ID: 900405865

View in Genome Browser
Species Human (GRCh38)
Location 1:2492750-2492772
Sequence GGGATGGCAAATCCCACTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 111}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900405855_900405865 13 Left 900405855 1:2492714-2492736 CCAGGTAAAGGGGGTGTCTGTGC 0: 1
1: 0
2: 2
3: 17
4: 146
Right 900405865 1:2492750-2492772 GGGATGGCAAATCCCACTGAGGG 0: 1
1: 0
2: 1
3: 9
4: 111
900405854_900405865 14 Left 900405854 1:2492713-2492735 CCCAGGTAAAGGGGGTGTCTGTG 0: 1
1: 0
2: 3
3: 17
4: 254
Right 900405865 1:2492750-2492772 GGGATGGCAAATCCCACTGAGGG 0: 1
1: 0
2: 1
3: 9
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900405865 Original CRISPR GGGATGGCAAATCCCACTGA GGG Intronic