic
1084544642 11:69808760-69808782 CACGCAGCTGAGCTCTGCTGTGG - Intergenic
1085781404 11:79412301-79412323 CACCCAGCTGGGCCATCATGAGG - Intronic
1088243843 11:107797625-107797647 CATCCAGCTGTGGGCTCCTTGGG + Intronic
1089784547 11:120898659-120898681 CTCCCAGCTGCAGCATCCTGGGG + Intronic
1091055485 11:132414438-132414460 CATTCAGCTGAGGCTTCTTGTGG - Intergenic
1091213657 11:133886047-133886069 CACCCAGCTGATGCCTGAGGTGG - Intergenic
1091930017 12:4388631-4388653 TCCCCAGCTGAGGGCACCTGAGG - Intergenic
1092979950 12:13784640-13784662 TTCCCAGCTTAGGCCTCCAGAGG + Intronic
1095465372 12:42483563-42483585 CACCCTGCTGGGGTCTCCTCCGG - Intronic
1096264503 12:50112258-50112280 CATCCAACCGAGGCCTCCTCAGG - Exonic
1096707484 12:53431377-53431399 CACTCCGCTGAGGCCTACAGGGG - Exonic
1097921325 12:65077739-65077761 CACCCACCTGATGCCTTGTGAGG + Exonic
1098146963 12:67507289-67507311 GATACAGTTGAGGCCTCCTGCGG + Intergenic
1100739514 12:97575821-97575843 CACCTAGCTGAAGCCTCCCGTGG - Intergenic
1100855062 12:98750831-98750853 CCCGCAGCTGAGGCTTCCTGCGG - Intronic
1102427454 12:112855419-112855441 AGCCCAGCTGAGCCCTCCAGTGG + Intronic
1102513949 12:113434242-113434264 CTCCCAGCTCTGGACTCCTGGGG - Intronic
1103368172 12:120398239-120398261 CACCCAGCCCCCGCCTCCTGAGG + Intergenic
1103910295 12:124348441-124348463 CTCACAGCCGAGGCCTCCAGAGG + Intronic
1103995148 12:124824817-124824839 CACCCACCAGAAGCCTCATGAGG + Intronic
1104905983 12:132213775-132213797 CAGCAAGCTGGGGCCTCCTCAGG - Intronic
1106133458 13:26958136-26958158 CACCCAGCAGAGGGCTCCATGGG + Intergenic
1112262080 13:97886179-97886201 CACCTAGATGAGCCCTCCTTTGG - Intergenic
1112509671 13:99997995-99998017 CACCCAGCCCAGGGCCCCTGTGG + Intergenic
1113961516 13:114128790-114128812 CTCCCCGCTGGGGCTTCCTGTGG - Intronic
1114743248 14:25119566-25119588 CAACCAGCAGAGACCTCGTGTGG - Intergenic
1115801952 14:37004663-37004685 CAGCCTGCTGAGGGCTCCTCTGG + Intronic
1119041257 14:71276704-71276726 GACCCAGGGGAGGCTTCCTGGGG - Intergenic
1119085129 14:71732406-71732428 CACCCAGCTTCTGCCTACTGAGG + Intronic
1119242513 14:73073023-73073045 CTCCCATCTCAGCCCTCCTGAGG + Intronic
1119325599 14:73758371-73758393 CCCTCAGCTGAGGCCCCCTAGGG + Intronic
1121265599 14:92600380-92600402 CACCCCCCTTAGGCATCCTGGGG - Intronic
1122037219 14:98957599-98957621 CACCCACCTGAGACCTCGTGGGG - Intergenic
1122116043 14:99527745-99527767 CACCCAGCTGTGGCTCCCGGTGG - Intronic
1122238085 14:100344326-100344348 CAGCCAGCCTCGGCCTCCTGAGG + Intronic
1122504983 14:102226624-102226646 CACGCAGCTGAAGCGGCCTGGGG + Intronic
1123039219 14:105483557-105483579 CGCCCAGCTCAGGCCTCCCCAGG - Intergenic
1202929050 14_KI270725v1_random:22983-23005 CACCCAGGTCAGGGCTCCAGGGG - Intergenic
1123423310 15:20148513-20148535 CACCCAGGTCAGGGCTCCAGGGG + Intergenic
1123532531 15:21155034-21155056 CACCCAGGTCAGGGCTCCAGGGG + Intergenic
1123739780 15:23225792-23225814 CACCCCGCACCGGCCTCCTGGGG - Intergenic
1124627263 15:31315446-31315468 CTCCCAGCTGAGGCCTCAAATGG - Intergenic
1125547118 15:40513925-40513947 AACTCCGCAGAGGCCTCCTGGGG - Intergenic
1126782507 15:52150681-52150703 AACCCAGCTGTGGCCTCCCATGG + Intronic
1127898815 15:63326139-63326161 CACCCAGCAGAGGATCCCTGAGG + Exonic
1127899378 15:63329866-63329888 CACACGGCTGATGGCTCCTGGGG - Intronic
1128082842 15:64866445-64866467 GACCCAGCTGGAGCCTCTTGAGG + Exonic
1128107378 15:65054868-65054890 CACCGAGCCTAGGCTTCCTGGGG + Exonic
1129266610 15:74396772-74396794 ACTGCAGCTGAGGCCTCCTGAGG + Intergenic
1129869109 15:78929506-78929528 CACACAGGTGAGCCCACCTGGGG + Intronic
1130166179 15:81461342-81461364 CACCCAGCTGAGGCTTCTCTAGG + Intergenic
1132661368 16:1062932-1062954 CGCCCAGGCCAGGCCTCCTGTGG + Intergenic
1132689013 16:1174219-1174241 CACCCGGCTGAAGTCTCCTGTGG + Intronic
1133027721 16:2995904-2995926 CAGCCAGGTGAGGACACCTGGGG + Intergenic
1133130502 16:3673644-3673666 CAGCCAGGTGTGGCCTCCAGGGG - Intronic
1133320184 16:4908980-4909002 CTGCCATCTGAGGCCCCCTGTGG - Intronic
1133597840 16:7310183-7310205 CTCCCAGCAGAGGCGGCCTGCGG - Intronic
1134059664 16:11191465-11191487 CCACCTGCTGAAGCCTCCTGGGG - Intergenic
1134337944 16:13318660-13318682 CTCCCAGCTGAGGACCACTGTGG + Intergenic
1136516523 16:30771958-30771980 CACACACCTGAGCCCTCTTGAGG - Exonic
1136861508 16:33707089-33707111 CACCCAGGTCAGGGCTCCAGGGG - Intergenic
1137392566 16:48093443-48093465 CTCCCAGCAGAGGCCTCCTCTGG + Intronic
1137981186 16:53071515-53071537 CCCTCAGGTGAGCCCTCCTGGGG + Intronic
1138275404 16:55730543-55730565 AACCCAGTTAAGGTCTCCTGAGG - Intergenic
1138454224 16:57112280-57112302 GGGCCAGCTGAGGACTCCTGGGG + Intronic
1139646388 16:68334154-68334176 CACCCAGCTGAGGCATCCTGAGG + Intronic
1139959103 16:70707540-70707562 CACCCAGATGAGACCTTCTATGG - Intronic
1140939358 16:79707134-79707156 AACCCTGCAGAGGCCTGCTGGGG + Intergenic
1141596228 16:85098500-85098522 CACACAGCAGAGCCCACCTGAGG + Exonic
1141748727 16:85944079-85944101 CAACCAGCTGAGTCCCACTGAGG - Intergenic
1203123008 16_KI270728v1_random:1555280-1555302 CACCCAGGTCAGGGCTCCAGGGG - Intergenic
1142849050 17:2695572-2695594 CACCCAACTGAGTCCTTCTGGGG + Intronic
1142899331 17:3002629-3002651 TCCCCAGTGGAGGCCTCCTGGGG - Intronic
1143649526 17:8254969-8254991 CTCCCAGCTGAGGCCTGCCGGGG + Intronic
1143775540 17:9196407-9196429 CTACCAGCTGCCGCCTCCTGTGG + Intronic
1144727663 17:17510002-17510024 CAACCAGCTGAGGCCCCTAGAGG - Intronic
1144852790 17:18252383-18252405 GACCCAGCAGAGGCCTCCTGAGG - Intronic
1145687205 17:26683086-26683108 CACCCAGTTGAGGCCTTCATTGG + Intergenic
1146000313 17:29126719-29126741 GACCCTGCTGAGGCCTCCCAGGG - Intronic
1147265535 17:39232184-39232206 GACCCAGCTGAAGCAGCCTGGGG + Intergenic
1147561532 17:41512438-41512460 CACACAGGTGAGACTTCCTGGGG - Intergenic
1147907043 17:43830191-43830213 CACCCAGCTGCAGCCCCCAGGGG + Intronic
1147911256 17:43857602-43857624 GACCCAGCTGAACCCTCCAGGGG + Intronic
1148906810 17:50917486-50917508 GCCCCAGCTGTGGCCTGCTGTGG - Intergenic
1150230225 17:63545662-63545684 CAGCCAGGTGAGGCATCCTGGGG - Exonic
1150666893 17:67148229-67148251 CACCCAGCTGGTGTCCCCTGCGG + Intronic
1151305574 17:73260965-73260987 CACACAGCTGAGGCCGACTCTGG + Exonic
1151699255 17:75734024-75734046 CACCCAGCTCAGCCCTCCAATGG + Intronic
1151816416 17:76473585-76473607 CCCCGAGCTGCGGCTTCCTGTGG - Intronic
1152241927 17:79165447-79165469 GACCCCGCTGTGCCCTCCTGCGG - Intronic
1152293698 17:79454729-79454751 GACCCACCTTAGGGCTCCTGTGG + Intronic
1152739516 17:82012802-82012824 CACCTCCCTGAGGGCTCCTGAGG + Intronic
1152749073 17:82054307-82054329 CACCCGGCTGTAGGCTCCTGGGG + Intronic
1154310950 18:13265824-13265846 CACACAGCTCAGGCCTCCAGGGG + Intronic
1155404625 18:25474242-25474264 CACCCAAATCAGGCCTTCTGAGG + Intergenic
1158487681 18:57882140-57882162 CACAGAGCTGAGGTCTGCTGGGG - Intergenic
1160332046 18:78002964-78002986 CACCCAGCTCAGGCCCTCAGAGG - Intergenic
1160953451 19:1678816-1678838 ACCACAGCTGAGGGCTCCTGAGG - Intergenic
1161195564 19:2984317-2984339 CTCCAGGCTGATGCCTCCTGGGG - Intronic
1161326277 19:3665742-3665764 CAACAAGCTGAGGCCCCCTGGGG - Intronic
1161509359 19:4662055-4662077 GACCCTCCTGATGCCTCCTGGGG + Intronic
1161586740 19:5109775-5109797 CGCCCTCGTGAGGCCTCCTGAGG + Intronic
1163153214 19:15427017-15427039 CACCCATCTGAGGGTCCCTGGGG - Exonic
1164711102 19:30357746-30357768 CTCCCAGCTGTGGGCGCCTGGGG + Intronic
1164941149 19:32253025-32253047 CCCCCCGCCAAGGCCTCCTGAGG + Intergenic
1165100345 19:33435266-33435288 GTCCCAGCTGAGGCTCCCTGTGG - Intronic
1165432037 19:35778400-35778422 CACCGAGCTGAGGACTACAGTGG - Intronic
1165797307 19:38526562-38526584 CACCCTGCTGATGCCCCCTTTGG + Intronic
1166869728 19:45864148-45864170 CCCCCAGCTGTCGCGTCCTGGGG + Intronic
1167503096 19:49858192-49858214 CAGCCAGCTCAGGCCACCTGGGG - Intronic
1168291439 19:55359531-55359553 GACGCAGCTGGGGCCTTCTGGGG + Exonic
1168515403 19:57006814-57006836 CACCCAGCTGAACCCACCTTTGG + Intergenic
1168706070 19:58470981-58471003 CTCCCCGCTTAGGCCTCCCGAGG + Exonic
1202693339 1_KI270712v1_random:105993-106015 CACCCAGGTCAGGGCTCCAGGGG + Intergenic
925334108 2:3080462-3080484 CACCCCGGTGAGGCCACCTGGGG - Intergenic
926079098 2:9969384-9969406 CATCCAAATGAGGCCTTCTGAGG + Intronic
927133434 2:20079911-20079933 CACCCAGCACAGGCCTCGTCTGG - Intergenic
927574429 2:24189716-24189738 CACCCAGAGGATGCCTCGTGTGG + Intronic
927973672 2:27322151-27322173 TTCCAAGTTGAGGCCTCCTGGGG + Intronic
928172622 2:29013050-29013072 CCACCAGCTGAGGCTGCCTGAGG - Intronic
928820434 2:35355333-35355355 CACACAGCAGAGGCCCCTTGTGG - Intergenic
930024518 2:47021992-47022014 CCCCAAGTAGAGGCCTCCTGGGG - Intronic
930116027 2:47718834-47718856 CACCCAGCTGAGCCCTCCGAAGG - Intronic
930754428 2:54960496-54960518 CACCCAGCTGGTTCTTCCTGGGG - Intronic
931248903 2:60513356-60513378 CACCCGGCAGATGGCTCCTGAGG - Intronic
931648777 2:64450163-64450185 CTGCCATCTGAGGCCTCCTATGG - Intergenic
931676636 2:64702962-64702984 CAACCAACTGAAGCATCCTGAGG + Intronic
931900289 2:66781009-66781031 CATCCAGCTGAGCTCACCTGTGG + Intergenic
932502049 2:72191469-72191491 CAACCAGCTGTGGCATCTTGGGG - Intronic
933953229 2:87348566-87348588 CACCCAGGTCAGGGCTCCAGGGG - Intergenic
934237460 2:90244911-90244933 CACCCAGGTCAGGGCTCCAGGGG - Intergenic
934459887 2:94208217-94208239 CACCCAGGTCAGGGCTCCAGGGG - Intergenic
935131672 2:100265328-100265350 CACCCAGCTGACACTCCCTGTGG - Intergenic
935145708 2:100393818-100393840 CCCTCAGCTGTGACCTCCTGTGG - Intronic
938101577 2:128501279-128501301 CACACAGCCGGGGCCTCCTTGGG - Intergenic
938968803 2:136412521-136412543 CACCCAGCTCAGGACCCCAGAGG + Intergenic
941846795 2:170141695-170141717 CAGCCTGCTGGGGCCGCCTGAGG - Intergenic
943511538 2:188833156-188833178 CAACCAGCTTATGGCTCCTGTGG - Intergenic
943688127 2:190840936-190840958 CATCCAACTGAGGACTGCTGTGG - Intergenic
944916702 2:204368337-204368359 GACCCAGATGAGGCTTCCTTCGG - Intergenic
946194410 2:218024539-218024561 CACTGAGCTGAGGCCATCTGTGG - Intergenic
948854771 2:240724974-240724996 TGCCCACCTGGGGCCTCCTGTGG - Intronic
1168830461 20:842500-842522 TTCCCACCTGAGGTCTCCTGGGG + Intronic
1169065278 20:2691709-2691731 GGCCCAGATGAGGCGTCCTGGGG - Intergenic
1169373024 20:5043196-5043218 ACCCCAGCTGAGGATTCCTGGGG - Intergenic
1169622031 20:7518066-7518088 TACTCAGCTCAGGTCTCCTGGGG - Intergenic
1170421355 20:16196648-16196670 CACCCAGATGAAGCCATCTGTGG - Intergenic
1171257643 20:23703036-23703058 CTCACAGCTGAGTCCTTCTGTGG + Intergenic
1171274740 20:23847100-23847122 CTCACAGCTGAGTCCTTCTGTGG + Intergenic
1171351742 20:24507765-24507787 CAGGCAGCAGGGGCCTCCTGCGG + Intronic
1171412044 20:24953914-24953936 CACCCAGCAGCAGCCTCCAGCGG + Intronic
1172121035 20:32598835-32598857 CAGCCAGCTGAGGGCTCCACAGG + Intronic
1172834458 20:37864049-37864071 CACCCAAGTGAGGGCTCCTCAGG - Intronic
1172916636 20:38448235-38448257 CACACACCTGGGGCCTCCAGGGG + Intergenic
1173177478 20:40775371-40775393 CACCCACCTGAAGCCCCCAGTGG + Intergenic
1173854240 20:46239803-46239825 CACTTAGCTCAGGGCTCCTGGGG - Intronic
1175403032 20:58711323-58711345 CCCTGTGCTGAGGCCTCCTGTGG - Intronic
1175610223 20:60345070-60345092 CACCCAGCTGAAGCCTCCCTGGG + Intergenic
1175900085 20:62356613-62356635 CACCGGGCAGAGGCCTCCTCTGG - Intronic
1176112363 20:63416416-63416438 CAGGCAGATGTGGCCTCCTGAGG + Intronic
1176591069 21:8651571-8651593 CACCCAGGTCAGGGCTCCAGGGG - Intergenic
1178887132 21:36493268-36493290 ACCCCAGCTCAGGACTCCTGTGG - Intronic
1179021335 21:37643630-37643652 CACCCAGATGTGGACACCTGAGG + Intronic
1180273897 22:10628604-10628626 CACCCAGGTCAGGGCTCCAGGGG - Intergenic
1181356319 22:22298282-22298304 CACCCAGGTCAGGGCTCCAGGGG + Intergenic
1181424170 22:22822359-22822381 CACCCAGCAGAGGCTTCCAGTGG + Intronic
1181463669 22:23099429-23099451 CACCCAGCTGGGGCTTCCTCAGG + Intronic
1181775663 22:25158512-25158534 CAGCCAGGAGAGGCTTCCTGGGG + Intronic
1181806947 22:25380626-25380648 ACCCCAGCTCAGGCATCCTGAGG - Intronic
1182431715 22:30302694-30302716 TGCCCAGCTGAGGCCTCCAGAGG - Intronic
1182667182 22:31968340-31968362 CACGAAGCTGAGGCCTCAGGGGG + Intergenic
1183281960 22:36936920-36936942 CACACTGCAGAGGCCTCATGGGG + Intronic
1183408317 22:37640985-37641007 CTCCCAGCTGAGGCCTGCCCTGG - Intronic
1183648788 22:39141886-39141908 GACCCAGCCTGGGCCTCCTGAGG + Intronic
1183905731 22:41038827-41038849 CACCAAGCAGAAGCCTCCGGAGG + Intergenic
1184240693 22:43209999-43210021 CACGCAGCTGAGGCTGCCTCTGG + Intronic
1184521605 22:44997821-44997843 CACCCAGGGGCGGCCTCCTCAGG + Intronic
1184755846 22:46515257-46515279 CCCCCACCTGGGCCCTCCTGGGG + Intronic
1185064254 22:48622852-48622874 CACACAGCCGAGACCTCCAGGGG - Intronic
952538997 3:34346274-34346296 CACACACCTGTTGCCTCCTGAGG - Intergenic
952852582 3:37741203-37741225 CACCCTGCTGAGGCTTTCTCTGG + Intronic
954060271 3:48061435-48061457 CTGCCAGCCTAGGCCTCCTGAGG + Intronic
954486677 3:50859651-50859673 CACCAAGCTGAGGCTTTGTGTGG + Intronic
954681293 3:52347399-52347421 CCCCCAGCTGAGACCTCAGGAGG - Intronic
954753926 3:52828816-52828838 CACAGACTTGAGGCCTCCTGAGG - Intronic
956410533 3:68973954-68973976 CACCCCGCTGAGGCCTCACCTGG + Intergenic
959500680 3:107102875-107102897 CACCCAGCTCTTCCCTCCTGGGG + Intergenic
961694200 3:128692945-128692967 CACCCAGCTGATGTCTACTGGGG - Intergenic
961749179 3:129085612-129085634 CGACCATCTCAGGCCTCCTGTGG - Intergenic
962757119 3:138473545-138473567 CACCCAGCTGCCGTCGCCTGAGG - Exonic
966726742 3:183115458-183115480 GACCCAGGTGAGTACTCCTGGGG - Intronic
968502850 4:959224-959246 CAGCCTGCTGCAGCCTCCTGGGG - Exonic
968746506 4:2363192-2363214 CACCCAGCTCAGGTCACCTGTGG + Intronic
968938561 4:3626156-3626178 CACCCAGCCGGGGCCTGGTGTGG + Intergenic
969351946 4:6603251-6603273 CACCCAGCTGACCCTTCTTGGGG + Intronic
969494436 4:7518430-7518452 CACCCAGCAGCTGCCTTCTGTGG - Intronic
969505522 4:7584690-7584712 CCCCCAGCTGAGCCCCGCTGTGG - Intronic
969703502 4:8780318-8780340 CAGCCAGCTGGGTCCTGCTGCGG + Intergenic
969869358 4:10095060-10095082 CTCCCTGCAGAGGCCCCCTGTGG - Intronic
981095185 4:140771982-140772004 CACCCAACTGAGGCACCCTTGGG - Intergenic
984195241 4:176650847-176650869 GTCACAGCTGAGGCCTCATGGGG + Intergenic
985586938 5:745357-745379 CACCCTGCTGAGCTGTCCTGTGG - Intronic
985635105 5:1032036-1032058 CACTCGCCTCAGGCCTCCTGGGG - Intronic
985775868 5:1841401-1841423 CACCCAGCTGTGCCGGCCTGGGG + Intergenic
985818126 5:2141789-2141811 CACCCAGGTGCCCCCTCCTGGGG - Intergenic
986506523 5:8457760-8457782 CACCCAGGTGAGCGCTCCGGAGG + Intergenic
988134023 5:27145540-27145562 CAGCCTCCTGAGGACTCCTGCGG + Intergenic
988263775 5:28926400-28926422 CACCCAGGCTAGGCCTCCAGGGG + Intergenic
990529973 5:56663725-56663747 CACCCAACAGAAGCCTCCTATGG - Intergenic
992395946 5:76369827-76369849 CACCCAGCTGGTGTCTGCTGCGG - Intergenic
995023800 5:107396513-107396535 CACCCAGCTGAGGGCTTCTGAGG + Intronic
995695757 5:114876598-114876620 CACCCAGTTCAGACTTCCTGGGG - Intergenic
995696502 5:114883907-114883929 CTCTCAGCTGAGGCCTCCTGTGG + Intergenic
997383199 5:133452023-133452045 CAGCCAGGTGTGGGCTCCTGGGG - Intronic
999142607 5:149372290-149372312 AACCCAGCCGAAGCTTCCTGGGG + Intronic
999247353 5:150162250-150162272 CACCCAGCCAGGGCCTCCTGGGG - Intergenic
1001140122 5:169137412-169137434 CAGCCCCCTGAGGCCTCCTCAGG - Intronic
1001221208 5:169902592-169902614 CACCCCGCTGAGGCTCCCTGGGG + Intronic
1001778152 5:174344611-174344633 CACCCAGCTCTGCCCTCCTCTGG - Intergenic
1006811079 6:36821064-36821086 CACCCTGTGGAGGCCTCCTCTGG - Intronic
1007495805 6:42259696-42259718 CACTCGGCTGATGCTTCCTGGGG + Exonic
1007743756 6:44029667-44029689 CACCAGGCTCAGGCCTCCGGGGG - Intergenic
1011281180 6:85679189-85679211 CCCCCAGCGGAGGCCGCCGGAGG + Intergenic
1013803391 6:113971161-113971183 CACCTCCCTGCGGCCTCCTGAGG - Exonic
1015516125 6:134084094-134084116 TACCCAGTTCAGGCCTCCTCTGG - Intergenic
1015519202 6:134114520-134114542 CAGCCACCTGAGGCCGCCTGGGG - Intergenic
1015796399 6:137016238-137016260 CACCCAGCTGGGGCTCCATGGGG + Intronic
1017523206 6:155220200-155220222 CAGCCAGCTGAGGACTCATCAGG - Intronic
1018411285 6:163551251-163551273 CACCCAGCTGGTGTCTGCTGAGG - Intronic
1019609303 7:1928899-1928921 CACCTCACTGAGGCCACCTGTGG + Intronic
1019738295 7:2661044-2661066 GACCCAACTGTGGGCTCCTGGGG - Intronic
1020727362 7:11832230-11832252 CAGTCAGCTGGGGCCCCCTGAGG - Intergenic
1021407256 7:20286071-20286093 TACCAACCTGAGTCCTCCTGAGG - Intergenic
1022042164 7:26591492-26591514 ATCCTAGCTGAGGACTCCTGGGG + Intergenic
1022345738 7:29512627-29512649 CACTCTGATGAGGCCCCCTGAGG + Exonic
1023213354 7:37832368-37832390 ATCACAGCTGAGGCTTCCTGGGG + Intronic
1023393529 7:39732416-39732438 CACCAAGCTGGGGCCTCAGGAGG + Intergenic
1023873936 7:44276780-44276802 CACCCAGCTGAGGCAGGCCGAGG - Intronic
1025695369 7:63771864-63771886 CACCCCACGGTGGCCTCCTGGGG - Intergenic
1029264302 7:99326135-99326157 CTCCCTGCCGGGGCCTCCTGAGG + Intronic
1029700374 7:102242722-102242744 CATGCAGCTGAGGCCTGTTGGGG - Intronic
1030903841 7:115158159-115158181 CACCCAGGTGAAGCCGCCTCAGG + Intergenic
1031512913 7:122671026-122671048 CACCCAGCTGATCCCTACTCAGG + Intronic
1031694082 7:124827484-124827506 CACCCAGCTGGCGTCTGCTGAGG + Intronic
1031714453 7:125090745-125090767 AACCAAGCTAAGGCCACCTGCGG - Intergenic
1032161473 7:129514149-129514171 CACCCAAGTGAGGGCTCCTCTGG - Intergenic
1034091489 7:148368371-148368393 CTCCCAGCTGAGGCCTCCCCTGG + Intronic
1034436038 7:151063174-151063196 CCCCCACCTGAGTCATCCTGCGG - Intronic
1034531700 7:151699922-151699944 CACCCATCTGCGGCCGCCTGTGG - Intronic
1035142559 7:156777324-156777346 CACTCAGCTGTGTCCTACTGAGG - Intronic
1035221554 7:157409429-157409451 CAGCCAGCTGAGCCACCCTGGGG - Intronic
1035287999 7:157818588-157818610 CCCCCAGCTGGTGCCTCCTGTGG + Intronic
1035333694 7:158112587-158112609 CTCCCAGCTGGGCCTTCCTGGGG - Intronic
1038124093 8:24651909-24651931 TAACCAGCTGAGGACTCCTTGGG + Intergenic
1041955768 8:63556764-63556786 CTCCCTGCTGGGTCCTCCTGAGG - Intergenic
1042927942 8:73986017-73986039 CTCCCACCTGAAGCCTCCAGGGG + Intergenic
1043640478 8:82443672-82443694 CACCCAGGGGAGCCCTCTTGTGG + Intergenic
1044464121 8:92483915-92483937 CACCTAGGTGTGGCCTCGTGAGG + Intergenic
1047488987 8:125358780-125358802 CACCCAGATGAGGAGTGCTGGGG - Intronic
1047778987 8:128096662-128096684 CTGCCAGCTGAGACCTCCAGGGG + Intergenic
1048534138 8:135276656-135276678 ATCCTAGCTGAGGCCTGCTGAGG + Intergenic
1048811924 8:138296233-138296255 AAGCCAGCCGAGGCCTTCTGAGG - Intronic
1048872675 8:138812291-138812313 CACCCGGCTCAGGGCTTCTGTGG - Intronic
1049821472 8:144636161-144636183 CACCCAGCTGGTGTCTGCTGTGG + Intergenic
1052928567 9:34038526-34038548 CTGCCAGCCTAGGCCTCCTGAGG + Intronic
1053478178 9:38396813-38396835 CACCCAGCAGGGGCCTCAGGTGG + Exonic
1053690389 9:40584025-40584047 CACCCAGGTCAGGGCTCCAGGGG - Intergenic
1054452180 9:65409180-65409202 CACCCAGCCGGGGCCTGGTGTGG - Intergenic
1054782194 9:69175375-69175397 CACCCAGCACAGACCACCTGGGG - Intronic
1057520610 9:95757151-95757173 ATCCCAGCTAAGGACTCCTGGGG - Intergenic
1058044976 9:100348668-100348690 CCTCCAGCCAAGGCCTCCTGAGG - Intronic
1059108276 9:111530605-111530627 CACCCAGCTGGTGCCTGCTGGGG + Intronic
1059367668 9:113799353-113799375 CTCCCAGCTGTGGCCCTCTGTGG - Intergenic
1060797991 9:126525604-126525626 CTCCCAGCAGAGGCGTCGTGTGG + Intergenic
1061250959 9:129426154-129426176 CACCCAACAGAGGCTTCTTGGGG - Intergenic
1061548788 9:131320370-131320392 CTCCCAGCTAAGGTCCCCTGAGG - Intergenic
1061937918 9:133868407-133868429 CACCGTGCTGAGGCTCCCTGAGG + Intronic
1062003626 9:134228810-134228832 CACCCTGCCGGGGCCTTCTGAGG + Intergenic
1062021051 9:134319596-134319618 CACCCTGCTGGGGCCTCCCATGG - Intronic
1062268727 9:135699301-135699323 CACCCATCCTGGGCCTCCTGGGG - Intronic
1062422151 9:136487960-136487982 CACCCCGCAGAAGCCTCATGTGG - Intergenic
1062521134 9:136958482-136958504 CACCCAGCTGTACCCTCCAGTGG + Intergenic
1203621086 Un_KI270749v1:130294-130316 CACCCAGGTCAGGGCTCCAGGGG - Intergenic
1187238278 X:17488417-17488439 CAGGCAGGAGAGGCCTCCTGTGG + Intronic
1187260623 X:17682261-17682283 TACCAAGCTGATGGCTCCTGAGG + Intronic
1187442480 X:19332678-19332700 CACACAGCTGGGAACTCCTGGGG - Intergenic
1192795561 X:74421921-74421943 CACCCAGCCGAAGCCACCTTCGG - Exonic
1196726723 X:118902345-118902367 CTCCAAGCTGGAGCCTCCTGTGG + Intergenic
1200034516 X:153319082-153319104 CTCCCAGCTGGGACCTCCTGGGG + Intergenic
1200982203 Y:9272680-9272702 CTCTCAGGTGGGGCCTCCTGCGG - Intergenic