ID: 900393718

View in Genome Browser
Species Human (GRCh38)
Location 1:2444592-2444614
Sequence CAGGGTATTCTTTAGGGAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 282
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 256}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900393711_900393718 6 Left 900393711 1:2444563-2444585 CCTGGGCTCTGGACCTGCCGGCA 0: 1
1: 0
2: 0
3: 16
4: 234
Right 900393718 1:2444592-2444614 CAGGGTATTCTTTAGGGAGATGG 0: 1
1: 0
2: 0
3: 25
4: 256
900393707_900393718 23 Left 900393707 1:2444546-2444568 CCACTGCTGAGGGGTCTCCTGGG 0: 1
1: 0
2: 2
3: 35
4: 326
Right 900393718 1:2444592-2444614 CAGGGTATTCTTTAGGGAGATGG 0: 1
1: 0
2: 0
3: 25
4: 256
900393714_900393718 -7 Left 900393714 1:2444576-2444598 CCTGCCGGCAGAGCTACAGGGTA 0: 1
1: 0
2: 1
3: 1
4: 65
Right 900393718 1:2444592-2444614 CAGGGTATTCTTTAGGGAGATGG 0: 1
1: 0
2: 0
3: 25
4: 256

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900393718 Original CRISPR CAGGGTATTCTTTAGGGAGA TGG Intronic
900393718 1:2444592-2444614 CAGGGTATTCTTTAGGGAGATGG + Intronic
901713501 1:11134559-11134581 TAGGGTATTCTGTTTGGAGAGGG - Intronic
902399346 1:16149631-16149653 CTGGGAATTCTTTCTGGAGAAGG - Intronic
903608157 1:24590127-24590149 CAGGGTCTTCATTTGAGAGAAGG + Intronic
905460682 1:38120887-38120909 CAGGGTCTTCCTTATGGAGAAGG - Intergenic
907084726 1:51660700-51660722 CAGCGTCTTCTTTAGTGAGCAGG + Intronic
908360134 1:63360919-63360941 CATGGCATTCTCTAGAGAGAGGG + Intergenic
910465543 1:87495274-87495296 CATGCTATTCTTTGGGCAGAGGG + Intergenic
912310955 1:108620945-108620967 CAGGGAAATCTTTACTGAGAAGG + Intronic
912672917 1:111648253-111648275 CAGGGTACCCTTTGGGGAGCAGG - Intronic
914829763 1:151162035-151162057 GAGGGTTTTCTTCAGGAAGATGG + Exonic
914963493 1:152228896-152228918 CAGGGTAGGCTTTATTGAGAAGG - Intergenic
916310817 1:163396987-163397009 CAGGGAAAGCTTTATGGAGAAGG - Intergenic
918276597 1:182959040-182959062 CAGGATACTCTTTGGGGAGCAGG - Intergenic
919180431 1:194073991-194074013 CTGGGTAGTCTTTAGGGCCACGG - Intergenic
919470334 1:197970715-197970737 CAGAGGATTCTTTAGTGATATGG - Intergenic
919901054 1:202044694-202044716 CAGTGTATGCTCTAGTGAGAGGG - Intergenic
919991885 1:202713060-202713082 AAGGGAATTCTTTAAGCAGAAGG - Intergenic
920882898 1:209896979-209897001 CAGGGAAGGCTTTGGGGAGAAGG + Intergenic
921381988 1:214533483-214533505 CAGGGTACCCTTTGGGGAGCAGG + Intronic
922718660 1:227889359-227889381 CAGGGTATGCATCTGGGAGAGGG + Intergenic
923582050 1:235227036-235227058 CAGGTTTCTCTTTAGAGAGATGG + Intronic
923915090 1:238492659-238492681 CAGGGTACCCTTTGGGGAGCAGG + Intergenic
1063008170 10:1994730-1994752 CAGAGCACTCTTCAGGGAGATGG + Intergenic
1063830105 10:9942741-9942763 CAGGGTCTGCTTTGGGGAAATGG - Intergenic
1063848947 10:10162740-10162762 CAGTTTATTCTTTTGGGAAATGG + Intergenic
1064039680 10:11949330-11949352 AAGGGTATTCTCTATTGAGAAGG - Intronic
1067780603 10:49202582-49202604 AAAGGTATTCTTCAGGAAGAAGG - Intergenic
1068025266 10:51634927-51634949 CAGGGCATACTTGAGGGAGGTGG + Intronic
1068146348 10:53075815-53075837 CAGTATATTCCTTGGGGAGATGG + Intergenic
1069304197 10:66948163-66948185 CACTGTATATTTTAGGGAGAGGG + Intronic
1069848328 10:71388611-71388633 AAGGGTATGCTTTAGGCAGAAGG - Intergenic
1070754844 10:78985608-78985630 GAGGGTATTTGTTGGGGAGAGGG - Intergenic
1071228077 10:83554686-83554708 CAGGGTGATCTTTAAGGAAATGG + Intergenic
1071944450 10:90626694-90626716 AAGGATATTCTTTAGGTTGAAGG + Intergenic
1072809980 10:98453966-98453988 CAGGGTGTTCTGTGGGGAGAGGG - Intergenic
1074441453 10:113480652-113480674 TTGGGTCTTCTTTATGGAGAAGG + Intergenic
1076331272 10:129671021-129671043 AAAGGTATTCTTCAGGCAGAAGG - Intronic
1077701190 11:4443817-4443839 CAGGGTATTCCTCAGAGACAGGG + Intergenic
1077842838 11:5993840-5993862 CAGAGTACCCTTTAGGGAGCAGG - Intergenic
1078255645 11:9656294-9656316 CAGGTTATTTTTTATGGAAAAGG - Intergenic
1078487233 11:11734966-11734988 CAGGGTATTCAACAGGGAGAAGG + Intergenic
1080827457 11:35860210-35860232 CAGGGTACTCTCTGGGGAGCAGG - Intergenic
1081098739 11:38974027-38974049 AAGGGAATTCATTAGGGTGATGG - Intergenic
1081547565 11:44082642-44082664 CAGGGTGTTCTTTAGGATGGTGG + Intronic
1082772566 11:57219751-57219773 CAGGGAGTTCTTTAGGTGGAGGG - Intergenic
1082960068 11:58910947-58910969 CAGGGAATTATTTAGAGTGATGG - Intronic
1084487742 11:69460674-69460696 CAGGCTATGTTTTAGGGAAAAGG + Intergenic
1084736143 11:71106951-71106973 CAAGGTATTCTTTGTAGAGACGG - Intronic
1085302199 11:75465359-75465381 CAGGGGAGTCTTCAGGGAGGAGG - Intronic
1087597049 11:100267500-100267522 CAGGGTATGCCTTACCGAGAAGG + Intronic
1087618493 11:100516412-100516434 CAGCTTTTTCTTTATGGAGAAGG + Intergenic
1088222947 11:107589365-107589387 CAGGGTAGGCTTCAGAGAGAAGG + Intergenic
1089072595 11:115711733-115711755 CAGGTTATTCCTTTGGTAGAAGG - Intergenic
1090232124 11:125114877-125114899 CAGGGTACACTTTGGGGAGCAGG + Intergenic
1091452438 12:581634-581656 CAGGGTCTGCTCTGGGGAGAAGG + Intronic
1091859534 12:3767602-3767624 CAAGAAATTCTTTAGAGAGAAGG + Intergenic
1092907632 12:13116392-13116414 CAGGGTGTTCTTTGGGGCGTAGG - Intronic
1093370116 12:18355573-18355595 CAGGGTAGTCTTTGGGGCCAGGG - Intronic
1096635053 12:52952854-52952876 CAGGGTACCCTTTGGGGAGCAGG + Exonic
1097554612 12:61121700-61121722 CAGGGTTTTCTAGAGGGACAGGG - Intergenic
1097950127 12:65418688-65418710 CAGGGTACTCTCTGGGGAGCTGG - Intronic
1098166067 12:67699377-67699399 CAGGGTATACTATAGGCAGTGGG + Intergenic
1098814410 12:75139559-75139581 CAGGGTAATATTTATGGATATGG - Intronic
1098913556 12:76234675-76234697 CATGGTATTCTTTAAAAAGAAGG - Intergenic
1099161706 12:79249564-79249586 TTGGTTTTTCTTTAGGGAGATGG + Intronic
1101269689 12:103130572-103130594 CAGGTCATTCATTAGGGAGTAGG + Intergenic
1101468867 12:104976715-104976737 CAGGGTACCCTTTGGGGAGCAGG - Intergenic
1101526727 12:105538037-105538059 CAGGGCACTTTTTAGAGAGATGG - Intergenic
1101649720 12:106666020-106666042 AAAGAAATTCTTTAGGGAGAAGG - Intronic
1101821569 12:108188239-108188261 CAGGGGATTCTTTCTGGAGGTGG + Intronic
1102553182 12:113707340-113707362 TAGGGTATTTTCTAGGGAGATGG - Intergenic
1102642606 12:114380147-114380169 CAGAGTAGGCTTTATGGAGAGGG - Intronic
1103327307 12:120130133-120130155 CAGGGTGTATTTTAGTGAGATGG - Intronic
1104057079 12:125238815-125238837 CAGGGTATTGTTAAGAGACAGGG + Intronic
1104822379 12:131684573-131684595 CAGGGTAGTCGGGAGGGAGATGG - Intergenic
1107870980 13:44746318-44746340 CAGGGTTTCCTTTAGGCAGAGGG + Intergenic
1111133104 13:84000814-84000836 CAGGGTTTTATTTGGTGAGAAGG - Intergenic
1111581786 13:90231694-90231716 CAGGGTACCCTTTGGGGAGCAGG + Intergenic
1113394225 13:109931035-109931057 CAAGGTATTCTCCAGGAAGAGGG + Intergenic
1113898733 13:113783886-113783908 GAGGGTTTTCTTTAAGAAGAAGG + Intronic
1114914198 14:27241453-27241475 AAGAGTTATCTTTAGGGAGAAGG + Intergenic
1116412982 14:44647599-44647621 CAGGGTAGTCATAGGGGAGATGG - Intergenic
1117865066 14:60138718-60138740 AAGGGTATTCTTCAGACAGAAGG + Exonic
1119799646 14:77431906-77431928 TTGGCTATTTTTTAGGGAGAGGG - Intronic
1120761452 14:88289146-88289168 CAGGATTTCCTTTAGGGAAATGG - Intronic
1122328205 14:100895323-100895345 CAGGGTTTGCTTAGGGGAGATGG + Intergenic
1122391739 14:101393705-101393727 AAGGATATTCTTTAGGCAGAAGG - Intergenic
1122592898 14:102868162-102868184 CAGTGTATTTTTGAGGGAGCTGG + Intronic
1124668398 15:31614685-31614707 AAAGGTGTTCTTTAGGTAGAAGG + Intronic
1125519506 15:40340138-40340160 AAGGGGATTGCTTAGGGAGATGG + Intronic
1126440388 15:48682458-48682480 AAGTATGTTCTTTAGGGAGAAGG - Intergenic
1127162930 15:56209422-56209444 AAAGGAATTCTTTAGAGAGAAGG + Intronic
1127406106 15:58648007-58648029 CATGGAATTATTAAGGGAGAAGG - Intronic
1129887579 15:79049325-79049347 CAGGGTACCCTTCAGGGATAAGG + Intronic
1131350422 15:91694594-91694616 CAGGGTATTCTCTCAGGAGGTGG + Intergenic
1131456338 15:92585298-92585320 CCTCGTATTCTTGAGGGAGAAGG - Intergenic
1133163519 16:3928937-3928959 TAGGGTGTTCTTCAGGCAGAAGG + Intergenic
1136646798 16:31627004-31627026 CAGGGTATTTTGTAAGGAAATGG - Intergenic
1140182081 16:72729917-72729939 CAGGGTACCCTTTGGGGAGCAGG + Intergenic
1140919243 16:79521548-79521570 GAGGGTCTTGTTCAGGGAGATGG - Intergenic
1141048372 16:80737797-80737819 CTGGGCATTCTTTAGAGAAATGG - Intronic
1143194874 17:5068319-5068341 CAGGGTTTTATTTTGGTAGAAGG + Intergenic
1143890669 17:10099778-10099800 GAGGGTATACCTTGGGGAGAAGG - Intronic
1143961262 17:10722758-10722780 AAGGGTGTTCTTCAGGGTGAAGG - Intronic
1144998593 17:19288026-19288048 CAGGGCATCCTTTATGAAGATGG - Intronic
1145129997 17:20336286-20336308 CAGGATTTTCTTTAGGAAGTAGG + Intergenic
1146985063 17:37208141-37208163 GAGGGAATGCTTTAGGGAGGGGG - Intronic
1147673253 17:42189055-42189077 CAGGGTCTGCTTTGGGGAAACGG - Intronic
1148391166 17:47274245-47274267 CAGGTTATTGGTTAGGAAGAAGG - Intronic
1149149326 17:53541136-53541158 AAGGGAATTCTTTAAGGAGCAGG - Intergenic
1149567467 17:57650306-57650328 CAGGGGATGCTGGAGGGAGAGGG - Intronic
1149580191 17:57744680-57744702 CAAGGTGTTATTTAGGCAGAAGG + Exonic
1153723794 18:7935823-7935845 CAGGGTCTACTTTAGGGTGGAGG - Intronic
1153907753 18:9678209-9678231 CAGGGTACCCTTTGGGGAGCAGG - Intergenic
1153951734 18:10063350-10063372 AAGGAAATTCTTTAGGCAGAAGG - Intergenic
1154135091 18:11770650-11770672 AAAGGTATTCTTTAGGGTAATGG - Intronic
1156521285 18:37724187-37724209 CAGGGTACCCTTTAGGAAGCTGG - Intergenic
1157530203 18:48413917-48413939 CAGCATTTTCTTGAGGGAGATGG - Intergenic
1159001976 18:62982499-62982521 CAGGGTAAGTATTAGGGAGAAGG + Intergenic
1160122217 18:76140766-76140788 CAGGGTAATCTTGAGGGATGGGG + Intergenic
1160282169 18:77501412-77501434 GATGGCATTCTGTAGGGAGAGGG + Intergenic
1163987086 19:20963382-20963404 CAGGGTACCCTTTGGGGAGCAGG + Intergenic
1164787670 19:30946622-30946644 AAGGGAGTTCTTTAGGCAGAAGG - Intergenic
1166266289 19:41686562-41686584 CAGGGTCTTTTTCAGGGGGAGGG + Intronic
1167813845 19:51860959-51860981 TAGGGTATTCATTCAGGAGAAGG - Intronic
1167899656 19:52610184-52610206 CAGGGCATTCTTCACAGAGAGGG - Intronic
929337896 2:40773298-40773320 CAGGGTATATTATAGGGATATGG + Intergenic
929548069 2:42869263-42869285 AAGGGTATGCTTCAGGCAGAAGG + Intergenic
930151938 2:48068411-48068433 CAGGTTATTCTACAGGGAGTGGG + Intergenic
930485030 2:52000766-52000788 CTGGGTATTATTCAGGAAGAGGG - Intergenic
931441605 2:62294143-62294165 CAGGGTCTTCTTTTGTGGGAAGG - Intergenic
931627607 2:64271033-64271055 CAGGGTCTTGTTGAGGGTGATGG + Intergenic
931912949 2:66922090-66922112 CAGGGTAGACTTATGGGAGAGGG + Intergenic
931913521 2:66928112-66928134 CAAGGTATACCTTGGGGAGATGG - Intergenic
932117254 2:69063519-69063541 AAAGGAATTCTTTAGGGTGAAGG + Intronic
932656961 2:73618628-73618650 CAAGGTGTTCTTTCGGGAGAGGG + Intergenic
932663623 2:73678884-73678906 CAAGGTGTTCTTTCTGGAGAGGG + Intergenic
932743041 2:74306691-74306713 CAGGGTACCCTTTGGGGAGCAGG - Intronic
933459675 2:82565813-82565835 GAGAGTATTTTTTAGGTAGAAGG + Intergenic
938964674 2:136377727-136377749 CAGGCTCTTCTTTACAGAGAAGG - Intergenic
939141427 2:138358915-138358937 CAGGGTTTTGTTTAGGGTAAGGG - Intergenic
939174549 2:138734503-138734525 CAGGGAAAGCTTTAAGGAGAAGG + Intronic
939575054 2:143885808-143885830 CAGGGTATAATTTAGGGGAAAGG + Intergenic
941541676 2:166793913-166793935 GTGGGTATCTTTTAGGGAGATGG + Intergenic
942971266 2:181961170-181961192 CAGGGTACCCTTTGGGGAGCAGG - Intronic
943548555 2:189311226-189311248 CAGGGTACCCTTTGGGGAGCAGG - Intergenic
943581510 2:189689082-189689104 CAGTTTATTCTTTAAGTAGAGGG + Intronic
944657603 2:201891566-201891588 CAGGGTAATCTTGAGGAGGAAGG + Intronic
946006974 2:216533645-216533667 CTGAGTACTCTTCAGGGAGAGGG + Intronic
948442988 2:238008935-238008957 AAGGATGTTCTTTAGGCAGAAGG - Intronic
948467853 2:238160653-238160675 CAGGGCCTTCTTTTGGGAGCTGG - Intronic
1170673454 20:18456536-18456558 AAGGGAATTCTTTTGGGTGATGG - Intronic
1171362843 20:24601792-24601814 AAGGATGTTCTTTAGGCAGAAGG - Intronic
1173369755 20:42424834-42424856 TAAGGTATTATGTAGGGAGATGG + Intronic
1173678360 20:44857913-44857935 CTGAGTAATCTTTGGGGAGAAGG + Intergenic
1174782249 20:53400686-53400708 GAGAGTATTCATTAGGGTGAGGG - Intronic
1177535095 21:22415477-22415499 AAGGGTAGTTTTTGGGGAGAAGG - Intergenic
1180887687 22:19258818-19258840 CAGGGTACCCTTTGGGGAGCAGG + Intronic
1181092371 22:20482781-20482803 CAGGGTATCCTTTGGGGAGCAGG - Intronic
1182889213 22:33802770-33802792 GGTGGTATTGTTTAGGGAGAGGG - Intronic
1183975985 22:41512647-41512669 CATGGTGTTCTGTAGGGTGAAGG + Intronic
1184448452 22:44568262-44568284 CAGGGTACCCTTTAGAGAGCAGG + Intergenic
1184464985 22:44663688-44663710 CATGGAATTCTTTGAGGAGAGGG + Intergenic
950281781 3:11714249-11714271 CATGGGACACTTTAGGGAGATGG - Intronic
950403223 3:12787356-12787378 CAGGGTACCCTTTGGGGAGCAGG - Intergenic
950888189 3:16378895-16378917 TGGGCTATTTTTTAGGGAGAGGG - Intronic
951145592 3:19222785-19222807 CAGGATATTTTTTAGGATGAAGG + Intronic
952662312 3:35866430-35866452 AAGGTTCTTCTTTAGGGTGATGG + Intergenic
955066201 3:55535625-55535647 CAGGTCATGCTTTAGGAAGAGGG - Intronic
959626887 3:108462937-108462959 CTGGGGGTTCTTCAGGGAGATGG - Intronic
962147965 3:132861107-132861129 CAAGGAATTCTTTAGGGTGATGG - Intergenic
962968112 3:140372673-140372695 CAGGGTATGCTTAAGATAGATGG - Intronic
963665454 3:148180164-148180186 AAAGGTATTTTTTAGGGAGGTGG + Intergenic
964483258 3:157162629-157162651 CAGGGTACCCTTTGGGGAGCAGG - Intergenic
965950155 3:174299017-174299039 CAGGGAAGTCTTTGGGAAGAAGG - Intergenic
966565050 3:181369967-181369989 CACAATATTCTTTAGGCAGAAGG - Intergenic
967314298 3:188136632-188136654 CAGGGGAGCCTTCAGGGAGAAGG + Intergenic
971064168 4:23008982-23009004 GAGAATATTCTTCAGGGAGAAGG + Intergenic
972143379 4:35989669-35989691 CAGGGTCTACTTGAGGGTGAAGG + Intronic
972538833 4:40021535-40021557 CAGGGTACCCTTTGGGGAGCAGG + Intergenic
975040270 4:69738016-69738038 CAGGGTATAATTGAGGGTGAAGG - Intronic
975332559 4:73133949-73133971 CAATGTCTTCTTCAGGGAGATGG + Intronic
976025858 4:80687663-80687685 CAGGGCATTCTGGAGGGAGGAGG + Intronic
980625554 4:135371143-135371165 CAGGGTACCCTTTGGGGAGCAGG - Intergenic
980990990 4:139738173-139738195 CAGGGCATCCTTCAGGGTGAGGG + Intronic
981080218 4:140632443-140632465 AAGGGCATTTTTTAGGAAGAAGG - Intronic
981422952 4:144572195-144572217 CAGGGTACCCTTTGGGGAGCAGG - Intergenic
982842535 4:160209439-160209461 TAGAGTATTCTTTCTGGAGATGG - Intergenic
984147882 4:176087182-176087204 AAGGGATTTCTTTAGGTAGAAGG - Intronic
985139795 4:186828375-186828397 CAGGGAATTCTTCAAGGAGATGG - Intergenic
985189056 4:187351837-187351859 CAGGGAAGGCTTTAGAGAGATGG + Intergenic
986308933 5:6536803-6536825 CATGGTATTCTGTAGGAACAAGG - Intergenic
986757303 5:10850099-10850121 GAGGGTATACTTGAGGAAGATGG + Intergenic
989012316 5:36886509-36886531 CAGGGTACCCTTTGGGGAGCAGG + Intronic
992151056 5:73903570-73903592 CCGTCTGTTCTTTAGGGAGAGGG - Intronic
992800333 5:80289794-80289816 CAGGGTATCCTTTGGGGAGTAGG + Intergenic
995215458 5:109589608-109589630 CAGGGTACCCTTTGGGGAGCAGG + Intergenic
995569399 5:113463405-113463427 TAGGGTAATCATAAGGGAGATGG + Intronic
995757878 5:115529536-115529558 TATGGTGTTCTTTAGGCAGAAGG + Intronic
996452172 5:123637420-123637442 CAGGGTACCCTTTGGGGAGCAGG + Intergenic
996875726 5:128238529-128238551 CAGGCTATACTTTAGGGCAATGG + Intergenic
999853761 5:155571161-155571183 AAGGGCATTCTTTAGGGAAAAGG - Intergenic
1000608641 5:163351399-163351421 AAGAGAATTCCTTAGGGAGATGG + Intergenic
1000653696 5:163849918-163849940 CATGGTATTCTTAGGGTAGAAGG + Intergenic
1001110676 5:168893614-168893636 CCGTGTCTTCTTTAGAGAGATGG + Intronic
1004484340 6:16051752-16051774 CAGGGAAATCTTTATGGAGGAGG - Intergenic
1005381725 6:25241764-25241786 CAAGGTATTGTTTCTGGAGAAGG - Intergenic
1008764011 6:54888388-54888410 AAGGGAATTCTTTAGGAAGAAGG - Intronic
1009897904 6:69775584-69775606 CATTGTATTCTTCAGGGAGGAGG + Intronic
1010800966 6:80175231-80175253 CAAGTTATTCTTTAAAGAGAAGG - Intronic
1011337542 6:86277743-86277765 GAGGATATTATTCAGGGAGAAGG - Intergenic
1011982809 6:93404421-93404443 CAGGGTATTGGTTAGGAATAAGG + Intronic
1013667228 6:112361403-112361425 CAGGGGACCCTTTAGGGAGCAGG - Intergenic
1013838762 6:114364523-114364545 GAGGGTGCTCTGTAGGGAGATGG - Intergenic
1015446105 6:133306903-133306925 CAGGGTATGATTTATGTAGAAGG + Intronic
1015743392 6:136483346-136483368 CAGGGCCTTCTTGAGGGTGAAGG + Intronic
1016577799 6:145589842-145589864 CAGGGTACCCTTTGGGGAGCAGG + Intronic
1016950535 6:149575242-149575264 AAGGGAATTCTTTAGGCCGAAGG - Intronic
1020411796 7:7900554-7900576 AAGGTTATTCCTTAGGAAGATGG + Intronic
1022017387 7:26363018-26363040 TCTGGGATTCTTTAGGGAGAGGG + Intronic
1022828612 7:34042267-34042289 AAGTTTATTCTTTAGAGAGATGG - Intronic
1023174746 7:37425022-37425044 CTGGGTCTTCTTAAGGCAGAGGG - Intronic
1024486217 7:49923718-49923740 AAGAGTATTCTTCAGGCAGAGGG - Intronic
1024788156 7:52931916-52931938 CAGGGTCTGCTTTTGGGAGGAGG - Intergenic
1025103777 7:56154350-56154372 CAGGGCATTCCTTTGGGGGAAGG - Intergenic
1029877710 7:103771432-103771454 CAATGCATTCATTAGGGAGATGG - Intronic
1031297582 7:120022441-120022463 CAAGGTATTATTTAGGCAAATGG + Intergenic
1031465459 7:122104763-122104785 CAGGGTATACTTGAGGGTGGAGG + Intronic
1031956194 7:127944928-127944950 CAGTGTAATCTCTAGGAAGATGG - Intronic
1033255480 7:139797657-139797679 CTGTGTAGTCTTTAGGGTGAGGG + Intronic
1034359192 7:150479150-150479172 CAGGGTATACTTGAGGGTGGAGG + Exonic
1036505538 8:9351842-9351864 CAGGGTATTCTTCAGAATGAAGG - Intergenic
1037998621 8:23371290-23371312 CAGGGAATTCTTCAGGCAAAAGG + Intronic
1039249069 8:35641932-35641954 CAGGGTATTCAATAGTGAGATGG - Intronic
1040986791 8:53304123-53304145 CTGGGTAGTCATTAGGGAAAAGG + Intergenic
1044230302 8:89767868-89767890 AAGGGTATTTATCAGGGAGATGG - Intronic
1045133261 8:99182357-99182379 CAGGGAATTTTCTGGGGAGATGG + Intronic
1045349511 8:101325264-101325286 CATGGTAGTCTTTTGGGATAGGG + Intergenic
1045701527 8:104871890-104871912 CAGGGTATTCTTATGGTAGAGGG + Intronic
1045727758 8:105195631-105195653 CAGGGTATTCTTTTTGGAGCTGG + Intronic
1047419523 8:124695381-124695403 AAGGATATTCTTTCTGGAGAAGG + Intronic
1047799918 8:128298184-128298206 CAGGGTATTAATTAGGAAGAAGG + Intergenic
1047823737 8:128550628-128550650 CAGAGTTTTCCATAGGGAGATGG + Intergenic
1049029412 8:140023319-140023341 CAGGGTATTCTTTTCTGAGGTGG - Intronic
1050577412 9:7011684-7011706 CAGGCAATTCTTAAGGGAGAAGG - Exonic
1050836267 9:10083135-10083157 CAGGGAAATCTTTAAGGATAGGG - Intronic
1051559575 9:18425418-18425440 GAGGGTATATTTTTGGGAGAGGG - Intergenic
1051668096 9:19484228-19484250 CAGGGTCTTCTTTCTGTAGAAGG + Intergenic
1052396401 9:27943883-27943905 CAGGATGTTCTCCAGGGAGAAGG + Intergenic
1053087025 9:35233959-35233981 CAGAGAACTCTCTAGGGAGAAGG - Intronic
1053150403 9:35739537-35739559 CAGGGTATTGGTTAGGATGAGGG - Intronic
1054711889 9:68519181-68519203 AAGGATATTCTTCAGGAAGAAGG + Intronic
1055188580 9:73489032-73489054 CAGGGTATTCTATAGTAAGTAGG + Intergenic
1055674663 9:78644755-78644777 CAGGATATTCCTTAGGAAAAAGG + Intergenic
1057739716 9:97700746-97700768 CAGGGTACACTTTGGGGAGCAGG + Intergenic
1058246364 9:102631054-102631076 CATGGTATTCCTGAGAGAGAAGG - Intergenic
1058493656 9:105530274-105530296 CAGGGTGTCCTTTAGGGAAGTGG + Intronic
1060348722 9:122838839-122838861 CAGGGTACTCTTTGGGGAGCAGG + Intergenic
1060781611 9:126417138-126417160 CAGAGAAAGCTTTAGGGAGAAGG - Intronic
1061523444 9:131137344-131137366 CAGATTTTTCTTTAGGGATAAGG - Intronic
1062356706 9:136168344-136168366 CAGGGTATTGTTTTAGGACAGGG - Intergenic
1187044708 X:15635311-15635333 CAGGGTATTTTTTAGAGAGCTGG + Intronic
1187306112 X:18096671-18096693 CAGCCTATTCTTTTGGGAAAAGG + Intergenic
1188613936 X:32134047-32134069 CATGGTATTCTTCATTGAGAAGG - Intronic
1189200551 X:39192264-39192286 CAGGGAATTTTCTAGGGAGATGG - Intergenic
1189757505 X:44285819-44285841 CATGGGCTTCTTTAGAGAGACGG - Intronic
1190163054 X:48047854-48047876 CAAGGAATTCTTAGGGGAGATGG - Intronic
1190827233 X:54028790-54028812 CAGGGTATAGTGGAGGGAGAGGG - Intronic
1191275240 X:58537824-58537846 CAGAGTATTCTTTGGGATGATGG - Intergenic
1192823574 X:74669942-74669964 CAGGGTATTCCTTAAGGGCAGGG + Intergenic
1193824093 X:86201274-86201296 CAGGGTCTTCTTGAGGGGGGTGG + Intronic
1193972790 X:88077409-88077431 CAGGTGATATTTTAGGGAGATGG + Intergenic
1194322107 X:92460964-92460986 CAGGGTACCCTTTGGGGAGCAGG + Intronic
1195380471 X:104266127-104266149 CAGGGGTTTCTTTAGAGTGATGG - Intergenic
1195665840 X:107429477-107429499 CAGGGTACTCTTTGGGGAGCAGG + Intergenic
1195961031 X:110387051-110387073 CAGGGGAAGCTTTAAGGAGAAGG + Intronic
1197106306 X:122720688-122720710 GAGGGTATGAGTTAGGGAGATGG + Intergenic
1197618004 X:128715802-128715824 CAGGGTATCCTTTGGGGAGCAGG + Intergenic
1199731795 X:150640904-150640926 CAGGGTATTTTTTTAGGGGATGG + Intronic
1200630269 Y:5574443-5574465 CAGGGTACCCTTTGGGGAGCAGG + Intronic
1200835894 Y:7730668-7730690 AGGGGTATTTTTTAGGGAGAGGG - Intergenic