ID: 900398737

View in Genome Browser
Species Human (GRCh38)
Location 1:2464150-2464172
Sequence TCTGGGGCTCAGAAGCAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 415
Summary {0: 1, 1: 0, 2: 2, 3: 36, 4: 376}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900398727_900398737 17 Left 900398727 1:2464110-2464132 CCTGGCGGCACAGGGTGCTGCCC 0: 1
1: 0
2: 4
3: 18
4: 216
Right 900398737 1:2464150-2464172 TCTGGGGCTCAGAAGCAGCTGGG 0: 1
1: 0
2: 2
3: 36
4: 376
900398726_900398737 18 Left 900398726 1:2464109-2464131 CCCTGGCGGCACAGGGTGCTGCC 0: 1
1: 0
2: 1
3: 9
4: 200
Right 900398737 1:2464150-2464172 TCTGGGGCTCAGAAGCAGCTGGG 0: 1
1: 0
2: 2
3: 36
4: 376
900398725_900398737 21 Left 900398725 1:2464106-2464128 CCTCCCTGGCGGCACAGGGTGCT 0: 1
1: 0
2: 1
3: 21
4: 308
Right 900398737 1:2464150-2464172 TCTGGGGCTCAGAAGCAGCTGGG 0: 1
1: 0
2: 2
3: 36
4: 376
900398731_900398737 -4 Left 900398731 1:2464131-2464153 CCACTGTCCAAGAGAGGGCTCTG 0: 1
1: 0
2: 0
3: 29
4: 224
Right 900398737 1:2464150-2464172 TCTGGGGCTCAGAAGCAGCTGGG 0: 1
1: 0
2: 2
3: 36
4: 376
900398730_900398737 -3 Left 900398730 1:2464130-2464152 CCCACTGTCCAAGAGAGGGCTCT 0: 1
1: 0
2: 0
3: 8
4: 139
Right 900398737 1:2464150-2464172 TCTGGGGCTCAGAAGCAGCTGGG 0: 1
1: 0
2: 2
3: 36
4: 376

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900398737 Original CRISPR TCTGGGGCTCAGAAGCAGCT GGG Intronic
900398737 1:2464150-2464172 TCTGGGGCTCAGAAGCAGCTGGG + Intronic
900462653 1:2808952-2808974 TCTGGGGCTGTGGAGGAGCTGGG + Intergenic
901137922 1:7009659-7009681 TCTGGGGGACAGAAGCAGCAGGG - Intronic
901708375 1:11094503-11094525 TCAGGGGTTCAGGAGCAGCCTGG - Intronic
901892081 1:12275297-12275319 TCTCGGCCTCCCAAGCAGCTGGG - Intronic
902490118 1:16775387-16775409 TCAGGTGCACAGAAGGAGCTGGG + Intronic
902536262 1:17120649-17120671 CCTGCCACTCAGAAGCAGCTGGG - Intergenic
905250249 1:36643790-36643812 TCTGGGACTCAGGAGTAGATAGG - Intergenic
905455360 1:38084535-38084557 TCTGGGGCTCATCTGCACCTAGG + Intergenic
907328975 1:53659088-53659110 TCTGGGCCTCAGAGGGTGCTGGG + Intronic
907599099 1:55748757-55748779 CCTCAGTCTCAGAAGCAGCTGGG + Intergenic
907737743 1:57131472-57131494 TCTGGGACTCAGAAGTATCTGGG - Intronic
908247913 1:62242583-62242605 TCTGGGACCCAGAAGAGGCTGGG + Intronic
911086292 1:93980171-93980193 ACTGGAGCTGAAAAGCAGCTGGG - Intergenic
912497860 1:110102914-110102936 TCTGAGACCCTGAAGCAGCTTGG + Intergenic
913155475 1:116092759-116092781 TCTGCGCAGCAGAAGCAGCTAGG - Intergenic
913330820 1:117665967-117665989 TCTGGGCTGCTGAAGCAGCTGGG - Intergenic
915031259 1:152882178-152882200 TCGGGGGTTCAGAACCAGCCTGG - Intronic
915206580 1:154274454-154274476 TCAGGAGCTCAAAAGCAGCCTGG - Intronic
915609716 1:156981590-156981612 TCTCGGCCTCCGAAGTAGCTGGG + Intronic
915938168 1:160100999-160101021 CCTGGGGCTGGGAAGGAGCTGGG + Intergenic
915963121 1:160283556-160283578 TCTGGGGCCCCGAAGCATCAGGG + Exonic
916001142 1:160617038-160617060 TCTCGGCCTCCCAAGCAGCTGGG - Intronic
916786468 1:168090597-168090619 CCTGGGGCACAGCAGCAGCACGG - Exonic
917516693 1:175714463-175714485 TCTGGGGCGCAGTGCCAGCTGGG - Intronic
917978625 1:180255886-180255908 TCTGGGGATCAGATGCATCTGGG + Intronic
919388809 1:196955383-196955405 TAGGGGGCTCAGAAGAAGATAGG - Intronic
919576636 1:199318438-199318460 TCTTGGGCTCACAACCTGCTGGG + Intergenic
919671667 1:200344022-200344044 GCTGAGCCTCAGAATCAGCTGGG + Intergenic
920305478 1:205015583-205015605 TATGGGCCTCAGAAGGGGCTGGG + Intronic
920388057 1:205581802-205581824 TCTGAGGCTCAGCAGCAGCTGGG - Intronic
920783619 1:209019522-209019544 TGGGGGGCTCAGAAGAAGATAGG + Intergenic
921046800 1:211483589-211483611 TCCTGGGGTCAGTAGCAGCTAGG + Intronic
921441073 1:215186800-215186822 TCTGGGGCTAAAAAGCACTTGGG + Intronic
923530319 1:234807143-234807165 TCAGGTGCACAGAAGGAGCTGGG - Intergenic
923715780 1:236423894-236423916 TCAGGAGCTCAAAACCAGCTGGG + Intronic
1063016717 10:2085262-2085284 TCTTGGCCTCCTAAGCAGCTTGG + Intergenic
1063670111 10:8093418-8093440 TCTGGAGCTCACAACCAGCCTGG + Intergenic
1063707973 10:8449360-8449382 TCTTGGCCTCCCAAGCAGCTGGG - Intergenic
1064249763 10:13697889-13697911 TCTGGGCTTCAGAGGCTGCTGGG + Intronic
1064652978 10:17527987-17528009 TCTGGGAGTCAGGAGCTGCTGGG - Intergenic
1065751155 10:28888995-28889017 CCTTGGCCTCATAAGCAGCTGGG + Intergenic
1066056557 10:31686478-31686500 TCTGTGTCCCAGCAGCAGCTTGG - Intergenic
1066126821 10:32349807-32349829 TCAGGAGCTCAGGAGCAGCCTGG - Intronic
1067381029 10:45773577-45773599 ACTGGGTCTCAGAAGAGGCTTGG + Intronic
1067712864 10:48664229-48664251 GCTGGGGCTCAGAAGCTTTTGGG + Intergenic
1067888728 10:50114216-50114238 ACTGGGTCTCAGAAGAGGCTTGG + Intronic
1068283797 10:54909713-54909735 TCTGGGTCACAGCAGCTGCTTGG + Intronic
1068435928 10:56991064-56991086 TCTGGGGCTCACAAGCAAGTTGG + Intergenic
1068599945 10:58946369-58946391 TCTGGGGCTCAGAAGTTGACAGG + Intergenic
1070979084 10:80630171-80630193 TCTGGGGCTCTCAATCAGCCTGG - Intronic
1072393501 10:95014474-95014496 TCAGGAGCTCACAAGCAGCCTGG - Intergenic
1072754625 10:98010991-98011013 TCTGTGGCTCAGCTGCAGCTTGG - Intronic
1073142170 10:101255319-101255341 TCTTGGGCTCTGAAGCATTTGGG - Intergenic
1073509339 10:104033683-104033705 TCTGGGACCCAGAACGAGCTAGG + Intronic
1073576586 10:104631120-104631142 TCTGCAGCTCAGAAGAAGCGTGG - Intergenic
1077504500 11:2923831-2923853 TCTGGTTCCCAGCAGCAGCTTGG + Intronic
1077583053 11:3429569-3429591 CCTGGGGCTCCAAAGCTGCTGGG + Intergenic
1080682028 11:34486212-34486234 TCTGAGGCTCAGGAGCAGGGAGG + Intronic
1082767669 11:57181848-57181870 TCTGGTGCTCAGAGGCTCCTGGG + Exonic
1083624655 11:64066085-64066107 TCAGGAGCTCAAGAGCAGCTTGG + Intronic
1083945706 11:65921431-65921453 TCTGGGGGGCAGAAGGCGCTAGG - Exonic
1083981282 11:66172645-66172667 TCAGAGATTCAGAAGCAGCTGGG - Intronic
1084239965 11:67812372-67812394 CCTGGGGCTCCGAAGCTGCTGGG + Intergenic
1084357807 11:68651422-68651444 TCTGGCTCCCAGCAGCAGCTGGG + Intergenic
1084697048 11:70761970-70761992 GCTGGGGCTGAGAACCACCTGGG - Intronic
1084786012 11:71442018-71442040 TATGGGGCTGGGAAGGAGCTGGG + Intronic
1086346973 11:85906767-85906789 TCTCGGCCTCATAAGTAGCTGGG - Intronic
1088326637 11:108607821-108607843 TCTGAGGATCAGAATCACCTGGG + Intergenic
1088634710 11:111808656-111808678 TCTGGGGCTCAGAAACGGACTGG - Intronic
1089472008 11:118729070-118729092 TTGTGGGCTCAGAAGAAGCTAGG - Intergenic
1089679393 11:120110903-120110925 TCTGGTGCTCAGACGCAGGCTGG - Intergenic
1089794264 11:120967567-120967589 GCTAGGGGTCAGAGGCAGCTGGG - Intronic
1090420911 11:126574304-126574326 TATGGGGCTCTGAAGGAGGTGGG - Intronic
1090923060 11:131224185-131224207 TCTGCAGCCCAGAAGAAGCTAGG + Intergenic
1091424992 12:380150-380172 ACTCAGCCTCAGAAGCAGCTGGG - Intronic
1091560708 12:1610743-1610765 TCTGGGGCTGCGTAGGAGCTGGG + Intronic
1091788656 12:3258370-3258392 TCTGGGGCCCAGAATCACCTTGG + Intronic
1092179383 12:6435002-6435024 CATGAGGCTCAGAAACAGCTGGG + Intergenic
1093848824 12:24010723-24010745 TCAGGGGCTCATGACCAGCTTGG + Intergenic
1097078861 12:56414667-56414689 TCTGGGGCTCTGTATCAACTTGG + Intergenic
1098787549 12:74779240-74779262 ACAGGGGCTCATAAGCAGTTAGG + Intergenic
1099009304 12:77272723-77272745 TCTGGGTTTCAGAAGGAGCAAGG + Intergenic
1099505452 12:83470787-83470809 CCTGGGGATGAGAACCAGCTTGG - Intergenic
1099927881 12:89040227-89040249 CCTGGGTCTGAGAAGCAGCTGGG + Intergenic
1101346265 12:103889108-103889130 TCAGGGACACAGAAGGAGCTGGG + Intergenic
1101550905 12:105760670-105760692 TCTGGGGCTCAAGTTCAGCTTGG - Intergenic
1101753247 12:107600748-107600770 TCTGGGTCTCACCAGCAGGTTGG - Intronic
1101889505 12:108700135-108700157 TAAGGGGCTCAGAAACAGCGGGG + Intronic
1102888921 12:116543014-116543036 TCGAGGGCTCAGATGCAGCGTGG - Intergenic
1103443761 12:120980856-120980878 GCGGGGGCTCAGACCCAGCTGGG + Intronic
1104060598 12:125264603-125264625 TAGGGGTCTCAGAAGCAGTTGGG + Intronic
1104279523 12:127362048-127362070 CCTGGGCCTCTGAAGTAGCTAGG + Intergenic
1105282088 13:18971577-18971599 TCAGGAGTTCACAAGCAGCTTGG - Intergenic
1105302912 13:19151668-19151690 CGTGGGGCTCAGAAGCAGGCTGG + Intergenic
1105958804 13:25310153-25310175 TCTGGGGTTCCCAAGTAGCTAGG + Intronic
1108031159 13:46231149-46231171 TCTAGGGCTCAGAAGAAGACAGG - Intronic
1108128198 13:47268041-47268063 TCTGGGGTTCAAGACCAGCTTGG + Intergenic
1110806800 13:79764535-79764557 TCAGGGGTTCAGAACCAGCCTGG - Intergenic
1111479844 13:88810378-88810400 TGTGGGGCTCAGAAGAAGACAGG + Intergenic
1113888166 13:113671846-113671868 TCTGTGGTGCAGAACCAGCTGGG + Intronic
1113920403 13:113905038-113905060 GCTGGGGCTCGGATGCAGGTTGG - Intergenic
1114446935 14:22795867-22795889 TCTCTGCCTCAGAAGAAGCTGGG - Intronic
1115818347 14:37187517-37187539 TCTCCGGCTCCCAAGCAGCTGGG + Intergenic
1116016087 14:39408889-39408911 CCTGGGCCTCCCAAGCAGCTGGG + Intronic
1116562229 14:46395213-46395235 TCTCAGCCTCACAAGCAGCTGGG + Intergenic
1117999788 14:61512165-61512187 TCTGGGGATCAGAAGCACTCAGG + Intronic
1118087248 14:62431900-62431922 GCTGGGGTAGAGAAGCAGCTTGG - Intergenic
1118284672 14:64460814-64460836 TCTGGGGTTCAAGACCAGCTTGG + Intronic
1118563012 14:67107584-67107606 AGTAGGGCTCAGCAGCAGCTCGG + Intronic
1118762838 14:68890941-68890963 TCTGGGGGACAGATGTAGCTTGG - Intronic
1118980850 14:70715596-70715618 TCTGAGCCTCCGAAGTAGCTGGG - Intergenic
1119327830 14:73772047-73772069 TCTGGGGCCCTGAGCCAGCTGGG + Intronic
1119730505 14:76948112-76948134 TGTGGAGCTCTGAACCAGCTCGG - Intergenic
1119788039 14:77327277-77327299 CCTATGGCTCAGCAGCAGCTGGG + Intronic
1120799878 14:88676074-88676096 TGGAGGGCTCAGAAGCAGATAGG - Intronic
1122546961 14:102528408-102528430 CCTGAGCCTCTGAAGCAGCTGGG - Intergenic
1123053499 14:105559035-105559057 TCTGGGGCTCTGGAGCCCCTGGG + Intergenic
1123078076 14:105679449-105679471 TCTGGGGCTCTGGAGCCCCTGGG + Intergenic
1123923000 15:25083799-25083821 TCTGTGGCTGAGAGACAGCTTGG + Intergenic
1123931910 15:25176002-25176024 TCCATGGCTCAGAAGCAGCATGG - Intergenic
1123933591 15:25183476-25183498 TCCATGGCTCAGAAGCAGCATGG - Intergenic
1123944717 15:25233463-25233485 CCCATGGCTCAGAAGCAGCTTGG - Intergenic
1124071245 15:26394892-26394914 TCTGGGGCCCAGAAGCAGGCAGG - Intergenic
1124395093 15:29294077-29294099 TCTGGTGCTCAGAAGCAAAGAGG + Intronic
1125490549 15:40145427-40145449 TCTTGGCCTCTGAAGTAGCTGGG - Intergenic
1127466335 15:59248272-59248294 TCTGGAGCTCATAACCAGCCTGG + Intronic
1128359657 15:66953108-66953130 CCCGGGGCTCAGAAGCAGCCTGG - Intergenic
1128471306 15:67956024-67956046 TCTGTGGGTCAGGAACAGCTTGG - Intergenic
1128780930 15:70358218-70358240 TCTGGGGCAGAGCAGCTGCTGGG + Intergenic
1130292345 15:82613952-82613974 GCAGGGACTCAGAAGCAGCGAGG - Intronic
1130559503 15:84947100-84947122 TGTGGGGCTCACAAGGAGCAAGG - Intergenic
1130927792 15:88398199-88398221 TCTGTGCATCAGAAGCAGCTAGG + Intergenic
1132366161 15:101258589-101258611 TCTGGGTATCAGAATCATCTTGG - Intergenic
1132408148 15:101557244-101557266 TCTGGTGCTCAGACGCAGGCAGG + Intergenic
1133560464 16:6945773-6945795 TCTCGGCCTCCGAAGTAGCTGGG - Intronic
1133771968 16:8871911-8871933 TCTTGGGCTCCCAAGTAGCTGGG - Intergenic
1134027590 16:10966098-10966120 TCTGGGTATCAGAATCACCTGGG + Intronic
1134172227 16:11977307-11977329 TCTGGGGACCAGAAGCTCCTGGG - Intronic
1134567848 16:15266544-15266566 TCCCGGGATCGGAAGCAGCTCGG - Intergenic
1134734587 16:16489809-16489831 TCCCGGGATCGGAAGCAGCTCGG + Intergenic
1134932883 16:18222097-18222119 TCCCGGGATCGGAAGCAGCTCGG - Intergenic
1137365410 16:47855594-47855616 TCTGGGACCCAGAATCAGCTGGG + Intergenic
1137753228 16:50881923-50881945 TCTGGGCCTCACAAGCATCTGGG - Intergenic
1138559833 16:57794903-57794925 TCTGGGGGTAGGAAGCACCTGGG - Intronic
1139282225 16:65780692-65780714 TCTGGGGCCCAATAGTAGCTTGG - Intergenic
1139324120 16:66138745-66138767 CCTGGGGCCAAGAAGCCGCTAGG - Intergenic
1139327862 16:66165944-66165966 TCTGGAGCCCAGAAGCAGACTGG + Intergenic
1139704966 16:68734930-68734952 TCTGGGGGTCAGAAGATCCTGGG + Intergenic
1139901363 16:70330927-70330949 TCTGAGCCTCCCAAGCAGCTGGG - Intronic
1139949482 16:70662216-70662238 CCTGGGGGTCAGGAGCACCTTGG - Exonic
1140805097 16:78525991-78526013 ACTGGGTGTCAGAAGCAGATAGG - Intronic
1141057646 16:80833426-80833448 AGTGGGGTTCAGAAGCAGCAGGG - Intergenic
1141505027 16:84471349-84471371 CCTGGGGCTCAGCAGCACCAGGG + Intergenic
1141867962 16:86763672-86763694 TGTGGGGATCAGAAGAAGCAAGG - Intergenic
1143092620 17:4457918-4457940 TCTGGCGCTGGGAAGCTGCTGGG + Intronic
1144107158 17:11996929-11996951 TCTGGTTGTCACAAGCAGCTAGG + Exonic
1144327734 17:14197834-14197856 TCCTGTGCACAGAAGCAGCTGGG - Intronic
1144450885 17:15377438-15377460 TGTGGAGCTCAGAAGCAACCTGG - Intergenic
1144632393 17:16880859-16880881 TCTGGGGCTGCAAGGCAGCTGGG + Intergenic
1144638108 17:16923751-16923773 TCTGGGGCTGCGACGCAGCTGGG + Intergenic
1144786539 17:17835437-17835459 TCTGGGGCTGGCAACCAGCTGGG + Intronic
1144863590 17:18320860-18320882 GCTGGCCCTCAGAAGCAGCGTGG - Intronic
1144948591 17:18982252-18982274 CCTGGGGCTCAGCAGCAGGTGGG + Intronic
1145005715 17:19336613-19336635 TCTGGGACTGAGAAACAGCTGGG - Exonic
1146149476 17:30454544-30454566 TGTAGGGCTCAGAAGAAGATGGG - Intronic
1146529889 17:33599495-33599517 TCTGGGGCTCAGAACTACCGGGG + Intronic
1146579629 17:34025174-34025196 TCAGGGGCTCAGAAGGAACAAGG - Intronic
1146775651 17:35612717-35612739 TCTGGGACTCAGAACTAGGTTGG - Intronic
1146968610 17:37054213-37054235 CCTGGGGCCCAGGAGCAGCATGG - Intronic
1148352690 17:46951878-46951900 TCTGGGGGGGAGAAGCAGCGAGG - Intronic
1148774527 17:50088101-50088123 GCTGGGGCTCAGTCCCAGCTTGG - Intronic
1149219388 17:54398551-54398573 TCGAGGGCTCAGAAGAAGATAGG + Intergenic
1149916634 17:60615292-60615314 CCTGGGCCTCCCAAGCAGCTGGG - Intronic
1150576778 17:66437680-66437702 TGTGGGTCCCAGAAGCAACTGGG + Intronic
1150773293 17:68059804-68059826 TCAGGGGCTCAAAACCAGCCTGG - Intergenic
1150952670 17:69821196-69821218 CCTGGGGCCCAGAAGCAGGCAGG + Intergenic
1151728089 17:75895980-75896002 GGTGGGTCTCAGAAGCTGCTCGG - Intronic
1154105228 18:11517150-11517172 TCTGGAGCTCAGACGCGGGTTGG - Intergenic
1154192476 18:12242428-12242450 CCTGGGGCTCCCAAGTAGCTAGG + Intergenic
1155918388 18:31578209-31578231 ACTGGGGCTCAGAAGCAGTCTGG + Intergenic
1156307354 18:35889930-35889952 TCTGAAAGTCAGAAGCAGCTAGG - Intergenic
1157099586 18:44717094-44717116 CCTGGGTCTCAGAGGCAGCCAGG + Intronic
1158273394 18:55740988-55741010 TCTCAGTCTCCGAAGCAGCTGGG + Intergenic
1160602613 18:80025463-80025485 TCGGGGAATCAGCAGCAGCTGGG - Intronic
1161183770 19:2902191-2902213 CCTGGGGGTCAGAGGCAGTTTGG + Intronic
1161453738 19:4360246-4360268 CCTTGGGCTCAGGAGCACCTGGG + Intergenic
1161775673 19:6260876-6260898 TCTGAGGTTCAGAAGCAGTTTGG - Intronic
1161915029 19:7221920-7221942 CTTGGGGTTCTGAAGCAGCTGGG + Intronic
1161961321 19:7524964-7524986 GTTGGGGGTCAGAAGCCGCTCGG - Exonic
1162027198 19:7901049-7901071 TCTGGGGCCCAGGAGGATCTGGG + Exonic
1162083075 19:8231046-8231068 TCAGGGGTTCAAGAGCAGCTGGG - Intronic
1162472050 19:10878093-10878115 CCTGAGCCTCAGAAGTAGCTGGG + Intronic
1162832467 19:13294696-13294718 TCAGGGGTTCAGAACCAGCTTGG - Intronic
1163298705 19:16429706-16429728 TCAGGGGCTCAGCAGCAGCCAGG - Intronic
1163303006 19:16459547-16459569 TCTGTGGCTCAGTAGCAGTGAGG + Intronic
1165500444 19:36185000-36185022 TCTCGGTCTCCCAAGCAGCTGGG - Intronic
1165712875 19:38024545-38024567 TCTGGGGCCCAGGGCCAGCTGGG - Intronic
1165795208 19:38515303-38515325 TCTGGGGCTGTGAAGCAGGCAGG + Intronic
1166127093 19:40721576-40721598 TCAGGAGCTCAGAACCAGCCTGG - Intronic
1166583163 19:43920850-43920872 TCTCGGCCTCAGAAACTGCTGGG + Intronic
1166933389 19:46315796-46315818 TCTCGGCCTCCCAAGCAGCTGGG - Intronic
1167041187 19:47023332-47023354 TCCGGGGCTCAGAGGCATCAGGG + Intronic
1167429060 19:49443815-49443837 GCTGAGGCTCAGAGGCCGCTGGG - Intergenic
1167430064 19:49449074-49449096 TCTCAGGCTCCCAAGCAGCTGGG - Intronic
925901586 2:8512992-8513014 TCAGGGGCACAGCAGCAGCAGGG - Intergenic
927073250 2:19551038-19551060 TGTGGGGCTTGGGAGCAGCTGGG + Intergenic
931218785 2:60270414-60270436 TCTGTGGCTCTGAAGCAGGCAGG - Intergenic
931790111 2:65657389-65657411 TCTGAGGCTCAGAAAATGCTTGG - Intergenic
932236366 2:70124157-70124179 GCTGGGGCTCTGGAGGAGCTTGG + Intergenic
933828761 2:86189170-86189192 TCTGCGGGTTAGAAGCAGCAAGG - Intronic
934093315 2:88574254-88574276 TCCAGGGCTCTGAAGCAGCATGG - Intronic
935013814 2:99160290-99160312 TCTCAGCCTCTGAAGCAGCTGGG - Intronic
936089814 2:109494364-109494386 TCTGGGGCTCATGAGCAGTTTGG - Intronic
937377451 2:121347360-121347382 TCTGGGGTGCAGAAGCAGGAGGG + Intronic
938090406 2:128427579-128427601 TCTGGGGGGCAGCAGCAGCTGGG + Intergenic
938380384 2:130833072-130833094 TCTGGAGTTCAAAACCAGCTTGG + Intergenic
939663933 2:144926332-144926354 TCTGGAGCTGAGTAGCTGCTGGG - Intergenic
939782781 2:146469863-146469885 TTTGGAGCTCTGTAGCAGCTTGG - Intergenic
942560224 2:177212173-177212195 TGTGGGACTCACAAGCACCTTGG - Intergenic
943400675 2:187406067-187406089 TGTGGGGCTCTGAAGCAGTTGGG + Intronic
943661074 2:190559896-190559918 TCTGGGATTCAGATGCAGATAGG + Intergenic
946337517 2:219048483-219048505 TCAGGAATTCAGAAGCAGCTTGG + Intergenic
946673431 2:222131134-222131156 TCTGGGGCACAAAATCAGCCCGG - Intergenic
947408517 2:229808080-229808102 TCTTGGCCTCCCAAGCAGCTGGG + Intronic
948100868 2:235371668-235371690 ACTGCAGCTCAGAATCAGCTGGG - Intergenic
948671317 2:239570577-239570599 TCTGGGCCTCAGCAGCTGTTGGG + Intergenic
948757697 2:240168905-240168927 CCTTGGGGTCAGGAGCAGCTTGG + Intergenic
948855778 2:240729936-240729958 TCTGGGGCTGACCAGCAGTTTGG - Intronic
949066644 2:241994728-241994750 TCTGGCTCTCAAAACCAGCTGGG + Intergenic
1169119473 20:3086289-3086311 TCTGGGTCTCCCAAGTAGCTGGG - Intergenic
1169189791 20:3651304-3651326 TCTGTGGCTCACAAGCTGCCTGG - Intergenic
1170500120 20:16966890-16966912 TCTGAGGCCCAGAAGAAGCAAGG - Intergenic
1171136112 20:22696026-22696048 TCTCGGCCTTACAAGCAGCTGGG - Intergenic
1171313130 20:24162020-24162042 TCCGTGGCTCAGAAGTAGGTTGG - Intergenic
1172978205 20:38921943-38921965 CCTGGGTCTCAGCAGGAGCTAGG - Exonic
1173219015 20:41115958-41115980 TCTGAGGCTCCTAAGCAGCTGGG - Intronic
1173551531 20:43936244-43936266 TTGGGGGCTGGGAAGCAGCTGGG - Intronic
1174163384 20:48567516-48567538 TCTGGGGCCCTGAAGCAGGTGGG - Intergenic
1174285385 20:49469080-49469102 TCTGGGGCTCAGAGGCTCCCAGG + Intronic
1178589625 21:33898450-33898472 TCTGTGCCCCAGAAGCAGCCTGG - Exonic
1180883399 22:19222636-19222658 ACTGGGGCCCAGAGGCAGCCGGG + Intronic
1182326020 22:29513570-29513592 TCTTGGCCTCCTAAGCAGCTGGG - Intronic
1182348141 22:29681354-29681376 TCTGCGGCCCACAAGCTGCTTGG - Intronic
1182474796 22:30571191-30571213 CCTGGGACTGAGAAGGAGCTGGG + Intronic
1183276427 22:36900952-36900974 TCTGGGGGTCAGGAGCACCAGGG - Intergenic
1183402012 22:37610054-37610076 CCTGGGTCTCAGCAGCAACTGGG + Intronic
1184197293 22:42938485-42938507 GCAGTGGCTCAGAAGCAGGTAGG + Intronic
1184555919 22:45233076-45233098 ACTGAGGCTCAGAAGCAGGAGGG - Intronic
1184742690 22:46438229-46438251 TGTGGGGATGAGAGGCAGCTGGG + Intronic
1184762334 22:46551607-46551629 CCTGGGACCCAGAAGCGGCTAGG - Intergenic
1184835319 22:47017519-47017541 TGTGTGTCTCAGAAGCCGCTGGG - Intronic
950005631 3:9689306-9689328 TGTGGGACAGAGAAGCAGCTGGG + Intronic
950029166 3:9840576-9840598 TCTTCCCCTCAGAAGCAGCTGGG + Exonic
950078344 3:10203469-10203491 TCTGGGGCTCAGTGGAACCTTGG - Intronic
950463569 3:13140011-13140033 GTTGGAGCTCAGGAGCAGCTGGG - Intergenic
950881368 3:16325431-16325453 TAGGTGGCTCAGAACCAGCTGGG + Intronic
951397910 3:22192701-22192723 TCTGGAGTTCAGAAGAAGCTTGG - Intronic
951443015 3:22744413-22744435 TCTGATGCTCAGAATTAGCTGGG - Intergenic
951740087 3:25911965-25911987 TCAGGAGTTCAGGAGCAGCTTGG + Intergenic
952656481 3:35792527-35792549 TCAGGTGCTCATAAGCAGCTTGG + Exonic
952787817 3:37173316-37173338 TCTCAGCCTCACAAGCAGCTGGG + Intronic
955285191 3:57633677-57633699 TCAGGGGCTCAGGACCAGCCTGG + Intronic
956705635 3:71996542-71996564 TCTGGGATTCAGAAGCAGGGAGG - Intergenic
956705805 3:71998103-71998125 TTTGGGGCTATGAAGCAACTTGG - Intergenic
956934960 3:74090025-74090047 TCTGGGAAACAGAAGCAGTTTGG - Intergenic
959453474 3:106531581-106531603 TGGGGGGCTCAGAAGAAGATAGG + Intergenic
960706588 3:120488413-120488435 TCAGGGCCTCCTAAGCAGCTGGG - Intergenic
961298948 3:125909562-125909584 CCTGGGGCTCCAAAGCTGCTGGG - Intergenic
961331859 3:126147271-126147293 AGTGGGGGTCAGGAGCAGCTGGG - Intronic
961466260 3:127083682-127083704 TCTGGTTGTCAGAAGGAGCTTGG + Intergenic
961673658 3:128551869-128551891 TCTGGGACACAGAAGGAGGTGGG - Intergenic
961746424 3:129066274-129066296 GCTGGGACTCAGCAGCACCTGGG + Intergenic
964364513 3:155935006-155935028 TATGGGCCTCAAAATCAGCTTGG - Exonic
964620156 3:158713122-158713144 TCTTGTGCTGAGAAGCAGCCTGG - Intronic
964624766 3:158748456-158748478 TCTGGAGTTCAGCAGCTGCTGGG - Intronic
965063764 3:163816726-163816748 TCAGGAGCTCAGAATCAGCTTGG + Intergenic
966027003 3:175296375-175296397 TCAAGGGCTCAGAAGTAACTGGG + Intronic
966822427 3:183935625-183935647 TCTGGAGCTCTGGAGTAGCTGGG + Intronic
968957190 4:3725426-3725448 TCAGCCCCTCAGAAGCAGCTTGG - Intergenic
969600745 4:8174684-8174706 TATGGGCCTCAAAATCAGCTTGG - Intergenic
969693034 4:8716692-8716714 TCAGGAGCTCAAAAGCAGCCTGG + Intergenic
969815634 4:9685365-9685387 CCTGGGGCTCCAAAGCTGCTGGG - Intergenic
970882013 4:20943666-20943688 CCTGGGGTTCAAAACCAGCTTGG - Intronic
971665994 4:29485856-29485878 CCTGGGCCTCTGAAGTAGCTGGG + Intergenic
971939695 4:33199195-33199217 TTGAGGGCTCAGAAGAAGCTAGG + Intergenic
972067304 4:34964892-34964914 TCTGAGTCACAGATGCAGCTGGG + Intergenic
973685699 4:53367361-53367383 TCAGGGGCTCAAGACCAGCTTGG + Intergenic
976211653 4:82677344-82677366 TCTGGGCCCCAAATGCAGCTGGG + Intronic
978153995 4:105468923-105468945 TCTGAGGTTCTGCAGCAGCTCGG + Intronic
981237877 4:142439221-142439243 TCTGGGGCTCCCCATCAGCTTGG + Intronic
981343231 4:143646863-143646885 TGTAGGGCTCAGAAGAAGATAGG + Intronic
981343236 4:143646920-143646942 TGTAGGGCTCAGAAGAAGATAGG + Intronic
983289936 4:165789440-165789462 TCTGGAGCTCAGAAGGACCTTGG + Intergenic
983591193 4:169413281-169413303 TCTCTGCCTCCGAAGCAGCTGGG + Intronic
984229624 4:177079067-177079089 TCAGGAGCTCAGGAGCAGCCTGG - Intergenic
985167223 4:187109562-187109584 TCTGGGTCCCAGGAGCAGTTGGG + Intergenic
986077348 5:4351781-4351803 TCAGGGGTTCAAAACCAGCTGGG - Intergenic
987048847 5:14132474-14132496 TGTGAGGCTAATAAGCAGCTAGG - Intergenic
988035737 5:25824973-25824995 CCTCGGCCTCCGAAGCAGCTGGG + Intergenic
989534871 5:42551664-42551686 TGTAGGGATCAGAAGCAGGTAGG + Intronic
989547966 5:42696606-42696628 TCAGGGACTCAGGAGCAGTTAGG + Intronic
989812405 5:45695228-45695250 TCTGGGGCTCAGAAGAAGACTGG - Intronic
990211371 5:53483566-53483588 TCCGGGGCGCAGACGCAGCGGGG - Exonic
991535813 5:67668424-67668446 TGGAGGGCTCAGAAGCAGATAGG + Intergenic
991612908 5:68467018-68467040 ACTGGGGCTCAGAAACAAATAGG - Intergenic
991688273 5:69201741-69201763 CCTCAGCCTCAGAAGCAGCTGGG - Intronic
994489121 5:100419330-100419352 ACTGGGGCACAGAAGGAGGTGGG + Intergenic
994670007 5:102754036-102754058 GCTGGGGATCTGGAGCAGCTCGG + Intronic
997583851 5:135033598-135033620 TCTGGGGCGGAGAGGGAGCTTGG + Intronic
1000944932 5:167410334-167410356 TATGGTGCTCAGAATCATCTTGG + Intronic
1001494645 5:172179307-172179329 TTTGGGGCTCAGTAGGATCTGGG - Intronic
1001880098 5:175235871-175235893 TCTTGGGCTGAGAAGCAGGTGGG - Intergenic
1002159829 5:177308486-177308508 TCTCGGCCTCACAAGTAGCTGGG + Intronic
1002503983 5:179666103-179666125 TCTGAGGCTCCCAAGTAGCTGGG + Intergenic
1006430441 6:33992708-33992730 TCTGGGGCTGATGGGCAGCTGGG - Intergenic
1006693595 6:35911679-35911701 TCTCGGCCTCCGAAGTAGCTAGG + Intronic
1006896568 6:37475154-37475176 TCTGATGCTGAGGAGCAGCTGGG + Intronic
1007110737 6:39312290-39312312 TCTGGTGCTCAGAAAGATCTGGG + Intronic
1007191686 6:40024113-40024135 TCAGAGGCTGAGAAGCAGCCTGG + Intergenic
1010311670 6:74393508-74393530 TCTGTGCCTCCCAAGCAGCTGGG - Intergenic
1011229008 6:85138964-85138986 TCTGGAGCTCAGAAAGAGCGAGG - Intergenic
1011412023 6:87075669-87075691 TCAGGGGCTCAAGATCAGCTTGG + Intergenic
1011774731 6:90717006-90717028 ACTGAGGCTCAGAGGCAGCCAGG + Intergenic
1012436491 6:99220168-99220190 TCAGGGGCTCACAGGCAGATGGG - Intergenic
1012887543 6:104862264-104862286 TCTGGGCCACAGAAGAACCTGGG - Intergenic
1014104421 6:117546769-117546791 TCTGGGTGTGAGAAGCAGCATGG - Intronic
1015674095 6:135725495-135725517 TGGGGGGCTCAGAAGAAGATGGG + Intergenic
1015808163 6:137133262-137133284 GGTGGGGCACAGAAGCAACTGGG - Intergenic
1016199832 6:141394396-141394418 CCTGGGGCTCAGAGGCACCCCGG - Intergenic
1016387384 6:143541924-143541946 GCTGGGGCTCAGAAGCCTCTTGG - Intronic
1016830573 6:148429625-148429647 CCTGAGGCTCCCAAGCAGCTGGG - Intronic
1017539470 6:155385451-155385473 TCTGGGGTGCAAAAGCAGCCGGG - Intergenic
1017757331 6:157540412-157540434 TTTGGGTCTGAGACGCAGCTTGG - Intronic
1017787473 6:157768374-157768396 CCTGGGGCTCAGCAGCACCCTGG + Intronic
1018681111 6:166266389-166266411 CCTGGGGCTCAGAAGTACTTGGG - Intergenic
1018848605 6:167572196-167572218 TCAGGGGCACACAAGCAGCAGGG - Intergenic
1019710622 7:2516701-2516723 TTTGGGGCTCCCAGGCAGCTGGG - Intronic
1020062017 7:5159820-5159842 TCTCAGGCTCCGAAGTAGCTGGG - Intergenic
1020166128 7:5808856-5808878 TCTCAGGCTCCGAAGTAGCTGGG + Intergenic
1020365351 7:7374758-7374780 GCTGGGCCTAAGAAGCAGCCTGG - Intronic
1020541966 7:9469824-9469846 TTAGGGGCTCAGAAGGAGATAGG + Intergenic
1021697240 7:23287032-23287054 TCAGGGGTTCAAAAGCAGCCTGG - Intergenic
1022521793 7:31013226-31013248 TCTGGGGCTGTGAAGCAGGGTGG - Intergenic
1022533949 7:31084335-31084357 GCTGGGGCTGAGAAGCAACTGGG + Intronic
1023223257 7:37943063-37943085 GCTGAGGCTCAGCAGCAGCAGGG + Intronic
1023856867 7:44189389-44189411 CCTGGGGCTCAGGCGCCGCTCGG + Intronic
1024046902 7:45591227-45591249 GCTGGGGCTGAGGAGCAGGTAGG - Intronic
1026074444 7:67153338-67153360 TCTCGGTCTCCCAAGCAGCTGGG - Intronic
1026702422 7:72658834-72658856 TCTCGGCCTCCCAAGCAGCTTGG + Intronic
1027832913 7:83203276-83203298 TGTGTGGATCAGAAGCAGCTTGG - Intergenic
1029700710 7:102245156-102245178 TCTGAGCCTCAGGAGTAGCTGGG + Intronic
1030002972 7:105085337-105085359 TCAGGGGTTCAAAACCAGCTTGG + Intronic
1030352164 7:108501706-108501728 TCTCAGTCTCCGAAGCAGCTGGG - Intronic
1034174087 7:149086956-149086978 TCTTGGCCTCCCAAGCAGCTGGG + Intronic
1034416784 7:150969480-150969502 TGTGGGGCACAGGAGCATCTGGG - Intronic
1035431941 7:158829232-158829254 CCTGGGGCTCAGCTTCAGCTGGG - Exonic
1035718228 8:1770263-1770285 TCTGGGTCTCTGCAGCTGCTGGG - Intronic
1037552675 8:19990233-19990255 TCTGGGGCTCACAAGATGGTAGG - Intergenic
1037649568 8:20824176-20824198 TCTGCTGCTCTGAAGCAGTTTGG + Intergenic
1038258235 8:25970614-25970636 TCTGGCCCGCAGAGGCAGCTTGG - Intronic
1039718339 8:40134918-40134940 TTTGGGCCTCAGAAGCATGTAGG + Intergenic
1040899448 8:52403094-52403116 GCTGGGGCACAGTAGCAACTTGG + Intronic
1042944439 8:74140899-74140921 TCTCAGGCTCTGAAGTAGCTGGG - Intergenic
1043992871 8:86777742-86777764 ACTGGGACTCAGAAGATGCTTGG + Intergenic
1044625637 8:94233297-94233319 TCAGGAGCTGAGAAGCAGCCTGG + Intergenic
1045124458 8:99073884-99073906 TCTGAGGCTCCCAAGTAGCTGGG + Intronic
1046580525 8:116086858-116086880 TCAGGGGTTCAAAACCAGCTTGG + Intergenic
1046717577 8:117584348-117584370 ACAGGGACTCAGAAGCAGGTGGG + Intergenic
1047354589 8:124108478-124108500 CCTGGGGCCCAGAAGGAGATGGG - Intronic
1047942937 8:129843650-129843672 CCTTGGGCTCACAAGTAGCTGGG + Intronic
1048275603 8:133063304-133063326 CCTGCTGCTTAGAAGCAGCTTGG - Intronic
1048292605 8:133192063-133192085 TCTGGGGCTCAGAAGCTGCCAGG - Intronic
1049339346 8:142103684-142103706 AATGGGGCTCAGACTCAGCTGGG - Intergenic
1049366464 8:142239144-142239166 TCTAGGGCTCAGGGGAAGCTTGG + Intronic
1049448848 8:142647826-142647848 TGGAGGGCTCAGAAGCAGCCAGG + Intergenic
1051244962 9:15100825-15100847 ACTGTGCCTCAGAATCAGCTGGG + Intergenic
1052879258 9:33590731-33590753 TCAGGGACTCAGAAGCAGAAGGG + Intergenic
1053098294 9:35348131-35348153 TCTGAGGGGCAGAAGCAGATAGG + Intronic
1053345839 9:37377667-37377689 TCTCGGGCTCCCGAGCAGCTGGG - Intergenic
1053496720 9:38553488-38553510 TCAGGGACTCAGAAGCAGAAGGG - Intronic
1054502864 9:65886118-65886140 TCTGGAGCTCAGGAGAGGCTTGG + Intronic
1054848843 9:69825546-69825568 TCTCTGGCTCAGAAGCATCAAGG - Intronic
1056548170 9:87630053-87630075 GCAGGGGCACTGAAGCAGCTCGG - Intronic
1057128521 9:92637832-92637854 TCTGGGGGTGAGAGGCAGCGAGG + Intronic
1057442581 9:95092517-95092539 TCTGGGGCACAGAGGCGACTGGG + Intergenic
1059528696 9:115016360-115016382 TCTGGGGCACAGAGGCTGCATGG + Intergenic
1059550918 9:115228007-115228029 TCTGGGGCTCAGCAACATATAGG - Intronic
1061071570 9:128314015-128314037 CCTGGGGCTGTGGAGCAGCTGGG - Intronic
1061200171 9:129133370-129133392 TCAGGGGTTCACATGCAGCTGGG - Intronic
1061272570 9:129551690-129551712 TCTGGGGCTGGGAAGGAACTGGG + Intergenic
1061446559 9:130641735-130641757 TCTGGGCCTCCCAAACAGCTGGG + Intergenic
1061628476 9:131856417-131856439 TCTGGGGCTCCTCAGCAGCAAGG - Intergenic
1062399157 9:136364935-136364957 TCTTGGGCACTGCAGCAGCTTGG - Intronic
1062722086 9:138049887-138049909 TCGGGGGCTCAGCTACAGCTGGG + Intronic
1185519028 X:724567-724589 GCTGGGGCTAAGAAGTAGCCAGG + Intergenic
1187055814 X:15740676-15740698 TCTGGTGCTCAGGAGCAGTCAGG - Intronic
1187118495 X:16379793-16379815 TCAGGAGTTCAAAAGCAGCTTGG + Intergenic
1188187414 X:27131537-27131559 TGGGGGGCTCAGAAGAAGATAGG - Intergenic
1188247467 X:27853513-27853535 GCTGGGGCTCAGCACTAGCTGGG - Intergenic
1188548640 X:31337758-31337780 TCTGGGCCTCATGAGGAGCTAGG - Intronic
1189743440 X:44144912-44144934 ACTGCTGCTCAGAAGCAACTTGG - Intergenic
1190152656 X:47960755-47960777 TCTGAGGGGCAGCAGCAGCTTGG + Intronic
1191784100 X:64898506-64898528 TCAAGGGCTCAGAAGAAGATAGG - Intergenic
1193938992 X:87657511-87657533 TCAGGGCCTCCTAAGCAGCTGGG + Intronic
1195668043 X:107448507-107448529 TCCGGGTGTCAGAAGCACCTCGG - Intergenic
1196706256 X:118720187-118720209 TCTGTGGCTGAGAAGTAGCAAGG + Intergenic
1197805806 X:130397494-130397516 GCTGGGGGTCAGAGGAAGCTGGG - Intergenic
1198075708 X:133191005-133191027 TCTGGGGCTGAGCAGCAGATGGG + Intergenic
1198550475 X:137740071-137740093 TCAGGGGCTCAAAAGCAGCCTGG + Intergenic
1198937095 X:141909910-141909932 TGTGGTGCTCAGAAGCCTCTAGG + Intergenic
1198961957 X:142192955-142192977 TGTGGTGCTCAGAAGCCTCTAGG - Intergenic
1199537028 X:148914265-148914287 TCTGGTACTTAGAGGCAGCTGGG + Intronic
1200091983 X:153640256-153640278 TCTCTGACTCCGAAGCAGCTGGG - Intergenic
1200165739 X:154033939-154033961 GCTGGGACTCAGAAGCTGCAAGG + Intronic