ID: 900403148

View in Genome Browser
Species Human (GRCh38)
Location 1:2480908-2480930
Sequence GAGCCAGCAAACCAGGCCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 626
Summary {0: 1, 1: 0, 2: 4, 3: 57, 4: 564}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900403139_900403148 12 Left 900403139 1:2480873-2480895 CCGTCAGCAGGTCCTGGTTCCGG 0: 1
1: 0
2: 0
3: 10
4: 122
Right 900403148 1:2480908-2480930 GAGCCAGCAAACCAGGCCCTGGG 0: 1
1: 0
2: 4
3: 57
4: 564
900403145_900403148 -7 Left 900403145 1:2480892-2480914 CCGGGTGGTGCTGGCTGAGCCAG 0: 1
1: 0
2: 0
3: 35
4: 299
Right 900403148 1:2480908-2480930 GAGCCAGCAAACCAGGCCCTGGG 0: 1
1: 0
2: 4
3: 57
4: 564
900403144_900403148 0 Left 900403144 1:2480885-2480907 CCTGGTTCCGGGTGGTGCTGGCT 0: 1
1: 0
2: 1
3: 15
4: 182
Right 900403148 1:2480908-2480930 GAGCCAGCAAACCAGGCCCTGGG 0: 1
1: 0
2: 4
3: 57
4: 564
900403138_900403148 13 Left 900403138 1:2480872-2480894 CCCGTCAGCAGGTCCTGGTTCCG 0: 1
1: 0
2: 0
3: 8
4: 92
Right 900403148 1:2480908-2480930 GAGCCAGCAAACCAGGCCCTGGG 0: 1
1: 0
2: 4
3: 57
4: 564

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900403148 Original CRISPR GAGCCAGCAAACCAGGCCCT GGG Intronic
900288404 1:1913238-1913260 GAGCCACCACACCCGGCCCCCGG + Intergenic
900403148 1:2480908-2480930 GAGCCAGCAAACCAGGCCCTGGG + Intronic
901328324 1:8383574-8383596 GAGCCACCGCACCTGGCCCTTGG - Intronic
901600959 1:10423025-10423047 GAGCCACCACGCCTGGCCCTGGG + Intergenic
902184151 1:14712519-14712541 TAGAGAGAAAACCAGGCCCTGGG + Intronic
902835370 1:19043712-19043734 GAGCCATCACACCTGGCCCTTGG - Intergenic
904108940 1:28109881-28109903 GAGCCACCACACCAGGCCTCTGG - Intergenic
904188306 1:28723221-28723243 GAGCCACCACACCCGGCCCCAGG - Intergenic
904468178 1:30720058-30720080 GAGCCAGGAGCCCAGGCCCCTGG - Intronic
904520596 1:31092400-31092422 GAGCCACCACACCAAGCCCTTGG + Intergenic
904899508 1:33845824-33845846 CAGCCAGAAAGCCTGGCCCTAGG + Intronic
904955538 1:34280451-34280473 GAGCCAGCAAACCCTGCCTGAGG + Intergenic
905115467 1:35635389-35635411 GAGCCATCATACCAGGCCGATGG + Intronic
905752050 1:40474133-40474155 GACCCAGCAATCCTGCCCCTGGG - Intergenic
906428139 1:45731649-45731671 GAGCCACCACACCTGGCCCTGGG - Intronic
907065901 1:51482748-51482770 GAGCCACCACACCCGGCCTTAGG + Intronic
907198828 1:52708762-52708784 GAGCCACCACACCCGGCCCAGGG - Intergenic
907256949 1:53186547-53186569 AAGCCAGCAATCCAAGCTCTAGG + Intergenic
909438187 1:75668604-75668626 GAGCCACCACACCCGGCCCTGGG + Intergenic
910945272 1:92584937-92584959 GAGCCACCACACCCGGCCTTGGG - Intronic
910948613 1:92620058-92620080 GAGCCAGCACGCCCGGCCCTTGG - Intronic
911083333 1:93955269-93955291 GAGCCACCACACCTGGCCTTTGG + Intergenic
911110226 1:94175985-94176007 GAGCCACCACACCTGGCCCAAGG + Intronic
911172125 1:94781139-94781161 GAGCCAGCAAACGAGACACGGGG + Intergenic
911630170 1:100174581-100174603 GAGCCACCACACCTGGCCATGGG + Intronic
911863031 1:102979078-102979100 TAGCTGGCAAACCAGGCCCTCGG - Exonic
912671537 1:111632626-111632648 GAGCCACCACACCTGGCCGTAGG - Intronic
913074985 1:115334542-115334564 GAGCCAGCAAATCAGACTCTAGG - Intronic
913102572 1:115582925-115582947 GAGCCACCACGCCTGGCCCTTGG + Intergenic
914884100 1:151570989-151571011 GAGCCACCACACCTGGCCCATGG + Intronic
915421352 1:155784827-155784849 GAGCCAGCATGCCTGGCCCCTGG - Intronic
917119830 1:171635830-171635852 GAGCCAGCCAGCCAGGGCCCAGG - Exonic
917342301 1:173992430-173992452 GAGCCACCACACCCGGCCTTAGG + Intronic
917588055 1:176448011-176448033 GAGCCACCATACCCAGCCCTAGG - Intergenic
918434855 1:184500848-184500870 GAGGCAGGAAACAAGGCCCTGGG + Intronic
918495551 1:185131854-185131876 GAGCCACCACACCTGGCCCTTGG - Intronic
919466135 1:197922864-197922886 CAGGCACCATACCAGGCCCTGGG - Intronic
922078339 1:222269771-222269793 GAGCCAGCAAAGCCTGTCCTTGG - Intergenic
922119452 1:222649480-222649502 GAGCCACCACACCAGGCCTTGGG - Intronic
922165884 1:223115533-223115555 GAGCCAGCACACCAAGCCTCAGG + Intronic
923778284 1:236999028-236999050 GAGCCACCATGCCAGGCACTGGG - Intergenic
924148938 1:241108008-241108030 GAGCCACCGCACCTGGCCCTTGG - Intronic
924241032 1:242040689-242040711 GAGCCACCATCCCTGGCCCTTGG - Intergenic
924848899 1:247803389-247803411 GAGTCAGATAACCAGTCCCTAGG - Intergenic
1063392131 10:5656932-5656954 GAGCCAGCAAACCAGGAAGATGG - Intronic
1063470096 10:6277503-6277525 GAGCCACCACACCCGGCCGTGGG + Intergenic
1063496079 10:6509691-6509713 GAGCCACCACACCCGGCCCCAGG + Intronic
1064061222 10:12139244-12139266 GAGCCACCACGCCCGGCCCTCGG + Intronic
1064594307 10:16928005-16928027 GAGCCAGCCATCCAGAGCCTGGG + Intronic
1064634119 10:17346320-17346342 GAGCCAGCACACCCAGCCCAGGG - Intronic
1065016992 10:21471160-21471182 GAGCCACCTCACCTGGCCCTGGG + Intergenic
1065762655 10:28996912-28996934 GAGCCACCACACCCAGCCCTGGG + Intergenic
1065853700 10:29812995-29813017 GAGCCACCACGCCAGGCCTTGGG + Intergenic
1067011053 10:42714278-42714300 GAGCCAGCCATCCAGAACCTGGG + Intergenic
1067203855 10:44197298-44197320 GAGCCACCACACCTGGCCATGGG + Intergenic
1067312545 10:45127593-45127615 GAGCCAGCCATCCAGAACCTGGG - Intergenic
1067590059 10:47501423-47501445 GAGCCACCGTACCAGGCCCATGG - Intergenic
1067637182 10:48009520-48009542 GAGCCACCGTACCAGGCCCATGG - Intergenic
1067833224 10:49622042-49622064 GAGGGAGGAAGCCAGGCCCTGGG + Intronic
1068727563 10:60320307-60320329 GAGCCACCATACCAGGCCCATGG - Intronic
1068749264 10:60572979-60573001 GAAGCAGCAAATCAGCCCCTGGG - Intronic
1069486569 10:68827583-68827605 GAGCCCGCAACGCAGGGCCTCGG - Exonic
1069759753 10:70800620-70800642 GAGCCACCACACCTGGCCCAGGG - Intergenic
1069860337 10:71467177-71467199 GACCCAGCAGCCCAGGTCCTGGG - Intronic
1069934759 10:71907544-71907566 GAGCCATCACACCAGCACCTGGG - Intergenic
1070186020 10:74063180-74063202 GAGCCATGACACCAGGCCCGAGG + Intronic
1070676623 10:78416162-78416184 GAGCCAGAGAATGAGGCCCTTGG - Intergenic
1071150769 10:82631815-82631837 GAGCCACCACACCTGGCCATGGG - Intronic
1071827067 10:89335989-89336011 GAACCACCACACCTGGCCCTAGG - Intronic
1072279379 10:93852092-93852114 GAGCCATCACACCAGGCCTATGG - Intergenic
1072569468 10:96645973-96645995 GAGCCACCACATCAGGCCATGGG - Intronic
1072792478 10:98328202-98328224 GGGCCAGAAAGCTAGGCCCTGGG - Intergenic
1073031187 10:100527316-100527338 GAGCCACCACACCTGGCCCAGGG - Intronic
1073076744 10:100829157-100829179 GAGCCAACAAAACAGGCCAGAGG - Exonic
1073318160 10:102597341-102597363 GAGACTGGAAACCAGGCCCTGGG - Intronic
1074127595 10:110541940-110541962 GAGCCACCACACCCGGCCCAGGG - Intergenic
1074437173 10:113444051-113444073 AGGCCAGCAAACCAGGCCCTTGG - Intergenic
1075124185 10:119686557-119686579 GAGCCACCACACCAGGCCTCAGG + Intergenic
1076659517 10:132046168-132046190 GAGCCACCACACCTGGCCCCTGG - Intergenic
1077473891 11:2777450-2777472 GAGCCAGAAAACCAGCCCCCAGG - Intronic
1077646763 11:3932204-3932226 GAGCCAGCAAACAAGACACAGGG - Intronic
1077893218 11:6434613-6434635 GAGCCACCACACCTGGCCCAGGG + Intronic
1079055316 11:17201242-17201264 GAGCCACCACACCAGGCCTAGGG - Intronic
1079387550 11:19994260-19994282 GAGCCACCACGCCTGGCCCTAGG - Intronic
1079450466 11:20596892-20596914 GAGGCAGGAAGCCAGGCCCTGGG - Intergenic
1081303144 11:41478062-41478084 GAGCCACCAAACCCGGCCTGTGG + Intergenic
1081915395 11:46727304-46727326 GAGCCACCACACCCGGCCCATGG + Intronic
1083995737 11:66271201-66271223 GAGCCACCACACCCGGCCCCTGG - Intronic
1084177608 11:67431565-67431587 GAGCCAGCAAAGGAAGCTCTGGG + Intronic
1084276353 11:68053090-68053112 GGGCCGGGAAACCGGGCCCTTGG + Exonic
1084357706 11:68650981-68651003 GAGCCACCAAGCCTTGCCCTCGG - Intergenic
1084403109 11:68956206-68956228 GAGGCAGCAAAGCAGGACCTCGG - Intergenic
1084632049 11:70359296-70359318 GAGCCACCACACCTGGCCCAAGG + Intronic
1084944578 11:72631846-72631868 GAGCCTGGCAGCCAGGCCCTGGG - Intronic
1084963367 11:72729631-72729653 GAGCCACCATACCCAGCCCTAGG - Intronic
1085274487 11:75289604-75289626 AAGCAAGGAAGCCAGGCCCTGGG + Intronic
1085525355 11:77160626-77160648 CACCCACCACACCAGGCCCTGGG + Intronic
1085832027 11:79911841-79911863 GAGACAGCAAAGCAGTGCCTGGG + Intergenic
1087065759 11:94026547-94026569 GATCCTGCTAACCAGGCCTTGGG - Intronic
1087756413 11:102059362-102059384 GAGCCACCATGCCTGGCCCTTGG - Intronic
1088476623 11:110246488-110246510 GAGCCACCATGCCCGGCCCTGGG - Intronic
1089284605 11:117397364-117397386 GAGTCAGCAAAACAGTCCTTTGG + Intronic
1089460492 11:118650313-118650335 AGGCCAGCACACCAGGTCCTGGG - Intronic
1089731286 11:120520651-120520673 CAGCCAGCCAGCCAGGCCCTTGG - Intronic
1090040713 11:123288766-123288788 GAGCCACCGCACCCGGCCCTGGG + Intergenic
1090841931 11:130497596-130497618 GAGCCACCACGCCTGGCCCTGGG + Intergenic
1092129084 12:6095954-6095976 GGGCCACCACACCAGGCTCTAGG + Intronic
1093033154 12:14307765-14307787 GAGCCACCGCACCTGGCCCTGGG + Intergenic
1093128528 12:15359710-15359732 GAGCCACCGCACCAGGCCATTGG + Intronic
1094680056 12:32659928-32659950 GAGCCACCACACCCGGCCCCTGG + Intergenic
1095528923 12:43161559-43161581 GAGCCACCACACCAGGCCACAGG - Intergenic
1095582403 12:43815027-43815049 GAGCCACCACACCCAGCCCTGGG + Intergenic
1096373448 12:51087356-51087378 GAGCCACCACGCCTGGCCCTGGG + Intergenic
1097260375 12:57716468-57716490 GAGCCAGAGGACCAGGCCCCAGG + Exonic
1098263463 12:68695247-68695269 GATCCAGCAAACCTGCCTCTGGG + Intronic
1098265739 12:68717180-68717202 GAGCCACCACACCCGGCCATGGG + Intronic
1100393300 12:94163079-94163101 GAGCCACCGCACCTGGCCCTAGG - Intronic
1100547990 12:95621568-95621590 GAGCCACCACACCTGGCCTTAGG + Intergenic
1100572194 12:95853264-95853286 GAGCTAGCAATCAAGGACCTGGG - Intergenic
1100598369 12:96090909-96090931 GAGCCAGACATCCATGCCCTAGG - Intergenic
1101333738 12:103778244-103778266 GAGCCACCACACCTGGCTCTAGG - Intronic
1101743417 12:107519600-107519622 GAGCCACCACACCAGGCCTAGGG + Intronic
1101775218 12:107787366-107787388 GAGCCACCACACCTGGCCCTTGG + Intergenic
1102202749 12:111068819-111068841 GAGCCACCAAACCCTGCCCAGGG - Intronic
1102353745 12:112214867-112214889 GAGCCACCACACCCGGCCCCTGG - Intronic
1102699286 12:114825222-114825244 GAGCCACCACACCCGGCCCCAGG - Intergenic
1103183860 12:118938809-118938831 GACCCAGCAAACCAGGGACCTGG + Intergenic
1103684567 12:122721811-122721833 GAGCCACCATGCCAGGCCATCGG + Intergenic
1103785478 12:123429828-123429850 GAGCCACCACACCTGGCCATTGG - Intronic
1103892676 12:124251637-124251659 GAGCCACGATACCTGGCCCTAGG - Intronic
1105458551 13:20563256-20563278 GAGCCACCATACCAGGCCTGAGG + Intergenic
1105562608 13:21508406-21508428 GAGCCACCACACCCGGCCCAAGG + Intronic
1106293028 13:28383377-28383399 GAGCCACCACACCCGGCTCTAGG - Intronic
1106617079 13:31339928-31339950 GAGCCAGCCCTCCTGGCCCTGGG - Intergenic
1107073420 13:36296375-36296397 GAGCCACCAGGCCCGGCCCTTGG + Intronic
1107321508 13:39194048-39194070 GAGCCACCACACCCGGCCCCAGG - Intergenic
1107526238 13:41234461-41234483 GAGCCACCACACCTGGCCCTGGG + Intronic
1107563989 13:41583357-41583379 GAGCCACCGCACCTGGCCCTAGG - Intronic
1107791130 13:44003430-44003452 TAGCCAGAAAAGCAGTCCCTGGG + Intergenic
1111199015 13:84909600-84909622 GAGCCACCACACCCGGCCATAGG + Intergenic
1111968401 13:94884374-94884396 GAGCCACCGTGCCAGGCCCTTGG - Intergenic
1112468991 13:99670962-99670984 GAGCCAGCAATGCAGGGCTTTGG - Intronic
1113362808 13:109646632-109646654 GAGTCAGCAAACTATGGCCTAGG - Intergenic
1114443093 14:22766804-22766826 GACCCAGTGAACCAGGCCCCAGG + Intronic
1114542634 14:23473281-23473303 GAGCCACCACACCAGGCCTTGGG + Intronic
1114543539 14:23481938-23481960 GAGGCAGAAAACGAGGCCCAAGG - Intronic
1114630624 14:24157350-24157372 GACCCAGAATACCAGGCCCAGGG + Exonic
1115649330 14:35391629-35391651 GAGCCACCACACCCAGCCCTGGG - Intergenic
1115676157 14:35677056-35677078 GAGCCACCACACCCGGCCCAAGG - Intronic
1116730980 14:48622347-48622369 GAGCCACCACACCTGGCCCGTGG + Intergenic
1116960522 14:50963743-50963765 GAGCCACCATACCCAGCCCTGGG - Intergenic
1117342363 14:54803377-54803399 GAGCCAGCAAACGAGACACGGGG + Intergenic
1118274595 14:64374209-64374231 GAGCCACCACACCTGGCCCGAGG + Intergenic
1118354372 14:65000534-65000556 GAGCCACCTCACCTGGCCCTGGG - Intronic
1118726564 14:68633109-68633131 GAGCCACCACACCCAGCCCTGGG + Intronic
1119294134 14:73519459-73519481 GAGCCACCACACCCGGCCATAGG - Intronic
1119680809 14:76591060-76591082 GAGACAGGAAACCAAGCCCTGGG + Intergenic
1120495539 14:85230218-85230240 GAGCCACCACCCCCGGCCCTAGG + Intergenic
1120660951 14:87250580-87250602 GAGCCACCACACCTGGCCCAGGG - Intergenic
1121052378 14:90828001-90828023 CAGCGAGAAAACCAGTCCCTTGG + Intergenic
1121431371 14:93890731-93890753 AAGCCAGCTAACAAGGACCTGGG - Intergenic
1121562356 14:94884845-94884867 GAGCCAGTTCACCAGGGCCTGGG - Intergenic
1121750267 14:96348396-96348418 GAGCCACCATGCCTGGCCCTTGG - Intronic
1122269354 14:100561462-100561484 GAGCCACCACACCTGGCCTTGGG - Intronic
1123105555 14:105839604-105839626 GAGCCAGGCACCCAGGCCCCCGG - Intergenic
1123436753 15:20260203-20260225 GAGCCACCGCACCTGGCCCTAGG + Intergenic
1124070743 15:26390960-26390982 CAGCCAGCAGTCCAGGGCCTGGG + Intergenic
1125557386 15:40597557-40597579 GAGCCATCGCACCAGGCCCCGGG + Intronic
1125608798 15:40957308-40957330 GAGCCACCACACCCAGCCCTTGG - Intergenic
1125786027 15:42318876-42318898 GAGCCACCATGCCTGGCCCTAGG + Intronic
1125807181 15:42503652-42503674 GAGCCACCATACCCGGCCTTTGG + Intronic
1126120613 15:45248081-45248103 GAGCCACCACACCCGGCCCGTGG + Intergenic
1126589701 15:50326371-50326393 GAGCCACCATACCTGGCTCTTGG - Intronic
1126766570 15:52016759-52016781 GAGCCACCACACCTGGCCCAGGG - Intronic
1127283855 15:57515872-57515894 GAGCCACCACACCCGGCCCAGGG - Intronic
1127450446 15:59111316-59111338 GAGCCACCACGCCAAGCCCTTGG + Intronic
1128286380 15:66440374-66440396 GAGCCACCACGCCTGGCCCTGGG + Intronic
1128578120 15:68790007-68790029 GAGCCAGGAAGCCAGGCCTTAGG + Intronic
1128584530 15:68836577-68836599 GAGCCACCATGCCTGGCCCTGGG - Intronic
1128588901 15:68876799-68876821 GAGCCACCATGCCCGGCCCTGGG + Intronic
1129190745 15:73936188-73936210 CAGCCATCAAGCCAGGCCCAGGG - Intronic
1129264207 15:74385385-74385407 GAGGCTGCCAGCCAGGCCCTGGG - Intergenic
1129276218 15:74447416-74447438 GAGCCACCACACCTGGCCCATGG - Intronic
1129452228 15:75657509-75657531 GAGCAAGCAAAATAGGCTCTAGG - Exonic
1129464422 15:75715971-75715993 GACCCAGCTAAGCAGGCCCCAGG - Intergenic
1129720824 15:77877041-77877063 GACCCAGCTAAGCAGGCCCCAGG + Intergenic
1130774233 15:86961480-86961502 GAGCCAGCAAACGAGACCTGGGG + Intronic
1131003371 15:88955923-88955945 GAGCCACCACACCAGGCCAGAGG + Intergenic
1131441666 15:92464286-92464308 CAGCCCGCATACCATGCCCTTGG + Exonic
1131796377 15:96021544-96021566 GAGCCAGCAAAACAGAACATTGG + Intergenic
1132091086 15:98948426-98948448 CAGACAGCGAGCCAGGCCCTGGG - Intronic
1132397892 15:101488442-101488464 GAGCAAGCAGGCCACGCCCTGGG - Intronic
1133335836 16:5006172-5006194 GAGCCAGCAAGACCTGCCCTAGG - Intronic
1133338321 16:5020894-5020916 GAGCGAGCAAAACATGCCCAGGG + Intergenic
1133740045 16:8644538-8644560 GAGCCTGCAAACCAGCCAGTCGG - Exonic
1134448369 16:14347807-14347829 GAGCCACCAATCCCTGCCCTGGG + Intergenic
1134516199 16:14889245-14889267 GAGCCACCAAACCCAGCCCATGG - Intronic
1134620080 16:15681543-15681565 GAGCCACCATACCCGGCCTTTGG + Intronic
1134703871 16:16287892-16287914 GAGCCACCAAACCCAGCCCATGG - Intronic
1134963672 16:18424222-18424244 GAGCCACCAAACCCAGCCCATGG + Intronic
1134967967 16:18506821-18506843 GAGCCACCAAACCCAGCCCATGG + Intronic
1135108458 16:19671490-19671512 GAGCCATCATGCCTGGCCCTTGG - Intronic
1135429310 16:22369159-22369181 GAGCCACCACACCCGGTCCTTGG - Intronic
1135823425 16:25705002-25705024 GAGCCACCGCACCCGGCCCTGGG + Intronic
1136149256 16:28336097-28336119 GAGCCACCACACCTGGCCCCAGG + Intergenic
1136408008 16:30060261-30060283 GAGCCACCACACCTGGCCTTAGG + Intronic
1136420801 16:30131678-30131700 GAGCCACCATGCCTGGCCCTTGG + Intergenic
1136847813 16:33590658-33590680 GAGCCACCGCACCTGGCCCTAGG - Intergenic
1137274719 16:46925847-46925869 GAGCCACCACACCTGGCCCAGGG - Intronic
1137522316 16:49205006-49205028 GAGCCACCACACCTGGCCTTTGG - Intergenic
1138411619 16:56844940-56844962 GAGCCAGGAAACAAAGCCTTTGG + Intronic
1138512172 16:57515161-57515183 GAGCCAGGAAACCAGGGCAGGGG - Intronic
1138799558 16:60011491-60011513 GAGCCACCACACCTGGCCCAAGG - Intergenic
1139940802 16:70604167-70604189 AAGCCTGTAAGCCAGGCCCTGGG + Intronic
1139963690 16:70732931-70732953 GAGCCACCACACCCGGCCCAAGG + Intronic
1140081400 16:71750870-71750892 GAGCCACCACACCCGGCCTTTGG - Intronic
1140476638 16:75242405-75242427 GTGCCCACAAACCAGGGCCTGGG + Intronic
1140479856 16:75256725-75256747 GAGCCAGCAAGGCAGCCCCAGGG + Intronic
1141455025 16:84135742-84135764 GAGGCAGCAAACCATGTACTAGG + Intronic
1141459932 16:84172159-84172181 GAGCCACCGAGCCCGGCCCTTGG + Intronic
1141699501 16:85635986-85636008 GAGCCACCAAACCAAGTGCTGGG - Intronic
1141993897 16:87625137-87625159 GAGCCAGCACACCTGGCCCATGG + Intronic
1142423500 16:89987864-89987886 GAGCCATCACGCCCGGCCCTCGG - Intergenic
1203109521 16_KI270728v1_random:1439307-1439329 GAGCCACCGCACCTGGCCCTAGG - Intergenic
1142575575 17:904826-904848 GAGCCACCATGCCCGGCCCTTGG + Intronic
1142701283 17:1662615-1662637 GAGCCACCACACCTGGCCCAGGG - Intronic
1142913915 17:3117956-3117978 GAGCCACCACGCCAGGCCTTGGG + Intergenic
1143070773 17:4291074-4291096 GAGCCACCACGCCCGGCCCTCGG - Intronic
1143083432 17:4398025-4398047 GAGCCACCACACCCGGCCTTAGG + Intergenic
1143251594 17:5527075-5527097 CAGCCAGGAAACCAATCCCTGGG - Intronic
1143276816 17:5717688-5717710 GAGCCACCGCACCTGGCCCTTGG + Intergenic
1143368176 17:6422011-6422033 CTGCCAGCAAACTAGGTCCTTGG - Intronic
1143739956 17:8945257-8945279 GTGCCAGGAAACCAGCCACTGGG + Intronic
1144885487 17:18455821-18455843 GAGCCACCACACCAGGCCAATGG - Intergenic
1144930204 17:18852819-18852841 GAGCCACCACACCTGGCCCGTGG + Intronic
1145146733 17:20488551-20488573 GAGCCACCACACCAGGCCAATGG + Intergenic
1145873983 17:28301721-28301743 GAGCCACCACACCCGGCCCATGG + Intergenic
1145947266 17:28786114-28786136 GAGCCACCACACCCGGCCATAGG + Intronic
1146026073 17:29322023-29322045 GAGCCACCAAACCCAGCCATGGG - Intergenic
1146111347 17:30092671-30092693 GAGCCACCACACCCGGCCATGGG + Intronic
1146846826 17:36187434-36187456 GAGGCAGGGACCCAGGCCCTAGG - Intronic
1146860546 17:36294150-36294172 GAGCCACCATGCCTGGCCCTGGG + Intronic
1147090875 17:38098248-38098270 GAGCCACCATGCCTGGCCCTGGG + Intergenic
1147106336 17:38222258-38222280 GAGCCACCATGCCTGGCCCTGGG - Intergenic
1147296549 17:39487897-39487919 GAGCCACCACACCTGGCTCTTGG + Intronic
1147726890 17:42571409-42571431 GAGCCACCACACCTGGCCCCCGG + Intronic
1148423175 17:47566261-47566283 GAGCCACCATGCCTGGCCCTGGG + Intronic
1148631360 17:49111921-49111943 GAGCCACCACACCTGGCGCTAGG + Intergenic
1148915127 17:50970231-50970253 GAGCCACCGCACCCGGCCCTTGG - Intronic
1149566751 17:57645710-57645732 GAGACACCACACCTGGCCCTGGG + Intronic
1149650462 17:58273156-58273178 GACCCAGGAAGCCAGGGCCTGGG - Intronic
1149730176 17:58937590-58937612 GAGCCACCACACCCGGCCGTAGG - Intronic
1150154993 17:62845529-62845551 GCGCCACCACACCCGGCCCTGGG - Intergenic
1150371434 17:64642089-64642111 GAGCCATCACGCCCGGCCCTAGG + Intronic
1150545527 17:66153876-66153898 GAGCCACCACACCCGGCCCTTGG - Intronic
1150719598 17:67603023-67603045 GAGCTACCACACCAGGCCCCTGG + Intronic
1150811867 17:68363162-68363184 GAGGCAGCCAACCATGACCTGGG + Intronic
1150819372 17:68422774-68422796 GAGTCAGGAAATCAGGCCCAAGG - Intronic
1151248571 17:72815635-72815657 GAGCCACCACACCTGGCCCTAGG - Intronic
1151818446 17:76483567-76483589 CAGCCACCACACCCGGCCCTAGG + Intronic
1151916364 17:77121104-77121126 GGGCCAGCAATACAGGCACTAGG - Intronic
1152105478 17:78326205-78326227 GGTCCAGCAAACCTGGACCTTGG + Intergenic
1152407243 17:80104762-80104784 GAGCCAGCAGACCAGGGCCCCGG + Intergenic
1152564064 17:81092383-81092405 GACACACCACACCAGGCCCTGGG + Intronic
1152747322 17:82047293-82047315 CAGCCAACAGCCCAGGCCCTTGG - Intergenic
1152814843 17:82401424-82401446 GAGCCACCACACCCGGCCCTGGG + Intronic
1152835224 17:82525500-82525522 TAGCCTCCAGACCAGGCCCTTGG - Intronic
1153154226 18:2130689-2130711 GAGCCACCACGCCAGGCCCAGGG - Intergenic
1153628377 18:7043609-7043631 GACCCAGCAAACCATCTCCTGGG + Intronic
1153634667 18:7103520-7103542 GAGCCACCACACCAGGCCTCAGG - Intronic
1153994733 18:10430792-10430814 AGGCCAGCCAACCAGGCCCCAGG - Intergenic
1154289279 18:13092868-13092890 GAGCCACCATACCTGGCCGTAGG - Intronic
1155513232 18:26597936-26597958 GAGCCACCGCACCTGGCCCTTGG + Intronic
1155983937 18:32209837-32209859 CAGCCAGGAAACCAGGGCCTTGG - Intronic
1156267369 18:35500839-35500861 GAGCCACCATACCTGGCCTTGGG - Intergenic
1156374028 18:36496200-36496222 CAGCAAGGAACCCAGGCCCTGGG + Intronic
1157149599 18:45203223-45203245 GAGCCAGGAAAACAAGCCCCTGG + Intergenic
1158592748 18:58791379-58791401 GAGCCACCACACCTGGCCCAAGG + Intergenic
1158606800 18:58902774-58902796 GAGCCACCACACCTGGCCCCAGG + Intronic
1158965934 18:62622276-62622298 GAGCCATCACATCAGGCCCAAGG - Intergenic
1159071454 18:63627363-63627385 GGGCCAGCCAACCTGGCACTGGG - Intergenic
1159280643 18:66280333-66280355 GGGCCAGCAAACTAGGCCCATGG - Intergenic
1160196928 18:76763259-76763281 GAGCCACCATACCCGGCCCTTGG + Intergenic
1160293789 18:77619274-77619296 GAGCCAGCAAACGAGACACAGGG + Intergenic
1161113325 19:2481977-2481999 GAGCCACCACACCCGGCCATGGG - Intergenic
1161190485 19:2952137-2952159 GAGCCACCACACCCGGCCTTAGG - Intergenic
1162918073 19:13884898-13884920 AAGCCACCAAACCAGACCCGGGG + Intronic
1162932736 19:13965494-13965516 GAGCCAGCTCTCCAGGCTCTTGG + Exonic
1162952233 19:14078360-14078382 GAGCCACCACACCTGGCCCCTGG - Intergenic
1163793043 19:19319446-19319468 GAGCCACCACACCTGGCCCAGGG - Intronic
1163836350 19:19576896-19576918 GAGCCACCACACCTGGCCCGAGG + Intronic
1164052085 19:21592392-21592414 GAGCCACCACACCCGGCCGTGGG + Intergenic
1164586214 19:29477787-29477809 GAGCCACCGCACCTGGCCCTTGG + Intergenic
1165032745 19:33010061-33010083 GAGCCACCGCACCTGGCCCTAGG + Intronic
1165445815 19:35856345-35856367 GACCCAGGAATCCAGGCCCTCGG - Intronic
1165748545 19:38245757-38245779 GAGCCAGCACACCTGGCCCAGGG + Intronic
1166683536 19:44781895-44781917 GACCCAGGAATCCAGGCCCCAGG - Intronic
1166727341 19:45036992-45037014 GAGCCACCAAGCCTGGCCTTAGG - Intronic
1166845942 19:45728549-45728571 GAGCCACCACGCCTGGCCCTGGG - Intronic
1167033096 19:46976648-46976670 GAGCGTGCCAACCAGGCCCATGG + Intronic
1167265036 19:48478956-48478978 GACCCAGCAGTCCAGGCCCCCGG - Intronic
1167373913 19:49101301-49101323 CAGCCTGCACACCAGGCCCTGGG - Intronic
1167496023 19:49818987-49819009 GACCCAGGAATCCAGGCCCCCGG - Intronic
1167538198 19:50068843-50068865 CAGCCACCAAGCCAGGCTCTAGG - Intergenic
1167961083 19:53104436-53104458 GAGCCACCATACCTGGCCCCAGG + Intergenic
1168107801 19:54174748-54174770 GATCCAGGAGACCAGGCCCCAGG + Intronic
1168426040 19:56239877-56239899 GAGCCACCACACCTGGCCCTAGG - Intronic
925789045 2:7464766-7464788 GAGCCACCACGCCCGGCCCTTGG - Intergenic
925859858 2:8163717-8163739 GCGCCACCACACCAGGCCCATGG + Intergenic
926455842 2:13067948-13067970 GAGCCAAGAAACAAGGCCTTAGG + Intergenic
926608869 2:14925126-14925148 GGCCCAGCACACCAGGCTCTGGG - Intergenic
926634599 2:15166114-15166136 GTGCCAGCAAGCTATGCCCTGGG + Intergenic
926658220 2:15433810-15433832 GAGCCACCAGGCCTGGCCCTGGG - Intronic
927640837 2:24844366-24844388 CAGCCATCCAGCCAGGCCCTAGG - Intronic
928139483 2:28715959-28715981 GAGCCACCACACCCGGCCCAAGG + Intergenic
928331255 2:30359725-30359747 TAGCCAGGCAACAAGGCCCTGGG + Intergenic
928374424 2:30763394-30763416 GAGAGAGTAACCCAGGCCCTCGG - Intronic
928420989 2:31137878-31137900 GAGCCCGCAAACCCGGCACGCGG + Intronic
928603677 2:32924921-32924943 GAGCCACCACACCTGGCCTTTGG - Intergenic
928841378 2:35609521-35609543 GAGCCACTGCACCAGGCCCTGGG - Intergenic
928984059 2:37163632-37163654 GAGCCACCACACCTGGCCATGGG + Intergenic
929928791 2:46236232-46236254 TGGTCAGCAAGCCAGGCCCTTGG - Intergenic
929945929 2:46371753-46371775 GGTCCAGAAATCCAGGCCCTAGG - Intronic
930607292 2:53505767-53505789 GAGCCAGCAAACAAGGCATGGGG + Intergenic
930711214 2:54552737-54552759 GAGCCACCACACCTGGCCCCAGG + Intronic
931650321 2:64462686-64462708 GAGCCACCACACCTGGCCCAGGG - Intergenic
932186118 2:69697837-69697859 GAGCCACCACACCTGGCCCCAGG - Intronic
932327085 2:70870496-70870518 GAGCCACCATTCCTGGCCCTTGG + Intergenic
932988630 2:76759497-76759519 AAGCCAGCAAACCTGCCCCTGGG + Intronic
933555230 2:83823397-83823419 GAGCCAGCCAACCCTGCCCCTGG - Intergenic
934766519 2:96883008-96883030 GAGCCAGCCCACCAGACTCTGGG - Intronic
935162719 2:100543174-100543196 GAGCCACCACACCTGGCCGTAGG + Intergenic
935374253 2:102379157-102379179 GAGCCACCACACCCGGCCCCAGG - Intronic
935826887 2:106961193-106961215 GAGCCAGAAAATCAGTCCCTGGG + Intergenic
936007921 2:108906740-108906762 GTGCCAGGAGACCAGGCCCACGG + Intronic
936385569 2:112025405-112025427 CAGCCAACACACCAGGTCCTGGG - Intronic
936613036 2:114020211-114020233 GAGCCACCACACCTGGCCTTGGG - Intergenic
937045512 2:118849178-118849200 GCGTCAGCAAACGAGGCCTTCGG + Intergenic
937182379 2:120008412-120008434 CAGAGAGCAAACCAGGACCTAGG + Intergenic
937635771 2:124153895-124153917 GAGCCACTAAGCCGGGCCCTGGG + Intronic
937986271 2:127639542-127639564 TAGCCAGCAGGCCAGGCCCTAGG + Intronic
938032724 2:128009185-128009207 CAGCCACCACACCTGGCCCTGGG - Intronic
938133533 2:128736285-128736307 GAGCCTGCAAACCATCCCCAGGG - Intergenic
938261508 2:129898923-129898945 GAGCCACCGCACCTGGCCCTCGG - Intergenic
938711723 2:133981110-133981132 GAGCCACCAAGCCCAGCCCTGGG - Intergenic
940002961 2:148985085-148985107 GAGCCACCACACCTGGCCATTGG + Intronic
940020958 2:149155464-149155486 GGGGCAGCAAACAAGGCCCTTGG - Intronic
941278191 2:163517183-163517205 GAGCCAGCAATGGAGGACCTAGG + Intergenic
941364853 2:164597903-164597925 AAGCAAGTAAACCAGTCCCTAGG + Intronic
942327503 2:174788286-174788308 TGACCAGAAAACCAGGCCCTTGG + Intergenic
943417584 2:187628038-187628060 GAGCCAGCGTACCTGGCCCATGG + Intergenic
944173400 2:196803063-196803085 GAGCCACCACGCCAGGCCCCCGG + Intergenic
945325868 2:208481493-208481515 GAGCCACCATACCCGGCCTTTGG + Intronic
945638598 2:212393023-212393045 TAGCCACCAAAGCAAGCCCTGGG + Intronic
946281486 2:218668958-218668980 GAGTCAGGAAACCTGGCTCTGGG - Intronic
947759469 2:232593331-232593353 GAGCCACCAATCCATGCCCTCGG - Intergenic
948364516 2:237446065-237446087 GAACCCGGAAACCAGGCCCAAGG - Intergenic
948545794 2:238727847-238727869 GAGTCAAAAACCCAGGCCCTTGG + Intergenic
1168755336 20:312829-312851 GAGCCACCACACCTGGCCTTGGG + Intergenic
1168897894 20:1336525-1336547 CAGCCAGGAAACCAGGGCTTGGG - Intronic
1168923021 20:1556966-1556988 GAGCCACCACACCTGGCCCCTGG - Intronic
1168978675 20:1986983-1987005 GAGCCAGCATAGGAGGCCGTGGG - Intronic
1169466245 20:5842995-5843017 GAGCCAGCAAACAAGGCCCATGG - Intronic
1169492811 20:6085564-6085586 GAGCCACCGCACCTGGCCCTTGG - Intronic
1172382599 20:34508524-34508546 GAGCCACCATGCCCGGCCCTAGG - Exonic
1172439282 20:34954268-34954290 GAGCCACCACACCTGGCCCATGG - Intronic
1172492719 20:35353504-35353526 GAGCCACCACACCTGGCCATAGG - Intronic
1172746680 20:37216052-37216074 GAGCCACCTCACCTGGCCCTAGG - Intronic
1172901104 20:38335482-38335504 GAACCAGCATGCCTGGCCCTAGG - Intronic
1173224510 20:41154394-41154416 GAGCCAGCCAATCCTGCCCTAGG - Intronic
1173631076 20:44516017-44516039 GAGCCACCACGCCTGGCCCTAGG - Intronic
1173686710 20:44928986-44929008 GAGCCACCACACCTGGCCCTGGG - Intronic
1174186003 20:48706842-48706864 GAGCCAGGAATCCAGGCCGAGGG + Intronic
1174370899 20:50086791-50086813 GAGCCAGCTCACCCGGCCTTAGG - Intronic
1175217298 20:57398356-57398378 GAGCGAGCAGCCCAGGCCCAGGG + Intronic
1175290514 20:57872078-57872100 GAGCCACCGCACCTGGCCCTGGG - Intergenic
1175399857 20:58693835-58693857 GAGCCGGCACAACAGCCCCTCGG + Exonic
1175607639 20:60323931-60323953 AAGCCACCACACCTGGCCCTGGG + Intergenic
1176227037 20:64006602-64006624 GAGCCACCACACCCGGCCTTTGG + Intronic
1177151245 21:17457514-17457536 GAGCCACCACACCCGGCCCCTGG + Intergenic
1177158667 21:17524274-17524296 GAGCCACCACGCCTGGCCCTGGG - Intronic
1177702833 21:24660862-24660884 GAGCCACCACCCCTGGCCCTAGG + Intergenic
1178114815 21:29406110-29406132 GAGCCACCACTCCTGGCCCTGGG + Intronic
1178990351 21:37349838-37349860 GAGCCAGCATGCCCGGTCCTAGG + Intergenic
1179279794 21:39924817-39924839 GAGCCACCACACCTGGCCCCGGG + Intronic
1179571182 21:42279766-42279788 GTCACAGCAAGCCAGGCCCTTGG + Intronic
1179916442 21:44480992-44481014 GAGCCAGAAAAGCAGGGCCAAGG - Intergenic
1181513489 22:23399168-23399190 GATGCAGCAAAGCAGGCCCAGGG + Intergenic
1181531574 22:23520509-23520531 GAGCCACCACACCCGGCCCATGG + Intergenic
1182080196 22:27523389-27523411 GAGCCAGCAACCCTGCTCCTAGG + Intergenic
1182371596 22:29815009-29815031 GAGCCACCACACCTGGCCCCAGG - Intronic
1182451880 22:30426618-30426640 TAGCCAGCTAAGCAGTCCCTGGG - Intronic
1182460121 22:30477624-30477646 GAGCCACCACACCCGGCCCCTGG - Intergenic
1182461408 22:30486305-30486327 GAGCCACCACCCCAGGCCCCAGG - Intergenic
1182946168 22:34324640-34324662 TAGCAGGCAATCCAGGCCCTTGG - Intergenic
1183128198 22:35805602-35805624 GATCCAGCAATCATGGCCCTTGG + Intronic
1183878452 22:40804823-40804845 GAGCCACCACACCTGGCCTTGGG - Intronic
1184122592 22:42462170-42462192 GAGCCAGCAACCAGGGGCCTTGG + Intergenic
1184587333 22:45456915-45456937 GAGCCACCACACCGGGCCCCAGG + Intergenic
1184792394 22:46708075-46708097 CAGCCTGCACACCTGGCCCTTGG + Intronic
950261170 3:11544236-11544258 GAGCCAGGAAGTCAGACCCTGGG + Intronic
950393747 3:12717833-12717855 GATCCAGCAACCCAGGTTCTGGG - Intergenic
951500819 3:23384823-23384845 GAGCCACCACACCTGGCCCCTGG + Intronic
953374614 3:42418258-42418280 CAGCCAGCAAACCTGGCCAGGGG + Intergenic
953551928 3:43909760-43909782 GAGCCACCATACCCGGCCATTGG - Intergenic
953624177 3:44557135-44557157 GAGCCAGCAAACCAGACCTGGGG + Exonic
953671409 3:44965351-44965373 GACTCAGCAACCCAGTCCCTGGG - Intronic
954028276 3:47800297-47800319 GAGCCACCACACCTGGCCTTAGG + Intergenic
954818865 3:53307231-53307253 GAGCCACCACACCCGGCCCCAGG + Intronic
954900482 3:54014958-54014980 GAGCCACCTCACCTGGCCCTGGG + Intergenic
956855626 3:73272040-73272062 GAGCCACCACACCCGGCCTTGGG + Intergenic
957877761 3:86171385-86171407 GAGCCATTGCACCAGGCCCTAGG - Intergenic
960824972 3:121773036-121773058 GAGCCACCACACCCGGCCCCAGG - Intronic
960875734 3:122293345-122293367 GAGCCAGCAAAGCAGGCACAGGG - Intergenic
961026953 3:123566566-123566588 GAGCCACCACACCTGGCCCAAGG + Intronic
961481252 3:127182661-127182683 GAGCCAGTCACCCTGGCCCTGGG - Intergenic
962644507 3:137423214-137423236 GAGCCACCACGCCCGGCCCTGGG - Intergenic
962695766 3:137945690-137945712 GAGCCACCACACCAGGCCTTGGG + Intergenic
962975397 3:140441816-140441838 GAGCCAGAAGACAAGGACCTTGG - Intronic
964436841 3:156662085-156662107 GAGCCAGCATGCCTGGCCTTTGG + Intergenic
964714328 3:159705987-159706009 GAGCCACCGCACCAGGCCTTAGG + Intronic
964821628 3:160776881-160776903 GAGCCACCATGCCCGGCCCTTGG + Intronic
965380285 3:167980052-167980074 GAGCCAGCACACCCGGCCCATGG - Intergenic
966513972 3:180796356-180796378 GAGCCACCACACCGGGCCTTCGG + Intronic
966522464 3:180888608-180888630 GAGCCACCAAACCTGGCCTAAGG + Intronic
967058319 3:185849466-185849488 GAGCCACCACATCCGGCCCTAGG - Intergenic
967708537 3:192679816-192679838 GAGCCAGCTAACCAGGCCATGGG + Intronic
967810171 3:193752981-193753003 GAGCCACCATGCCAGGCCCTGGG + Intergenic
968564389 4:1303102-1303124 GAGCCACCACACCCGGCCCGAGG - Intronic
969175165 4:5393200-5393222 GAGCCAACAGAACAGGCACTAGG - Intronic
969246340 4:5935501-5935523 GAGCCACCACACCCAGCCCTGGG - Intronic
970393086 4:15635467-15635489 GAGCCACCAGACCCGGCCCAGGG - Intronic
971215714 4:24660625-24660647 GAAACAGCAAACCAGTGCCTAGG - Intergenic
971805628 4:31355161-31355183 GAAACAACAAACCAGGCACTGGG + Intergenic
973176489 4:47212390-47212412 GAGCCACCACACCCAGCCCTGGG - Intronic
974443955 4:61954865-61954887 GAGTAAGCAAACCAGGTCCCTGG + Intronic
975555783 4:75663576-75663598 GAGCCACCGTACCTGGCCCTGGG - Intronic
976599414 4:86924483-86924505 GAGCCACCACACCAGGGCCATGG + Intronic
976708727 4:88046003-88046025 GAGCCACCATGCCTGGCCCTAGG - Intronic
977338237 4:95724853-95724875 GAGCCACCACACCCGGCCTTTGG - Intergenic
978131292 4:105200941-105200963 GAGCCACCACACCTGGCCCCAGG + Intronic
978163781 4:105581879-105581901 GAGCCACCACACCCGGCCATAGG - Intronic
979404443 4:120292166-120292188 GAGCCACCACACCTGGCCCATGG + Intergenic
979421040 4:120505486-120505508 GAGCCAGAAAATTAGGGCCTTGG - Intergenic
979504684 4:121482023-121482045 GAGCCACCGAACCCGGCCTTTGG + Intergenic
980774893 4:137424941-137424963 GAGCCACCACACCAGGCCTATGG + Intergenic
981930946 4:150188615-150188637 GAGCCACCATGCCCGGCCCTTGG - Intronic
981937815 4:150253698-150253720 CAGCCAGCCAAGCAGGCCCCTGG + Intronic
982409835 4:155062270-155062292 GAGCCACCGCACCTGGCCCTGGG - Intergenic
983585255 4:169347443-169347465 GAGCCAGCAAACAAGACACGAGG - Intergenic
984931859 4:184854948-184854970 CAGCTAGCAAAAGAGGCCCTGGG - Intergenic
985131480 4:186742378-186742400 GAGCCACCAAACCCGGCCCGGGG + Intergenic
985641662 5:1066142-1066164 GACCCAGCAGGGCAGGCCCTGGG - Intronic
986986915 5:13510928-13510950 GAACCAGCAAAACAGGACCTTGG + Intergenic
987453170 5:18111403-18111425 GAGCCACCACGCCCGGCCCTGGG - Intergenic
988940717 5:36143007-36143029 GAGCCACCACGCCCGGCCCTTGG + Intronic
989070833 5:37509508-37509530 GAGCCATCACACCCAGCCCTTGG + Intronic
989339167 5:40354658-40354680 GAGCTGGCAAACCAGCCCCCAGG - Intergenic
989593001 5:43129354-43129376 GAGCCACCACACCCAGCCCTTGG + Intronic
990285836 5:54299869-54299891 GAGCCACCGCACCTGGCCCTAGG + Intronic
991623569 5:68572343-68572365 GAGCCACCACACCCAGCCCTTGG + Intergenic
992396356 5:76372629-76372651 GAGCGAGCAAACCAGCCACCAGG + Intergenic
994841141 5:104926620-104926642 GAGCCACCACACCAGGCGCATGG - Intergenic
995756354 5:115508782-115508804 GAGCCACCGTACCCGGCCCTTGG - Intergenic
996865379 5:128115407-128115429 GAGCCACCGCACCTGGCCCTGGG + Intronic
997370517 5:133356845-133356867 GGGCATGCAAACGAGGCCCTAGG + Intronic
997549300 5:134738298-134738320 GAGCCACCACTCCCGGCCCTGGG + Intergenic
997803441 5:136889631-136889653 GAGCCATCAAACCAGTGCCCAGG + Intergenic
998045130 5:138980918-138980940 GAGCCACCATACCTGGCCCAGGG - Intronic
998695287 5:144631203-144631225 CAGCAAGGTAACCAGGCCCTGGG - Intergenic
999363261 5:151004043-151004065 GAGACACCACACCCGGCCCTGGG - Intergenic
999648911 5:153746584-153746606 GAGGCAGAGACCCAGGCCCTTGG + Intronic
1002382189 5:178838993-178839015 GAGCGAGTTAACCGGGCCCTGGG + Intergenic
1002441324 5:179265873-179265895 GAGCCTGCAGCCCAGGCCCCGGG - Intronic
1002501032 5:179647813-179647835 GAGCCACCACGCCCGGCCCTTGG - Intergenic
1002648533 5:180674272-180674294 GAGCGAGTTAACCGGGCCCTGGG - Intergenic
1003236789 6:4301945-4301967 GGTACAGCAAACCAGTCCCTGGG - Intergenic
1003351970 6:5326473-5326495 GAGCAGGCACACCAAGCCCTGGG - Intronic
1003835920 6:10072602-10072624 GAGCCACCACACCTGGCCCAGGG - Intronic
1003859202 6:10306766-10306788 GAGCCACCGCACCCGGCCCTGGG - Intergenic
1003859442 6:10308661-10308683 GAGCCACCATGCCTGGCCCTAGG + Intergenic
1004041866 6:11987011-11987033 GAGCCACCATCCCCGGCCCTTGG + Intergenic
1004787999 6:18990487-18990509 TTGCCAGGAAACCAAGCCCTTGG - Intergenic
1004999950 6:21230444-21230466 GAGCCACCACACCTGGCCCATGG + Intronic
1008764245 6:54891939-54891961 GAGCCAGCACACCTGGCCACAGG + Intronic
1012795870 6:103760337-103760359 GAGCCAACACCCCGGGCCCTGGG - Intergenic
1012881617 6:104797782-104797804 GAGCCACCATGCCTGGCCCTGGG - Intronic
1013550391 6:111202189-111202211 GAGCCACCACACCCGGCCGTGGG - Intronic
1014200182 6:118600604-118600626 GAGCCACCACACCCAGCCCTGGG + Intronic
1014434619 6:121407898-121407920 GAGCCACCACACCAGCCACTGGG + Intergenic
1015775961 6:136814552-136814574 GAGCCACCACACCCGGCCCCAGG + Intergenic
1016049731 6:139518352-139518374 GAGCCACCACGCCCGGCCCTGGG - Intergenic
1016671375 6:146712469-146712491 GAGCCACCATGCCAGGCCCTGGG + Intronic
1017100668 6:150847187-150847209 GAGCCACCACACCCGGCCCTCGG + Intergenic
1017484508 6:154890484-154890506 GAGCCACCAAACCCGGCCCAAGG - Intronic
1017590944 6:155977315-155977337 GAGTCACCATACCCGGCCCTAGG + Intergenic
1017801706 6:157902060-157902082 GAGCCAGGGAACCAGGGCCGTGG + Intronic
1017825532 6:158079077-158079099 GAGCCACCGCACCTGGCCCTAGG + Intronic
1018216244 6:161530800-161530822 GAGCCACCACACCTGGCCCAAGG + Intronic
1018248197 6:161842212-161842234 GAGCCACCACACCTGGCCCATGG - Intronic
1018451926 6:163917164-163917186 GAGCCACCATACCCGGCCCAGGG - Intergenic
1019140775 6:169940906-169940928 GACCCTGCAAACCAGGCTCCAGG + Intergenic
1019497528 7:1347460-1347482 GAGCCACCACACCCGGCCCTTGG + Intergenic
1019546734 7:1581137-1581159 GAGCCCCCAGACCTGGCCCTGGG - Intergenic
1019576504 7:1740178-1740200 GAGGCAGGAGGCCAGGCCCTGGG + Intronic
1019580726 7:1760727-1760749 GAGCCACCGCACCCGGCCCTCGG - Intergenic
1019766439 7:2854465-2854487 GAGCCACCACATCCGGCCCTAGG + Intergenic
1019934276 7:4244168-4244190 AGGCCAGGAAACCAGGCCTTGGG - Intronic
1020078937 7:5276204-5276226 GAGCCACCACACCTGGCCGTGGG + Intronic
1020267858 7:6573357-6573379 GAGCCACCGCACCCGGCCCTGGG + Intergenic
1022334300 7:29407901-29407923 GAGCCACCAAGCCCGGCCATGGG - Intronic
1022413028 7:30154079-30154101 GAGCCAGCAAACGAGACACGGGG + Intronic
1022456184 7:30560256-30560278 GAGCCACCACACCCGGCCCAGGG + Intergenic
1022858222 7:34338372-34338394 GAGCCACCAAGCCTGGCCCAGGG + Intergenic
1023069778 7:36417957-36417979 GAGCCACCATACCTGGCCCAGGG + Intronic
1023413274 7:39909090-39909112 AACCCGGCAATCCAGGCCCTGGG + Intergenic
1025071469 7:55903383-55903405 GAGCCACCACACCCGGCCATGGG - Intronic
1026153422 7:67807538-67807560 GAGCCACCAAACCTGGCATTTGG - Intergenic
1026306513 7:69147174-69147196 GAGCCACCACACCTGGCCCAGGG - Intergenic
1026653623 7:72237266-72237288 GAGCCACTACACCTGGCCCTGGG + Intronic
1027053547 7:75034681-75034703 AAACAAACAAACCAGGCCCTGGG - Intronic
1027399172 7:77789726-77789748 GAGCCACCAAACCCAACCCTCGG + Intergenic
1027570531 7:79860383-79860405 GAGCCAGCAAATGAGACACTGGG + Intergenic
1029510163 7:100989389-100989411 GAGCCACCACACCTGGCCTTGGG + Intronic
1029671757 7:102037634-102037656 GAGCCACCACGCCCGGCCCTGGG + Intronic
1029956141 7:104642310-104642332 GAGCCACCGTACCTGGCCCTAGG + Intronic
1029968779 7:104768643-104768665 GATCCAGCAAGCAAAGCCCTCGG + Intronic
1031072017 7:117172227-117172249 GAGCCACCACACCTGGCCATTGG + Intronic
1031081834 7:117265439-117265461 GAGCCACCACACCTGGCCCTGGG + Intergenic
1031983357 7:128145040-128145062 GAGCCACCACACCTGGCCTTTGG + Intergenic
1031993576 7:128213394-128213416 GAGAAAGTAAACTAGGCCCTGGG + Intergenic
1032012765 7:128357627-128357649 GAGCCAGAGAACCAGGTCATGGG + Intronic
1032128744 7:129212450-129212472 GAGCCTGCAGAGCAGGACCTGGG + Exonic
1032200757 7:129821128-129821150 GAGCCACCACACCTGGCCATTGG + Intergenic
1032245333 7:130206376-130206398 CAGCCAGAAACCCAGGGCCTGGG + Intronic
1032438726 7:131924329-131924351 GAGCCACCACACCCGGCCTTAGG + Intergenic
1032474115 7:132200629-132200651 CACCCAGCAAAGCAGCCCCTTGG - Intronic
1032580444 7:133098800-133098822 GAGCCACCACACCTGGCCCCAGG + Intergenic
1032741847 7:134747679-134747701 GAGCCACCTAAGCTGGCCCTGGG - Intronic
1032780946 7:135164879-135164901 GAGCTAGAAACCCAGGCCCCGGG - Exonic
1033351819 7:140568222-140568244 GAGCCACCAAGCCCGGCCCCTGG + Intronic
1034337823 7:150334731-150334753 GAGCCACCACACCCGGCCCGGGG - Intronic
1035145389 7:156810675-156810697 GAGCCACCATGCCTGGCCCTGGG + Intronic
1035470495 7:159106123-159106145 GAGCCTGGAAGCCAGGACCTCGG + Intronic
1036429699 8:8678709-8678731 GAACCAGGAAAGCAGACCCTGGG - Intergenic
1037812023 8:22092293-22092315 GAGCCACCACACCCGGCCATTGG - Intronic
1037981800 8:23259640-23259662 GAGCCACCACACCTGGCCCAAGG + Intronic
1038417402 8:27407262-27407284 GAGCCTGCTATCCAGGCCCTGGG + Intronic
1038460389 8:27711204-27711226 GAGCCACCACACCAGGCCCTGGG + Intergenic
1038769801 8:30466877-30466899 GAGCCACCAAACCCGGCCAGTGG + Intronic
1039592668 8:38762938-38762960 GATCCAGCAATCCAGCTCCTAGG - Intronic
1040397592 8:47014261-47014283 GAGCCGCCACACCTGGCCCTTGG - Intergenic
1042037212 8:64547728-64547750 GAGCCACCGCACCAGGCCATTGG - Intergenic
1042186412 8:66140676-66140698 CATGCAGCAAACCAGGTCCTTGG + Intronic
1042436748 8:68774820-68774842 GAGCCACCACACCCGGCCCAGGG - Intronic
1042455617 8:68999152-68999174 GAGCCACCACACCTGGCCCTGGG - Intergenic
1042910938 8:73825517-73825539 GAGCCACCACACCCGGCCTTGGG - Intronic
1044457025 8:92400987-92401009 GAGCCAGCACAGCAATCCCTTGG - Intergenic
1044592995 8:93931935-93931957 GAGCCACCAAGCCTGGCCCCTGG - Intergenic
1044603251 8:94026510-94026532 GAGGAAGCAAAGAAGGCCCTGGG + Intergenic
1044659120 8:94578392-94578414 GAGCCACCACACCTGGCCATAGG + Intergenic
1044957233 8:97493647-97493669 GAGCCACCACACCCAGCCCTGGG + Intergenic
1045342045 8:101263717-101263739 GAGCAAGGAAAGGAGGCCCTAGG - Intergenic
1045487576 8:102644152-102644174 GAGCCACCACACCTGGCCCATGG + Intergenic
1045516901 8:102867541-102867563 GAGCCATCACACCAGGCCTGAGG + Intronic
1045774065 8:105781127-105781149 GAGCCATCAAATCAGTCTCTGGG - Intronic
1046893627 8:119449776-119449798 GAGCCACCACACCCGGCCCCCGG + Intergenic
1047723105 8:127660508-127660530 GAGCCACCACATCTGGCCCTGGG + Intergenic
1049045643 8:140149333-140149355 GAGCCACCACACCTGGCCCCGGG - Intronic
1050289530 9:4139621-4139643 GAACCATGAAACCAGTCCCTGGG - Intronic
1051635947 9:19181164-19181186 GAGCCACCACACCCAGCCCTTGG - Intergenic
1052751842 9:32499738-32499760 GAGCCACCACACCCGGCCCAGGG + Intronic
1053244959 9:36527424-36527446 GAGCCACCATGCCAGGCCATGGG + Intergenic
1053856099 9:42341295-42341317 GAGCCACCTCACCTGGCCCTGGG - Intergenic
1054723639 9:68628221-68628243 GAGCCACCACACCCGGCCCCTGG + Intergenic
1055512472 9:77008915-77008937 GAGCCACCGAGCCTGGCCCTAGG - Intergenic
1055599177 9:77897594-77897616 GAGCCTCCAAAGCAGGACCTGGG + Intronic
1056196177 9:84230957-84230979 TAGCCAGCAGATCAGCCCCTGGG + Intergenic
1056210208 9:84358189-84358211 GAGCCAGCAAACGAGGCATGGGG + Intergenic
1056718474 9:89053492-89053514 GAGGCAGCCAGCTAGGCCCTGGG + Intronic
1057673586 9:97118581-97118603 GAGCCACCACACCCGGCCATTGG - Intergenic
1057867983 9:98696455-98696477 GACCCAGCAAACCAGTCCAGCGG - Intronic
1058033521 9:100225330-100225352 GAGCCACCACGCCCGGCCCTGGG + Intronic
1058550139 9:106105986-106106008 GAGCCACCACACCTGGCTCTTGG + Intergenic
1058718073 9:107739873-107739895 GAGCCAGCAACTCACCCCCTGGG - Intergenic
1058904805 9:109474141-109474163 GAGCCAGCAAACCTGCCTCCTGG + Intronic
1059262753 9:112994113-112994135 GAGCCCACACACCAGGGCCTTGG - Intergenic
1060665181 9:125428405-125428427 GATCCAGCCAGCCAGGCCCAAGG - Intergenic
1060727490 9:126016119-126016141 GAGCCAGCAAACCAGCCTTGGGG - Intergenic
1061086583 9:128402871-128402893 GAGCCACCACACCCGGCCCTAGG + Intergenic
1061341533 9:129985675-129985697 GAGCCACCACACCTGGCCCACGG - Intronic
1062099477 9:134720737-134720759 CAGCCAGGCAACCAGCCCCTGGG - Intronic
1062117101 9:134815369-134815391 GAGCCAGCAAGCCTGGCCAGTGG - Intronic
1062525608 9:136976955-136976977 TGCCCAGCAAACCTGGCCCTCGG + Intergenic
1062593270 9:137284613-137284635 GAGCCACCATGCCTGGCCCTAGG + Intergenic
1185510179 X:658257-658279 GAGCCAGCACGCCCGGCCCCAGG + Intronic
1186319605 X:8410072-8410094 GAGCCACCACACCTGGCCCCTGG + Intergenic
1186728009 X:12377465-12377487 GATCCAGGAAAACAGGCACTGGG - Intronic
1187062316 X:15798901-15798923 GAGCCAGCATGTCCGGCCCTGGG - Intronic
1187177969 X:16913834-16913856 GAGCCACCACACCCGGCCATGGG + Intergenic
1187427524 X:19191800-19191822 GAGCCACCACACCTGGCCCTGGG + Intergenic
1187462929 X:19503709-19503731 GAGCCATCACACCCGGCCATAGG + Intronic
1188320073 X:28725232-28725254 GAGCCACCATGCCTGGCCCTTGG + Intronic
1188672243 X:32894293-32894315 TAGCCAGCAAACGAGGCATTGGG + Intronic
1188894177 X:35645902-35645924 GAGCCACCACACCCGGCCCAGGG + Intergenic
1188922435 X:35993976-35993998 GAGCCACCACACCTGGCCCAGGG - Intergenic
1189311457 X:40021146-40021168 GAGCCACCAAGCCTGGCCCAAGG + Intergenic
1190160272 X:48027101-48027123 GAGCCAGCACGCCCGGCCATCGG - Intronic
1191090142 X:56611570-56611592 GAGCCACCACACCAGGCCCATGG - Intergenic
1191793432 X:64995642-64995664 GAGCCACCACATCAGGCCTTAGG + Intronic
1192103105 X:68286729-68286751 GAGCCACCACACCTGCCCCTAGG - Intronic
1192323670 X:70113966-70113988 GAGCCATCGCACCAGGCCCATGG - Intergenic
1192345035 X:70295631-70295653 GAGCCACCACACCAAGCCATAGG - Intronic
1193502906 X:82302185-82302207 GAGCCACCACACCCGGCCCCAGG - Intergenic
1193525465 X:82582782-82582804 GAGCCACCACACCTGGCCCATGG + Intergenic
1193808817 X:86026413-86026435 GAGCCACCACACCTGGCCCAAGG + Intronic
1194349590 X:92809259-92809281 GAGTCACCAGACCAGGCTCTTGG - Intergenic
1195247245 X:103005657-103005679 GAGCCAACACACCTGGCCCTGGG + Intergenic
1195380751 X:104268669-104268691 AAGCCACCACACCTGGCCCTTGG + Intergenic
1196302053 X:114058892-114058914 GAGCCACCGCACCAGGCCCAGGG + Intergenic
1197083937 X:122450848-122450870 GAGCCACCATGCCAGGGCCTGGG - Intergenic
1200022831 X:153226246-153226268 GAGGCAGAAAGCCAGGTCCTTGG - Intergenic
1200106274 X:153714921-153714943 GAGGCAGCAAACAGGGCCCCAGG + Intronic
1200657908 Y:5925860-5925882 GAGTCACCAGACCAGGCTCTTGG - Intergenic
1200758822 Y:7017037-7017059 GAGTCACCATACCAGGCCCAGGG - Intronic
1201010831 Y:9547317-9547339 GAGCCAGAGGCCCAGGCCCTGGG + Intergenic