ID: 900394099

View in Genome Browser
Species Human (GRCh38)
Location 1:2446114-2446136
Sequence GTCCACTGCAGTCCTAGCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 190}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900394087_900394099 17 Left 900394087 1:2446074-2446096 CCGCTGCCTGGCCGGGCTTCCAC 0: 1
1: 0
2: 1
3: 33
4: 285
Right 900394099 1:2446114-2446136 GTCCACTGCAGTCCTAGCCAGGG 0: 1
1: 0
2: 2
3: 14
4: 190
900394088_900394099 11 Left 900394088 1:2446080-2446102 CCTGGCCGGGCTTCCACCCCCGT 0: 1
1: 0
2: 1
3: 9
4: 194
Right 900394099 1:2446114-2446136 GTCCACTGCAGTCCTAGCCAGGG 0: 1
1: 0
2: 2
3: 14
4: 190
900394094_900394099 -8 Left 900394094 1:2446099-2446121 CCGTCCTGCTTCCCTGTCCACTG 0: 1
1: 0
2: 1
3: 80
4: 668
Right 900394099 1:2446114-2446136 GTCCACTGCAGTCCTAGCCAGGG 0: 1
1: 0
2: 2
3: 14
4: 190
900394091_900394099 -5 Left 900394091 1:2446096-2446118 CCCCCGTCCTGCTTCCCTGTCCA 0: 1
1: 0
2: 3
3: 38
4: 390
Right 900394099 1:2446114-2446136 GTCCACTGCAGTCCTAGCCAGGG 0: 1
1: 0
2: 2
3: 14
4: 190
900394084_900394099 22 Left 900394084 1:2446069-2446091 CCCTCCCGCTGCCTGGCCGGGCT 0: 1
1: 0
2: 4
3: 28
4: 288
Right 900394099 1:2446114-2446136 GTCCACTGCAGTCCTAGCCAGGG 0: 1
1: 0
2: 2
3: 14
4: 190
900394089_900394099 6 Left 900394089 1:2446085-2446107 CCGGGCTTCCACCCCCGTCCTGC 0: 1
1: 0
2: 1
3: 38
4: 371
Right 900394099 1:2446114-2446136 GTCCACTGCAGTCCTAGCCAGGG 0: 1
1: 0
2: 2
3: 14
4: 190
900394093_900394099 -7 Left 900394093 1:2446098-2446120 CCCGTCCTGCTTCCCTGTCCACT 0: 1
1: 0
2: 3
3: 55
4: 586
Right 900394099 1:2446114-2446136 GTCCACTGCAGTCCTAGCCAGGG 0: 1
1: 0
2: 2
3: 14
4: 190
900394085_900394099 21 Left 900394085 1:2446070-2446092 CCTCCCGCTGCCTGGCCGGGCTT 0: 1
1: 0
2: 2
3: 19
4: 213
Right 900394099 1:2446114-2446136 GTCCACTGCAGTCCTAGCCAGGG 0: 1
1: 0
2: 2
3: 14
4: 190
900394092_900394099 -6 Left 900394092 1:2446097-2446119 CCCCGTCCTGCTTCCCTGTCCAC 0: 1
1: 0
2: 3
3: 26
4: 420
Right 900394099 1:2446114-2446136 GTCCACTGCAGTCCTAGCCAGGG 0: 1
1: 0
2: 2
3: 14
4: 190
900394090_900394099 -2 Left 900394090 1:2446093-2446115 CCACCCCCGTCCTGCTTCCCTGT 0: 1
1: 1
2: 6
3: 63
4: 657
Right 900394099 1:2446114-2446136 GTCCACTGCAGTCCTAGCCAGGG 0: 1
1: 0
2: 2
3: 14
4: 190
900394086_900394099 18 Left 900394086 1:2446073-2446095 CCCGCTGCCTGGCCGGGCTTCCA 0: 1
1: 0
2: 2
3: 28
4: 298
Right 900394099 1:2446114-2446136 GTCCACTGCAGTCCTAGCCAGGG 0: 1
1: 0
2: 2
3: 14
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900394099 Original CRISPR GTCCACTGCAGTCCTAGCCA GGG Intronic
900394099 1:2446114-2446136 GTCCACTGCAGTCCTAGCCAGGG + Intronic
901021459 1:6258044-6258066 GGCCACTGCCGCCTTAGCCAAGG + Intronic
901153367 1:7119434-7119456 GTTCACTGCTGTCCTTTCCAGGG - Intronic
902522226 1:17026138-17026160 GTCCTTTGCATTCCTAGGCAAGG - Intronic
904209180 1:28874766-28874788 CACCACTGCACTCCTAGCCTGGG + Intergenic
904588010 1:31590765-31590787 GTCCACTGCAGAACTGGCCCAGG - Intergenic
910567106 1:88656629-88656651 GTCCACAGCAGACCTATGCAAGG - Intergenic
912856203 1:113170758-113170780 GACTCCTGCAGTCCTAGCCATGG + Intergenic
912945134 1:114078437-114078459 GTCCACTGCAGTCTTCTACATGG + Intergenic
913578037 1:120197047-120197069 GGCCACCCCAGTCCTAGCTACGG - Intergenic
913630134 1:120701305-120701327 GGCCACCCCAGTCCTAGCTACGG + Intergenic
914559954 1:148808467-148808489 GGCCACCCCAGTCCTAGCTACGG - Intronic
914612879 1:149321748-149321770 GGCCACCCCAGTCCTAGCTACGG + Intergenic
915056149 1:153133281-153133303 GACTCCTGCAATCCTAGCCATGG + Intergenic
916824974 1:168434540-168434562 CTCCACTGCAGCCATAGGCATGG - Intergenic
917144166 1:171870044-171870066 GTCCATTGAAGAACTAGCCATGG + Intronic
917758626 1:178131010-178131032 CACCACTGCAGTCCCAGCCTGGG + Intronic
919112940 1:193242342-193242364 GACTCCTGCAATCCTAGCCAGGG - Intronic
919147240 1:193651279-193651301 GTACCTTGCAGTACTAGCCACGG - Intergenic
919537658 1:198808207-198808229 CTCTACTGCACTCCTAGCCTGGG + Intergenic
919768417 1:201141873-201141895 GTCTCCTGCCATCCTAGCCAGGG - Intronic
920206446 1:204295801-204295823 GGCCACAGCAGGCCAAGCCAAGG + Intronic
920496739 1:206460312-206460334 GCCAACAGCAGTCCTAGCCCAGG - Intronic
921746293 1:218743763-218743785 GTCCAAGGCAGTGGTAGCCATGG + Intergenic
924156358 1:241180771-241180793 GTGCGCTGCTGTCCTATCCATGG - Intronic
1063032071 10:2245325-2245347 GTCCACATCATTCCTAGACATGG - Intergenic
1065041920 10:21705918-21705940 GACTTCTGCAATCCTAGCCATGG - Intronic
1066037673 10:31509299-31509321 GACTCCTGCAATCCTAGCCATGG - Intronic
1068120785 10:52780297-52780319 GCCCCCTGCAGTCCTAAGCATGG - Intergenic
1069808374 10:71140431-71140453 TTCCACTGCACTCCAAGCCTGGG - Intergenic
1069917501 10:71796392-71796414 TTCCATGGCAGTCCTAGCAAGGG - Intronic
1070358515 10:75663859-75663881 CTCCCCAGCAGTCCTCGCCATGG - Intronic
1070663789 10:78329061-78329083 GACTCCTGCAATCCTAGCCACGG - Intergenic
1071823778 10:89304018-89304040 GGTCACTACAGTCCTACCCATGG + Intronic
1072066789 10:91879313-91879335 GTCCACTCCAGTCCTGGTTAGGG + Intergenic
1076086665 10:127637833-127637855 GACTCCTGCAATCCTAGCCATGG - Intergenic
1077140879 11:1024359-1024381 GGCCACTGCAGTCCCACCCAGGG + Intronic
1081396176 11:42588813-42588835 GTCTACTGCAAACCTTGCCAAGG + Intergenic
1083518523 11:63283711-63283733 GACTCCTGTAGTCCTAGCCATGG - Intronic
1084127651 11:67110911-67110933 GTGCACTGCAGTCCAAGCAATGG + Intergenic
1084705898 11:70815817-70815839 GCCCACTGCAGTCCTGGCCAAGG + Intronic
1084840113 11:71839784-71839806 GGACACTGCAATCCTAGCCAAGG + Intergenic
1085554940 11:77411571-77411593 TTCCAGTGCAGGCCTAGCCCTGG + Intronic
1088460813 11:110081015-110081037 TGCCACTGCACTCCTAGCCTGGG - Intergenic
1091912119 12:4240973-4240995 GACTCCTACAGTCCTAGCCATGG - Intergenic
1092313281 12:7382578-7382600 GGCCCTTGCAATCCTAGCCATGG + Intronic
1092578298 12:9813814-9813836 GACTCCTGCAGTCGTAGCCATGG + Intergenic
1092961166 12:13598087-13598109 GACCACTGCGGTGCCAGCCAAGG - Intronic
1095910669 12:47423652-47423674 GACCCCTGAAATCCTAGCCATGG + Intergenic
1097908383 12:64944002-64944024 GTCCACTGCTGGCCTAACCTTGG + Intergenic
1101594200 12:106149355-106149377 GTTCACTTCAGTGCAAGCCAAGG + Intergenic
1103443007 12:120977589-120977611 CTCCACTGCACTCCAAGCCTGGG + Intergenic
1104457008 12:128923562-128923584 GTGCACTGCACTCCCAGCCTGGG - Intronic
1106187907 13:27424995-27425017 AGCCACTGCAGTCGTGGCCAGGG + Intronic
1106468374 13:30033165-30033187 TCCCATTGCAGTCCCAGCCATGG - Intergenic
1107223861 13:38022141-38022163 GACCCCTGCAATCCAAGCCATGG - Intergenic
1111082367 13:83328207-83328229 GACTTCTGCACTCCTAGCCATGG + Intergenic
1111572458 13:90105329-90105351 GACTACTGCAATCTTAGCCATGG - Intergenic
1114643490 14:24240525-24240547 ATACACAGCAGACCTAGCCATGG - Exonic
1115065714 14:29257196-29257218 ATCCACTGCAGCTCCAGCCATGG - Intergenic
1117909123 14:60619640-60619662 AGCCACTGCACTCCTAGCCTGGG - Intergenic
1118538912 14:66801697-66801719 ATCCAGTGCAGTCCTAGAGATGG - Intronic
1118538948 14:66801884-66801906 ATCCAGTGCAGTCCTAGAGATGG - Intronic
1120423276 14:84315444-84315466 GACTTCTGCAGCCCTAGCCATGG + Intergenic
1121331128 14:93050461-93050483 GTCAACTTCTGTCCTATCCAAGG + Intronic
1122472485 14:101980108-101980130 GTCCAGTGCAGGACTAGCCTTGG + Intronic
1122919635 14:104874698-104874720 CTCCACTGCAGTCCTCCCCCTGG + Intronic
1123115384 14:105892067-105892089 CTCCACTGCAGTCCTGGGCCTGG - Intergenic
1123119637 14:105910785-105910807 CTCCACTGCAGTCCTGGGCCTGG - Intergenic
1124204052 15:27702243-27702265 GACCCCTGCAGTCCTAGCCAGGG - Intergenic
1124386407 15:29211490-29211512 CACTACTGAAGTCCTAGCCAGGG - Intronic
1125416003 15:39453327-39453349 GTACCCTGCAGTGCTATCCATGG - Intergenic
1127222129 15:56890975-56890997 GTCCATTACAGACATAGCCATGG - Intronic
1131404915 15:92156337-92156359 GTCCACTGCTGACAGAGCCAGGG - Intronic
1132021125 15:98363610-98363632 GCCCACTGCAGTACTAGGCCTGG + Intergenic
1135401546 16:22169623-22169645 GTGCACTGCAGACCTCCCCAGGG + Intronic
1137642932 16:50048848-50048870 TGCCACTGCACTCCTAGCCTGGG + Intergenic
1138885685 16:61075295-61075317 CTACACTCCAGTCCTAGTCACGG + Intergenic
1139661501 16:68424069-68424091 GGCCAGGGCAGTCTTAGCCAGGG + Intronic
1139846358 16:69924537-69924559 GTCCACTGCAGTCCATCCCCAGG + Intronic
1142581661 17:946859-946881 CTCCACTGCAGTCCCTGGCACGG + Intronic
1146540933 17:33694173-33694195 GTCATCTGAAGTCCCAGCCAAGG + Intronic
1147972531 17:44227117-44227139 GTCCACTCCGGGCCTAGGCAGGG + Intergenic
1148248622 17:46054074-46054096 GTCCACTGCACTCCAGGCCTGGG + Intronic
1149161429 17:53698208-53698230 GTCAACTCCAGTCCTTACCATGG + Intergenic
1150573516 17:66409361-66409383 GTCCACAGGAGTCCAAGACAAGG - Intronic
1152613489 17:81327436-81327458 GTCCACAGCAGCCCTGGTCACGG - Intronic
1153205207 18:2691901-2691923 GGCCACTGCAGCCCTAGTTATGG - Intronic
1157619576 18:49008563-49008585 GTCCTCTGCAGTCTCAACCAGGG - Intergenic
1159120717 18:64166249-64166271 TTCCTCTGCAGTCCTAGGAAAGG + Intergenic
1160576386 18:79856654-79856676 GTCCTCTGCAGTCCCAGGCGGGG - Intergenic
1161391642 19:4024205-4024227 GTCCACTGCAGGCCTCGCTCGGG + Intronic
1163114094 19:15178863-15178885 GGCCAGTGCCGTCCTAGCCCGGG - Exonic
1163735667 19:18978890-18978912 GTCCACAGCAGCTCTAGTCATGG + Intergenic
1166094716 19:40531409-40531431 GGCAAATGCAGTCATAGCCAAGG - Intronic
1166643893 19:44516952-44516974 CTCCACTTCAGTCCTGGTCAAGG - Exonic
1167896618 19:52586932-52586954 GTCCCCTGCAGGCCTCGCCCCGG + Exonic
1168179163 19:54648560-54648582 GTCCAATGCATTCGCAGCCACGG + Intronic
925202396 2:1979196-1979218 GACCACTGCCGTCACAGCCAGGG + Exonic
929760384 2:44801841-44801863 GCCCCCTGCAGCCCCAGCCAAGG - Intergenic
930055248 2:47246999-47247021 GTCCACAGCAGTTCTAGACATGG + Intergenic
935289945 2:101601738-101601760 GGGCACTGCAGTCCTAGACTTGG - Intergenic
935660241 2:105460588-105460610 GGCCCCAGCAGTGCTAGCCAAGG - Intergenic
936623949 2:114128105-114128127 GTCCACTTGAGTCCTAGAAAAGG + Intergenic
937890086 2:126931878-126931900 GACTCCTGCAATCCTAGCCATGG - Intergenic
938561196 2:132473497-132473519 GTGTACTGTAGTCCTTGCCATGG + Intronic
941754382 2:169168889-169168911 GTCCAGTGCTGTCCATGCCATGG - Intronic
943053533 2:182946356-182946378 CGCCACTGCACTCCTAGCCTGGG + Intronic
945866624 2:215182880-215182902 GGCTCCTCCAGTCCTAGCCATGG - Intergenic
947998792 2:234550597-234550619 GCCAACTGCATCCCTAGCCAGGG + Intergenic
1168806084 20:673099-673121 GTCCACTGCAGACACTGCCAAGG + Intronic
1169162971 20:3398074-3398096 GTCAACTGGAGTCCTTTCCAGGG + Intronic
1169821966 20:9721609-9721631 CACCACTGCACTCCTAGCCTGGG + Intronic
1171224006 20:23425383-23425405 GGCCACTGCAGACCTGGGCAGGG - Intergenic
1171343056 20:24445517-24445539 CTCTAGTGCAGTCCTACCCAAGG + Intergenic
1171492635 20:25532131-25532153 TGCCCCTGCAGTCCCAGCCATGG - Intronic
1174831747 20:53820028-53820050 GCCCAGTGCAGTCCTAGCGGTGG - Intergenic
1175943441 20:62548217-62548239 GTCCACGGCTGTCCTCGCCAGGG - Intergenic
1176920950 21:14686846-14686868 GTCCACTACATTCTTTGCCAAGG - Intergenic
1179809655 21:43862498-43862520 TACCACTGCACTCCTAGCCTGGG + Intergenic
1180982775 22:19886712-19886734 GCCCACTGCAGGCCTCCCCATGG + Intronic
1181610028 22:24006019-24006041 GGCCACTGCAGCCCCAACCAAGG - Intergenic
1182673068 22:32014276-32014298 CACCACTGCAGTCCCAGCCTCGG - Intergenic
1182945680 22:34319508-34319530 GACCACTGCAGTCCTCTCCATGG - Intergenic
1183625623 22:38999683-38999705 GTCACCTACAGTCCTAGCCAAGG - Intergenic
1184072994 22:42157925-42157947 TGCCACTGCACTCCTAGCCTGGG - Intergenic
1185098407 22:48824181-48824203 GTGCACAGCAGTCCAAGGCAGGG + Intronic
1185107492 22:48882691-48882713 GTGCACTGCAGACCCAGCCTGGG + Intergenic
949442636 3:4099017-4099039 GGCCACTGCAGTCCTTAACAAGG + Intronic
950217245 3:11168416-11168438 GGCCAGTGCTGTCCAAGCCAGGG + Intronic
951068321 3:18295080-18295102 CTGGACTCCAGTCCTAGCCATGG + Intronic
951868375 3:27333223-27333245 GACTCCTGCAATCCTAGCCATGG + Intronic
952966869 3:38626427-38626449 GTCAACTGAACTCCTGGCCAGGG + Intronic
964734550 3:159903238-159903260 CGCCACTGCAGCCCTTGCCACGG + Intergenic
966879654 3:184342872-184342894 GTCCACCACAGCCCTAGCCCAGG - Intronic
966934407 3:184696311-184696333 GTCCACTGCAGTCATAACTAGGG - Intergenic
967018637 3:185503522-185503544 GTCAACTGCAGTCCTTTCCCAGG + Intergenic
967076105 3:186003711-186003733 GTGAACTTGAGTCCTAGCCAAGG + Intergenic
967437471 3:189466107-189466129 TTCCCCTCCAGACCTAGCCAAGG + Intergenic
967866685 3:194195807-194195829 GGCTGCTGGAGTCCTAGCCAAGG - Intergenic
968219603 3:196926678-196926700 GGCCACTGCACTCCAACCCAGGG - Intronic
969781203 4:9405787-9405809 GGACACTGAAATCCTAGCCAAGG + Intergenic
980429641 4:132676774-132676796 CACCACTGCACTCCTAGCCTGGG + Intergenic
984995594 4:185427020-185427042 CTCCACTGCACTCCTAGCCTGGG + Intronic
985965384 5:3335576-3335598 GTCCACTGCCTTCCTAGCACAGG - Intergenic
990900056 5:60739891-60739913 GCCCAGTGCAGTCCCAGTCATGG + Intergenic
994079889 5:95696812-95696834 CACCACTGCACTCCAAGCCAGGG + Intronic
995111138 5:108429447-108429469 GTCCAATTCAGTCCAACCCAAGG - Intergenic
995417368 5:111925822-111925844 GGTCACTACGGTCCTAGCCAGGG + Intronic
998028054 5:138837661-138837683 CACCACTGCAGTCCCAGCCTGGG - Intronic
998393911 5:141806102-141806124 GTCCTCTGCAGGTCAAGCCAGGG - Intergenic
998415931 5:141945979-141946001 GTCGACTGCTTTCCTACCCAGGG - Intronic
998999318 5:147902407-147902429 TTCCACTGCACTCCAAGCCTGGG + Intronic
1001276217 5:170353626-170353648 GTCCACTTAAGTCCTCACCACGG - Intronic
1001395461 5:171416488-171416510 TTCCACTTCATTCTTAGCCAGGG + Intergenic
1004005523 6:11634163-11634185 ATCCACTGCTCTCCAAGCCAGGG - Intergenic
1006991196 6:38216399-38216421 GGCCACCATAGTCCTAGCCAAGG - Intronic
1008597740 6:53060293-53060315 GACCCCTGCTGTCCTTGCCAAGG - Intronic
1009295323 6:61940367-61940389 GACTCCTGCAATCCTAGCCATGG + Intronic
1010611008 6:77953793-77953815 AGCCACTCCAGTTCTAGCCATGG + Intergenic
1014440683 6:121470372-121470394 TGCCACTGCACTCCTAGCCTGGG + Intergenic
1015857998 6:137646109-137646131 GACTCCCGCAGTCCTAGCCACGG - Intergenic
1016116263 6:140290131-140290153 GTCTCCTGCAACCCTAGCCACGG + Intergenic
1016933126 6:149428557-149428579 ATCCTCTGGAGTCCTTGCCAGGG + Intergenic
1018616318 6:165690280-165690302 CTCCACTCCAGTCCTCTCCATGG + Intronic
1018866158 6:167748400-167748422 GTCCCCTGCAGTCCTGGCATTGG - Intergenic
1018866173 6:167748452-167748474 GTCCCCTGCAGTCCTGGCATTGG - Intergenic
1019622675 7:2000280-2000302 CGCCATTGCAGTCCTAGCCCAGG + Intronic
1019623098 7:2002169-2002191 GTTCCCTGCAGTCCTAGAAATGG - Intronic
1021327866 7:19296682-19296704 GCCCACTGCAATCTTGGCCATGG - Intergenic
1021827295 7:24568071-24568093 GTACAGTGCAGTACTATCCATGG - Intergenic
1023029267 7:36078815-36078837 GCCCACTGCAGCCCTGGCGATGG + Intergenic
1023160902 7:37294383-37294405 GTCCCATGGTGTCCTAGCCATGG + Intronic
1023278452 7:38545499-38545521 TTCCACTGCAGTCCTACCTGGGG + Intronic
1024266918 7:47613893-47613915 GTCCCCGGCAGTGCTAGGCAAGG + Intergenic
1024766344 7:52665534-52665556 TGCCACAACAGTCCTAGCCACGG + Intergenic
1027008937 7:74724884-74724906 GCCCACTGCACTCCCAGCCTGGG + Intronic
1027201092 7:76064321-76064343 GTGCACTGCAAGCCAAGCCATGG - Exonic
1030655221 7:112160158-112160180 GTGCACTGCAGTCAGAGCAAGGG + Intronic
1032253569 7:130278911-130278933 GTCCATTGTAGGCCTGGCCAGGG - Intronic
1034710401 7:153185986-153186008 GGCCACTGCAGCTCCAGCCATGG - Intergenic
1035064479 7:156095100-156095122 GCCCACTGCACCCCAAGCCATGG + Intergenic
1035157478 7:156925928-156925950 GTCCACCACAGGCCTTGCCAGGG - Intergenic
1035157491 7:156925967-156925989 GTCCACCACAGGCCTTGCCAGGG - Intergenic
1035157504 7:156926006-156926028 GTCCACCACAGGCCTTGCCAGGG - Intergenic
1036278636 8:7379704-7379726 GGACACTGCAATCCTAGCCAAGG + Intronic
1036342886 8:7932164-7932186 GGACACTGCAATCCTAGCCAAGG - Intronic
1036400382 8:8402470-8402492 GCCCAGTGCAGGCCAAGCCATGG + Intergenic
1036838228 8:12092919-12092941 GGACACTGCAATCCTAGCCAAGG - Intergenic
1036860018 8:12339167-12339189 GGACACTGCAATCCTAGCCAAGG - Intergenic
1046046661 8:108972966-108972988 GACTCCTGCAATCCTAGCCATGG - Intergenic
1047102170 8:121688916-121688938 CTACACTGAAGTCCTAGCAAGGG - Intergenic
1047952598 8:129947484-129947506 GCCCACTGCAGTTCCTGCCATGG + Intronic
1048022781 8:130555715-130555737 TCCCACTGCAATCCTAGACATGG - Intergenic
1049004344 8:139845329-139845351 CTCCACTGCATTCCTGGCCCAGG + Intronic
1049777624 8:144413838-144413860 GGCCACAGCAGCCATAGCCACGG - Exonic
1055772241 9:79729968-79729990 TCTCACTGCAGGCCTAGCCAGGG + Intergenic
1056534643 9:87516952-87516974 CTCCAGTGCAGCCCTAGGCATGG - Intronic
1057403288 9:94743683-94743705 CTCCACTCCATTCCCAGCCATGG - Intronic
1058554618 9:106153690-106153712 ATCCACAGCAGCCCCAGCCAGGG - Intergenic
1060992200 9:127855587-127855609 GACCACTGCACTCCTGGCCTAGG + Intergenic
1061593173 9:131611998-131612020 GTTCACTGCAGTTCTAGAGATGG - Intronic
1186828384 X:13364724-13364746 GTACAATGGAGTCCTATCCATGG + Intergenic
1193226077 X:78985755-78985777 GGCCACTTCAGCTCTAGCCATGG - Intergenic
1196742024 X:119033484-119033506 TTCCACTGAAATCCTAGGCAGGG - Intergenic
1200573815 Y:4864212-4864234 GACTTCTGCAATCCTAGCCATGG - Intergenic
1201735355 Y:17254464-17254486 GTGGAATGCAGTCCTAGGCATGG - Intergenic