ID: 900406151

View in Genome Browser
Species Human (GRCh38)
Location 1:2493921-2493943
Sequence GTGTGTGCAGGGGCGTGCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 516
Summary {0: 1, 1: 0, 2: 3, 3: 51, 4: 461}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900406147_900406151 -5 Left 900406147 1:2493903-2493925 CCAGGGGTGTGGGAGGGTGTGTG 0: 1
1: 0
2: 13
3: 160
4: 1151
Right 900406151 1:2493921-2493943 GTGTGTGCAGGGGCGTGCTGTGG 0: 1
1: 0
2: 3
3: 51
4: 461
900406139_900406151 20 Left 900406139 1:2493878-2493900 CCTCTTTGCAGCAGTGTGGGAGC 0: 1
1: 0
2: 1
3: 18
4: 173
Right 900406151 1:2493921-2493943 GTGTGTGCAGGGGCGTGCTGTGG 0: 1
1: 0
2: 3
3: 51
4: 461

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900406151 Original CRISPR GTGTGTGCAGGGGCGTGCTG TGG Intronic
900137372 1:1123535-1123557 GTGTGTGCAGGAGTGTGCGCAGG - Intergenic
900137400 1:1123781-1123803 GTGTGTGCAGATGTGTGCTCAGG - Intergenic
900137401 1:1123803-1123825 GTGTGCGCAGGTGTGTGCTCAGG - Intergenic
900137403 1:1123827-1123849 GTGTTTGCAGATACGTGCTGAGG - Intergenic
900137404 1:1123861-1123883 GTGTGTGCAGGTGTGTGCTCAGG - Intergenic
900137409 1:1123918-1123940 GTGTGTGCAGGTGTGTGCCCAGG - Intergenic
900137411 1:1123940-1123962 GTGTGTGCAGGTGTGTGCGCAGG - Intergenic
900137428 1:1124138-1124160 GTGTGTGCAGGTGTGTGCTCAGG - Intergenic
900137437 1:1124188-1124210 GTGTGTGCAGGTGTGTGCCCAGG - Intergenic
900208445 1:1441416-1441438 GTGTGTGCAGGGGGTGTCTGTGG + Exonic
900406151 1:2493921-2493943 GTGTGTGCAGGGGCGTGCTGTGG + Intronic
900667865 1:3827792-3827814 GTCTGTGCTGCGGGGTGCTGGGG - Intronic
900691031 1:3980705-3980727 GAGTGTGCAGGGTCGTGGGGAGG + Intergenic
901393445 1:8963366-8963388 GTGTTTGCATGGGAGTGTTGAGG - Intronic
901507272 1:9692892-9692914 TTATGTGCAGGGGAGCGCTGGGG - Intronic
901660316 1:10794921-10794943 GTGCGGGCAGAGGCGCGCTGGGG - Intronic
901762661 1:11480662-11480684 GTGTGTGCACGCGCGCGCTGGGG - Intronic
901780336 1:11590111-11590133 GTGTGTGGAGGTGAGTGCTGAGG - Intergenic
902074955 1:13777067-13777089 CTGTGTGCATGTGCGTGTTGTGG - Intronic
902232518 1:15036762-15036784 GTGCTCACAGGGGCGTGCTGTGG + Intronic
902755881 1:18548854-18548876 GTGTCTGCAGGGTTGTGGTGAGG - Intergenic
903750489 1:25617731-25617753 GTGTCTGCGGGGGCGCGGTGAGG - Exonic
904041992 1:27590489-27590511 GTGTGTGCTGAGGGGTGGTGGGG - Intronic
904470390 1:30732260-30732282 GTGTGTGGAGGGGTGTGGGGAGG + Intergenic
904818188 1:33221070-33221092 GTATGTGAAGGGTGGTGCTGGGG + Intergenic
905521909 1:38606998-38607020 GTGTGTGCAGCTGAGGGCTGTGG - Intergenic
905770622 1:40635893-40635915 GTGCGTGCAGCCCCGTGCTGTGG - Intronic
906791937 1:48666513-48666535 GTGTGTGCACGTGCATGCTAAGG - Intronic
906795694 1:48694860-48694882 GTGTGTGCAAGAGGCTGCTGTGG - Intronic
907385518 1:54122916-54122938 GTGTGTGCAGGGGGAACCTGGGG + Intergenic
907856152 1:58305979-58306001 GTGTGTGGAGGGGGGTGGGGGGG - Intronic
908825340 1:68127602-68127624 GTTTGTGGAGAGGGGTGCTGGGG + Intronic
909534376 1:76719482-76719504 GTGTGTGTTGGGGTGTTCTGAGG - Intergenic
910485258 1:87706007-87706029 GTGTGGACAGGGGCTTGCTTGGG + Intergenic
913448356 1:118973751-118973773 ATGTGTGTAGGGGAGTGTTGGGG - Intronic
913549839 1:119906758-119906780 GTGTGTGCAGGTGCTAGCTGTGG + Intergenic
913591779 1:120336007-120336029 GTGTGTGCAGGGGTGAGGAGGGG - Intergenic
913651577 1:120919139-120919161 GTGTGTGCAGGGGTGAGGAGGGG + Intergenic
914169532 1:145209931-145209953 GTGTGTGCAGGGGTGAGGAGGGG - Intergenic
914524644 1:148453893-148453915 GTGTGTGCAGGGGTGAGGAGGGG - Intergenic
914599026 1:149181940-149181962 GTGTGTGCAGGGGTGAGGAGGGG + Intergenic
914641756 1:149613242-149613264 GTGTGTGCAGGGGTGAGGAGGGG + Intergenic
915296481 1:154925092-154925114 GAGTGAGCTGGGGCCTGCTGAGG - Exonic
915524377 1:156467039-156467061 GTGTGTGCAGGGGCATTTGGGGG + Exonic
915722160 1:157993539-157993561 GTGTGTGCAGGGGCGGGCGCGGG + Intronic
915750127 1:158199327-158199349 GAGTGTGCAGTGGCGCGGTGCGG - Intergenic
916629832 1:166600475-166600497 CTGTGTGCAGGAGGATGCTGGGG - Intergenic
917414781 1:174797545-174797567 GTGTGTGCAGGAGGGTGTGGGGG + Intronic
918434166 1:184494391-184494413 TTGAGTGCAGGGGAGTGATGAGG + Intronic
919641904 1:200053554-200053576 GTGTGTGCGTGTGCATGCTGGGG - Intronic
919756285 1:201068054-201068076 GGGTGAGCAGTGACGTGCTGTGG + Intronic
919803310 1:201366358-201366380 GTGTGTGCTGGGGGGGGCTGGGG - Intronic
922756823 1:228101677-228101699 GGTGGGGCAGGGGCGTGCTGTGG - Intronic
923072034 1:230574505-230574527 GGGTGTGCATGGGGGTGGTGTGG + Intergenic
924617561 1:245625783-245625805 GTGTGGGAAGGGGCGGGATGTGG - Intronic
924953551 1:248906749-248906771 CTCTGTGCCGGGGCGCGCTGGGG + Intronic
1063636641 10:7788444-7788466 GTGTGCGCAGGGCCGGGCTCCGG + Intronic
1065875359 10:29993221-29993243 ATCTGTCCAGGGCCGTGCTGGGG + Intergenic
1067941959 10:50664443-50664465 GTGTGTGTATTTGCGTGCTGGGG - Intergenic
1067991865 10:51223006-51223028 GTGTGTGGCGGGGGGTGGTGCGG + Intronic
1069304075 10:66946760-66946782 GTGTGTGCCTGGGTGTGGTGGGG - Intronic
1069319165 10:67146087-67146109 GTGTGTGTGGAGGGGTGCTGGGG - Intronic
1070649923 10:78228037-78228059 GTCTGTGAAGGGGTGGGCTGCGG + Intergenic
1070802688 10:79252723-79252745 GTGTGTGCAGGCATCTGCTGGGG + Intronic
1071666554 10:87564201-87564223 GTGTGTGCAGGTGCCTGCCATGG - Intergenic
1071950361 10:90696956-90696978 GGGTGTGGAGGCGCCTGCTGTGG + Intergenic
1071979256 10:90987107-90987129 GTGTTTACTGGGGAGTGCTGTGG - Intergenic
1073035726 10:100562988-100563010 GTGGGTGGACGGGCGTGTTGAGG + Intergenic
1073050997 10:100667423-100667445 GTGTGTGCTGGTGGGGGCTGGGG + Intergenic
1075316520 10:121457852-121457874 GTGTGTGCAGGTATATGCTGAGG - Intergenic
1075747589 10:124738459-124738481 GAGTTTGTAGGAGCGTGCTGGGG - Intronic
1075821344 10:125315396-125315418 GTGTGGGCAGGGGTAGGCTGTGG - Intergenic
1076253023 10:128997823-128997845 GTGTGTCCAGGGGCAGGCAGTGG + Intergenic
1077024267 11:432334-432356 GTGGTTGCAGGTGCGGGCTGTGG - Intronic
1077236797 11:1485782-1485804 GTGTGTGCAGGGGCGTGTGTGGG - Intronic
1077250556 11:1558864-1558886 GTGTGTGCAGTGGAGTTCGGGGG - Intronic
1077308129 11:1876910-1876932 GAGGGTGCGGGGGTGTGCTGGGG + Intronic
1077315991 11:1919601-1919623 GTGTGTGCGGAGTCTTGCTGGGG - Exonic
1077316287 11:1920809-1920831 CTGGGGGCAGGGGTGTGCTGGGG - Intronic
1077529236 11:3087517-3087539 GTGGGTGCAGGTGTGTGCAGGGG - Exonic
1078063174 11:8061349-8061371 GTGTGTGGGGGCGTGTGCTGTGG + Intronic
1078668364 11:13344193-13344215 GTGTGTGTGGAGGGGTGCTGAGG - Intronic
1079413696 11:20213051-20213073 CTGCGTGCAGGGGCGGGCTCCGG + Intergenic
1081483335 11:43508371-43508393 GTGTCTGCAGGGGTCTGTTGGGG + Intergenic
1083296065 11:61716261-61716283 GTGTGACCAGGGCCATGCTGGGG + Intronic
1083826010 11:65204594-65204616 GCGTGCACAGGGACGTGCTGAGG + Intronic
1083932139 11:65851865-65851887 GTGTGTGTTGGGGGGTGCAGGGG + Intronic
1084178829 11:67436753-67436775 CTGAGTGCTGGGGGGTGCTGGGG - Intronic
1084517091 11:69642961-69642983 GGGGGTGCGGGGGCGTGCGGGGG + Intronic
1084958220 11:72702768-72702790 GTGTGAGCTGGGGTGTGCTTGGG - Intronic
1085673498 11:78491753-78491775 GTGTGGGCAGGGGCGTTATTAGG - Intronic
1085738149 11:79057247-79057269 GTGTGTGCAGGCCAGTGCAGGGG - Intronic
1085880212 11:80458289-80458311 GTGTGTGTTGGGGCGGGTTGGGG + Intergenic
1088907053 11:114162848-114162870 GTGTGTTCAAGAGCGAGCTGGGG - Intronic
1089138460 11:116267987-116268009 GAGTGGGCAGGGGTGTGGTGTGG - Intergenic
1089200877 11:116724077-116724099 GTGTGTGCAGGGCCCTATTGTGG - Intergenic
1089283743 11:117392474-117392496 GTGTGTGCGGGGGCCTCCTCAGG + Exonic
1089739281 11:120571316-120571338 GGGTGTGCAGCGGCATGCAGAGG - Intronic
1091713775 12:2761535-2761557 GTGTGTGCATGTGTGTGTTGGGG - Intergenic
1092239359 12:6827885-6827907 GTGTGTGTGGGGGAGTGCAGGGG + Intronic
1092908992 12:13128506-13128528 GCGTGTGCATGTGCGTGCTCAGG + Intronic
1092937076 12:13374092-13374114 GTGTGTGCATGTGTGTGTTGGGG + Intronic
1093828719 12:23728419-23728441 ATGTGTGCAGGGTCTTGTTGAGG + Intronic
1096878144 12:54646260-54646282 GAGGGTGCAGGTGTGTGCTGTGG + Intronic
1097053733 12:56238307-56238329 CTGTGTGCAGGTGTGTGTTGGGG - Exonic
1098614830 12:72509265-72509287 GTGTGTGCGGGGGGGTGCGGTGG - Intronic
1099026445 12:77469965-77469987 GTGTGTGCAGGGGCGGGTGGGGG + Intergenic
1100776419 12:97979597-97979619 GTGTGTGCAGGTGCTGACTGTGG - Intergenic
1102165588 12:110803953-110803975 ATGTGAGCTGGGGAGTGCTGGGG + Intergenic
1102463777 12:113115933-113115955 GTCTGTGCAGGGGCCAGCAGAGG - Exonic
1102822864 12:115923324-115923346 GTGGGTGAAGGGGATTGCTGGGG - Intergenic
1102943713 12:116966472-116966494 GTGTCTCCAGGGCCGTGCTGCGG + Intronic
1103484647 12:121274334-121274356 GTGTGAGCCGGGCTGTGCTGTGG - Exonic
1103759828 12:123240853-123240875 CTGGGTGCAGTGGTGTGCTGAGG - Intronic
1104756018 12:131269732-131269754 GTGTGGGCTGGTGCATGCTGGGG + Intergenic
1105969910 13:25419083-25419105 GTGTGTGCACGCACGTGTTGAGG + Intronic
1106132300 13:26950658-26950680 GTGTGTGCGTGTGTGTGCTGTGG - Intergenic
1107045047 13:35984882-35984904 GTGTGTGCATGCGCACGCTGGGG - Intronic
1112015414 13:95327358-95327380 CTGTGTGGTGGGGAGTGCTGAGG - Intergenic
1112944826 13:104915358-104915380 GTGTGTGCAGGTGCGTGTGTGGG - Intergenic
1113442633 13:110341048-110341070 GGGTGGGGAGGGGTGTGCTGGGG + Intronic
1113647644 13:112010612-112010634 GTGTCTGCAGGGTGTTGCTGCGG - Intergenic
1113663117 13:112120442-112120464 GTCTGAGCAGGGGTGAGCTGAGG + Intergenic
1113966646 13:114156357-114156379 GTGGGTGCTGGGGCGTGGGGAGG + Intergenic
1113992446 14:16038181-16038203 GTGTGTGCGGGGAGGTGGTGTGG + Intergenic
1114492258 14:23110564-23110586 GTGGGTTCAAGCGCGTGCTGAGG - Intergenic
1115413290 14:33101134-33101156 GTGTGTGCAGGTGTGTGTGGGGG - Intronic
1118303953 14:64639052-64639074 CTGTGTGCTGGGGAGTGCAGGGG + Intergenic
1119778698 14:77264264-77264286 GTGTGTGCATGGGCATGCACTGG - Intergenic
1119847195 14:77839398-77839420 CTGTGTGCTGGGGCGAGCTCAGG + Intronic
1121013101 14:90533438-90533460 GTGGCTGCTGGGACGTGCTGAGG - Exonic
1121626187 14:95387091-95387113 GTGTGTGCAGAGGGGAGCAGAGG - Intergenic
1121626192 14:95387118-95387140 GTGTGTGCAGAGGGGAGCAGAGG - Intergenic
1121626199 14:95387145-95387167 GTGTGTGCAGAGGGGAGCAGAGG - Intergenic
1121795024 14:96727679-96727701 GTGTGTGCAGTGGAGTGAGGAGG + Intergenic
1122354088 14:101112985-101113007 GAGCATGCAGGGGCCTGCTGGGG + Intergenic
1122400135 14:101462092-101462114 GTGTGGGAAGGGGCATGTTGCGG + Intergenic
1123040616 14:105488809-105488831 GTGTGTGCTGGGGAGTGCCAAGG + Intronic
1123192178 14:106581863-106581885 GTGTGGGCAGGGGCATGCACAGG + Intergenic
1125556087 15:40586249-40586271 GGGTGTGCTGGTGTGTGCTGCGG - Intergenic
1125789519 15:42353228-42353250 GTGTGTGCTGAGGAGTGCTGAGG - Exonic
1126205221 15:46037741-46037763 GTGTCTGCAGGGGGCAGCTGAGG + Intergenic
1126825741 15:52546171-52546193 GTGTGTGCAGGTGCTGACTGTGG + Intergenic
1127526399 15:59796438-59796460 GTGTGTGCATGTGTGTGTTGGGG - Intergenic
1128061871 15:64740513-64740535 GTGGGTGCAGGGGCGGGGCGAGG + Exonic
1129707784 15:77804621-77804643 GTGTGTGCAAGGATGTGCAGGGG + Intronic
1130007215 15:80111325-80111347 GTGTCTGCAGGGGTGGGATGAGG - Intronic
1130139174 15:81209275-81209297 GTGTGGGGAGGGGCGTCCTGGGG + Intronic
1130141395 15:81229279-81229301 GTGTGGGGAGGGGCGTCCTGGGG + Intronic
1130938868 15:88491413-88491435 GTCAGTGCAGGTGCGGGCTGAGG + Intergenic
1132114162 15:99123740-99123762 GTCTGTGCGGGAGCCTGCTGGGG - Intronic
1132353304 15:101154015-101154037 GTGGGTGCAGGGGTGTGTGGGGG - Intergenic
1132435358 15:101796567-101796589 GTTTGTGCATGGGAGGGCTGTGG - Intergenic
1132460905 16:54059-54081 GTGTGTGCGGGCGGGGGCTGGGG + Intronic
1132608657 16:804204-804226 GTGTAGTCAGGGGCCTGCTGGGG + Intergenic
1132697118 16:1206972-1206994 GTGGGGGCAGGGGCGTGTTGAGG - Intronic
1132901182 16:2255344-2255366 GTCTGGGCAGTGGCGTGGTGTGG - Intronic
1133209698 16:4256731-4256753 GGGGGGGCAGGGGGGTGCTGGGG + Intergenic
1133240496 16:4411662-4411684 GGGTGTGCAGGGTCGTGGAGGGG - Intronic
1135031935 16:19045468-19045490 GTGTGTGCATGTGTGTGGTGGGG - Intronic
1135330657 16:21557195-21557217 CTGTGGGCAGGGGCTTGCAGTGG - Intergenic
1135341537 16:21652603-21652625 GTGTATGCCGGGGCGGGTTGGGG + Exonic
1135661416 16:24300347-24300369 GTGTGAGAAGGGGCGGGGTGAGG + Intronic
1135830028 16:25764871-25764893 GTGTGTGCATGAACTTGCTGTGG + Intronic
1136377515 16:29874038-29874060 GTGTGTGCAGAGGTGTTCAGAGG - Intronic
1136475909 16:30513271-30513293 GTGTGTGCAGGGGAGCAGTGAGG + Intronic
1136605723 16:31332015-31332037 GTGTGTGCATGTGTGTGCTCAGG + Exonic
1136653485 16:31693741-31693763 GTGTGTGCATGTGTGTGCTGTGG - Intergenic
1138116166 16:54362385-54362407 GTGTGTTGGGGGGAGTGCTGTGG + Intergenic
1138366272 16:56480322-56480344 GTGTGTGAGGGGGTGTTCTGTGG - Intronic
1139968785 16:70761013-70761035 GTGTGTGCATGGGGGGGCGGGGG + Intronic
1141983423 16:87563912-87563934 GTGTGTTCATGTGTGTGCTGGGG + Intergenic
1142043681 16:87911662-87911684 CTGTGGGCAGGGGCTTGCAGTGG - Intronic
1142106754 16:88308509-88308531 GAGTGTGGAGGGGCAGGCTGGGG - Intergenic
1142613342 17:1121212-1121234 GGCTGTGGAAGGGCGTGCTGGGG + Intronic
1143016990 17:3896189-3896211 CTGTGTGGAGGGCCCTGCTGTGG - Intergenic
1143026654 17:3945152-3945174 GGGAGCGCAGGGGCGTGCTTAGG + Intronic
1143032141 17:3973781-3973803 CTGTGTGCAGGGGCTGGATGTGG - Intergenic
1143493143 17:7295116-7295138 GGGTGTGCAGGGCCGTCCTGTGG - Intergenic
1144021857 17:11244983-11245005 GTGTGTGCATGGGCAGGCGGAGG - Intronic
1144755289 17:17676497-17676519 GTGTGTGTCGGGGTGTGCTGAGG + Intergenic
1144757148 17:17686603-17686625 GTGTGTGCACGCGCGCGCCGGGG + Intronic
1147317136 17:39626475-39626497 GAGTGTGCAGGGGTGTGCCGGGG - Intergenic
1147382032 17:40061970-40061992 GTGTGTGTATGTGTGTGCTGGGG + Intronic
1148020854 17:44552530-44552552 TTGTGTGCAAGGGCGTGGTGGGG - Intergenic
1148550256 17:48545987-48546009 GTGTGTGCATGAGTGTGGTGGGG + Intergenic
1148697979 17:49572527-49572549 GTGTGTGCAGGGCATGGCTGGGG + Intergenic
1148805612 17:50262387-50262409 GTGTCTGCATAGGCCTGCTGGGG - Intergenic
1148813527 17:50310492-50310514 GTGTGGGCAGGGGCAAGGTGAGG - Intergenic
1148950102 17:51303293-51303315 GTGTGGGAAGGGGGGTGTTGGGG - Intergenic
1149614583 17:57987823-57987845 GTGTGTGCGTGTGTGTGCTGGGG + Intronic
1151469624 17:74309886-74309908 CTGTGGGCAGAGGCGTCCTGAGG + Intronic
1151558547 17:74859365-74859387 GTGTGTGCAGGTCCGTGCCAGGG - Intronic
1151911077 17:77083726-77083748 CTGTGTGCAGGAGCCTCCTGTGG - Intergenic
1152177637 17:78798324-78798346 ATGTGTGTAGGGGTGTGGTGGGG - Intronic
1152191879 17:78893071-78893093 GTGTGTGCACGCGTGTGCAGGGG + Intronic
1152191894 17:78893203-78893225 GTGTGTGCATGTGTGTGCAGGGG + Intronic
1152293447 17:79453690-79453712 GTGTGTGCCGGTGTGTGCAGAGG + Intronic
1152594369 17:81231026-81231048 GTGTGTCGGGGGGCGTGCGGAGG - Intronic
1152688642 17:81707518-81707540 GTGTGTGGAGTGCCGTGCTCAGG + Exonic
1152733417 17:81984828-81984850 GTGTGTGCAGGGGTGTGTGGGGG - Intronic
1152733457 17:81984995-81985017 GTGTGTGCAGGTGTGTGGGGGGG - Intronic
1153217246 18:2832236-2832258 GTGTGTTGGGGGGCGTGCAGGGG - Intergenic
1153325525 18:3815400-3815422 GTGTGTGCACGGGTGTGCAGAGG - Intronic
1154080252 18:11249146-11249168 GTGTGTGCATGTGTGTGCAGTGG - Intergenic
1155437204 18:25826076-25826098 GTGGGTGGAGGGGCCTCCTGAGG - Intergenic
1155654406 18:28177343-28177365 GTGTGTGGAGGCGGCTGCTGTGG + Exonic
1156497529 18:37535971-37535993 ATATGTGCAGGGGCGTGGGGAGG - Intronic
1156707031 18:39895385-39895407 GGGTGGGCAGTGGGGTGCTGTGG + Intergenic
1157002440 18:43542687-43542709 GGGGGTGCAGGGAAGTGCTGGGG - Intergenic
1157263890 18:46200086-46200108 GTGTGTGCGCGCGCGTGCTGGGG + Intronic
1157289127 18:46397530-46397552 GTGTGTGTGGGGTCATGCTGGGG + Intronic
1157289145 18:46397638-46397660 GTGTGTGTGGGGTCATGCTGGGG + Intronic
1157484081 18:48074556-48074578 GTGTGGGCAGCTGTGTGCTGAGG + Intronic
1158293503 18:55968683-55968705 GTGTGTGTATGGGAGTGGTGGGG + Intergenic
1158835697 18:61329592-61329614 GTGTGTGCATGGCAGGGCTGAGG + Intergenic
1159016186 18:63103330-63103352 GTGTGTGCAGGTGTGTAGTGTGG + Intergenic
1159122556 18:64187507-64187529 GTGTGGGCAGCGAGGTGCTGTGG - Intergenic
1159903464 18:74069339-74069361 GTGTGGAGAGGGGCTTGCTGTGG - Intergenic
1160362113 18:78292518-78292540 GTGTGTGTGGTGGCTTGCTGCGG + Intergenic
1160373259 18:78391432-78391454 GGCTGTGCAGGGCCGTGGTGTGG + Intergenic
1160774064 19:846723-846745 GTGTGAGCAGGGAGGGGCTGAGG - Intronic
1160811545 19:1015057-1015079 GTGAGATCAGGGGAGTGCTGGGG - Intronic
1161066685 19:2242074-2242096 AGGTGTGCAGGGGCATGCTGAGG - Intronic
1161066695 19:2242116-2242138 AGGTGTGCAGGGGCACGCTGAGG - Intronic
1161066705 19:2242158-2242180 AGGTGTGCAGGGGCACGCTGAGG - Intronic
1161066715 19:2242200-2242222 AGGTGTGCAGGGGCACGCTGAGG - Intronic
1161117113 19:2503866-2503888 CTGTGTGCAGGGGGGAGCTCAGG - Intergenic
1162731658 19:12722111-12722133 GTGTGTGTAGGGGCCTGTTTCGG - Intronic
1162837033 19:13326941-13326963 TGGAGTGCAGGGGCATGCTGTGG + Intronic
1163091055 19:15020825-15020847 GTGTGGGCAGGAGAGTGCAGGGG - Intronic
1163146262 19:15380695-15380717 GTGGGTGCAGGGGCGGGGTGGGG - Intronic
1163157783 19:15448944-15448966 GTGTGTGGAGGGGGGTGAAGGGG - Intronic
1163642177 19:18468070-18468092 GTGTGTGGAGGGGTTTGGTGTGG - Intronic
1163659653 19:18569042-18569064 GTGGGTGCGGGGGTGGGCTGGGG - Exonic
1163664698 19:18597885-18597907 GTGTGTGTTGGGGGGTTCTGAGG + Intronic
1163752041 19:19083889-19083911 GTGCCTGCAGGGGCATGCTGGGG - Intronic
1163752061 19:19083949-19083971 GTGCCTGCAGGGGCACGCTGGGG - Intronic
1163752078 19:19084009-19084031 GTGCCTGCAGGGGCATGCTGGGG - Intronic
1164779389 19:30880383-30880405 GTGTGTGCAGGGACATCCTGAGG + Intergenic
1165003052 19:32780676-32780698 CTGTGAGCAGGTGAGTGCTGCGG + Intronic
1165422325 19:35728354-35728376 CTTTGTGCAGGGGAATGCTGGGG + Intronic
1165893439 19:39128001-39128023 GTGGGAGCAGGGGAGGGCTGAGG + Intronic
1166051696 19:40264527-40264549 GTGTGAGCTAGGGCGAGCTGGGG - Intronic
1166135623 19:40775502-40775524 GAGTGAGCAAGGGGGTGCTGGGG - Exonic
1166230442 19:41423191-41423213 GGGTGTGCTGGGGGCTGCTGCGG + Intronic
1166567902 19:43776310-43776332 GAGTGTGCAAGGGGGGGCTGGGG + Intronic
1166800274 19:45452438-45452460 CTCTGTGCAGGGTGGTGCTGGGG - Intronic
1166895390 19:46019124-46019146 GTGTGTGGTGGGACCTGCTGAGG + Intronic
1167033416 19:46978576-46978598 GTGTGTGGTGGGGCGTGTGGGGG + Intronic
1167143026 19:47665182-47665204 GTGTCTGGTGGGGGGTGCTGAGG - Intronic
1167741940 19:51329128-51329150 GTGTGTGGGGGGGTGGGCTGGGG + Exonic
925002397 2:416064-416086 CTGTCTGCAGGGGCATGCTTGGG + Intergenic
925319678 2:2952454-2952476 GTGTGTGCATGTGCGTGTTGGGG - Intergenic
925462040 2:4072018-4072040 GTGTGTGGTGGGGGGTGTTGGGG + Intergenic
926122495 2:10252429-10252451 GTGTGTGCATGTGCGTGTGGTGG + Intergenic
927000873 2:18792942-18792964 GTGTGTGCACGCGCGCGCAGTGG - Intergenic
927678421 2:25123783-25123805 GTGTGTGCACGTGTGTGCAGTGG - Intronic
928269661 2:29844844-29844866 GTGTGTGCAGGGGGGTTATCAGG - Intronic
928757884 2:34547535-34547557 GTGTGTGCAGGTGCTGGCTGTGG + Intergenic
929581802 2:43086054-43086076 GTGTGTGCACGTGTGTGGTGGGG - Intergenic
931991666 2:67796681-67796703 GTGTGTGTATGTGCGTGATGGGG - Intergenic
932188497 2:69718644-69718666 GTGTATGCATGTGTGTGCTGTGG - Intronic
932468445 2:71938844-71938866 GTGTGAGCAGGGGTGGGGTGTGG - Intergenic
932704987 2:74017247-74017269 GTGTGTGGAGTGGAGTGCAGCGG - Intronic
933419552 2:82028679-82028701 GGGGGTGCAGGGACGTTCTGAGG - Intergenic
934046303 2:88175392-88175414 GTGTTTGGAGGTGTGTGCTGAGG + Exonic
934517058 2:94995278-94995300 GTGTGTGCTGTGCTGTGCTGCGG + Intergenic
935580210 2:104750123-104750145 GTGTGAGGAGGGACTTGCTGAGG + Intergenic
936611543 2:114006576-114006598 GTGTTTGCAGAAGTGTGCTGTGG - Intergenic
937087771 2:119182598-119182620 GTGTGTGTTGGGGGGAGCTGGGG - Intergenic
937260837 2:120586089-120586111 GTGTGTGTTGGGGTGTGCAGGGG + Intergenic
939963060 2:148583262-148583284 GTGAGTGCAGGGGTGTGAGGTGG + Intergenic
941574397 2:167212898-167212920 GTGTGTGCAGAGGGGTGGGGGGG - Intronic
946185493 2:217978556-217978578 GCGGGGGCAGGGGCGGGCTGGGG - Intronic
946320570 2:218951808-218951830 CTGTGAGCAGGGGGTTGCTGAGG + Intergenic
946427748 2:219608440-219608462 TTGTGGGCTGGGGCGAGCTGAGG + Intronic
948304739 2:236938265-236938287 GTGTGTGCATGTGTGTGGTGTGG + Intergenic
948367246 2:237464946-237464968 GTGTGTGCGGGGGTGTGGGGGGG + Intergenic
948791011 2:240376873-240376895 GTGTGGGGAGGGGCGCCCTGTGG - Intergenic
948874609 2:240820028-240820050 GTGGGTGCAGGTGCGGGCTGCGG + Intronic
1169118620 20:3082816-3082838 GTGTGAGCACGGGCGCCCTGGGG + Intronic
1170601294 20:17843411-17843433 GTGGGTGCTGGGTGGTGCTGGGG + Intergenic
1171109985 20:22471910-22471932 ATGTGTGCACGGGTGTGCTGTGG - Intergenic
1171253000 20:23663522-23663544 GTGTGTGCTGGGTGGGGCTGGGG + Intergenic
1172270863 20:33655059-33655081 GTGAGGGCTGGGGCGAGCTGAGG - Intergenic
1172702799 20:36863280-36863302 GCGGGTGCAGGCGCGGGCTGGGG + Exonic
1172776782 20:37412363-37412385 GTGTGTGTAGGGGGGCGCTTAGG - Intergenic
1173473245 20:43339514-43339536 GTGTGTGGAGGTAGGTGCTGAGG - Intergenic
1174357669 20:50009470-50009492 GTGAGTGCAGGGGCGGGGGGGGG - Intergenic
1174887018 20:54347078-54347100 GTGTGTGCATGTGCGTGCTTTGG + Intergenic
1175175932 20:57112110-57112132 GTTTGTGCAGGGGCATGATGGGG + Intergenic
1175571616 20:60027060-60027082 GTGTGTTGAGGGGCATGCGGAGG + Intronic
1175720451 20:61282961-61282983 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720452 20:61282998-61283020 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720453 20:61283037-61283059 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720454 20:61283076-61283098 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720455 20:61283115-61283137 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720456 20:61283154-61283176 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720457 20:61283193-61283215 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720458 20:61283232-61283254 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720459 20:61283271-61283293 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720460 20:61283310-61283332 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720461 20:61283340-61283362 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175776347 20:61656235-61656257 GGGTGGGCAGGCGCGTGCTGGGG + Intronic
1175776353 20:61656255-61656277 GGGTGGGCAGGCGCGTGCTGGGG + Intronic
1175776359 20:61656275-61656297 GGGTGGGCAGGCGCGTGCTGGGG + Intronic
1175776368 20:61656315-61656337 AAGTGGGCAGGCGCGTGCTGGGG + Intronic
1175776377 20:61656355-61656377 AAGTGGGCAGGCGCGTGCTGGGG + Intronic
1175787127 20:61718756-61718778 GTGTGTGCAGGGGTGTAGGGTGG - Exonic
1175835904 20:61994291-61994313 GTGAGTGCAGGTTCCTGCTGGGG + Intronic
1175876018 20:62230398-62230420 GTGTGTGTATGGGTGTGTTGAGG - Intergenic
1175902877 20:62366926-62366948 GTGAGCGCAGGGGCGGGCCGTGG - Intronic
1175944330 20:62551650-62551672 GTCTGTGCAGGTCCCTGCTGGGG + Intronic
1176028081 20:62996329-62996351 GCGTGTCCAGGGCCCTGCTGTGG - Intergenic
1176064193 20:63186402-63186424 TTGTGTGTGGGGGAGTGCTGAGG + Intergenic
1176112998 20:63418984-63419006 GTGTGTGCAGGCCTGCGCTGGGG - Intronic
1176125649 20:63473375-63473397 GTGTGTGCAGGGAGGGTCTGTGG + Intergenic
1176409121 21:6438239-6438261 GGGGGTGCAGGGGCCTGCTGAGG - Intergenic
1177730739 21:25024652-25024674 GTGTGTGCAGGTACTGGCTGTGG + Intergenic
1179383920 21:40924343-40924365 GTGTGTGCAGGGTGGCCCTGAGG - Intergenic
1179468448 21:41594262-41594284 GTGTGTGCTGCTGAGTGCTGGGG + Intergenic
1179500053 21:41802988-41803010 GTGTGTCCAGGGCAGTGCTGGGG - Intronic
1179554234 21:42162406-42162428 GGCTGTGCAGGGGTGAGCTGGGG + Intergenic
1179654078 21:42834338-42834360 GTGTTTGCAGGGGCGGGGAGGGG + Intergenic
1179684614 21:43046561-43046583 GGGGGTGCAGGGGCCTGCTGAGG - Intergenic
1179939844 21:44630138-44630160 CTGTGGGCAGGGGCATCCTGTGG + Intronic
1180072707 21:45444343-45444365 GTGCGTGCAGGGGTGTAGTGAGG + Intronic
1180128074 21:45805400-45805422 CTGTGTGCTGGGCCGTGCGGAGG + Intronic
1180190696 21:46161203-46161225 GTGCGGGCAGCGGCGGGCTGCGG + Exonic
1180197132 21:46203868-46203890 GTGTGTTCTGGTGCTTGCTGTGG - Intronic
1180220909 21:46357267-46357289 GTGTATGGAGGGGCATCCTGGGG + Intronic
1180314825 22:11269336-11269358 GTGTGTGCGGGGAGGTGGTGTGG - Intergenic
1181323363 22:22025697-22025719 GTGTGCGCAAGGCAGTGCTGAGG + Intergenic
1183264462 22:36816833-36816855 GTGTGGGCAGAAGCGCGCTGGGG + Intronic
1183314745 22:37130574-37130596 GTGTGTGGAGCGGGGTCCTGAGG - Intronic
1183343673 22:37295363-37295385 GTGTGTGCATGTGTGTGGTGGGG - Intronic
1183725449 22:39586720-39586742 GTGTGTTCAGGGGCAGGCAGGGG + Intronic
1184059467 22:42073560-42073582 CTGTGTCCAGAGGCGTCCTGAGG + Intergenic
1184412864 22:44335686-44335708 GTGTGTGCTGGGGTGTGCGATGG + Intergenic
1184430388 22:44438778-44438800 GTGGGTGACGGGGCATGCTGAGG - Intergenic
1184478209 22:44732658-44732680 GTATGTGCGTGTGCGTGCTGGGG - Intronic
1185233032 22:49694159-49694181 GTGGGTGCAGGTGAGTGCAGGGG - Intergenic
949920466 3:8996326-8996348 GTGTGTGGTGGGGAGTGATGGGG - Intronic
950462733 3:13135057-13135079 GTGCATGCAGGGGTCTGCTGAGG + Intergenic
950726899 3:14922572-14922594 GTGTGTGCATGGGGGTGGGGTGG + Intronic
952616177 3:35276636-35276658 GTGTGTGCAGGTGTTAGCTGTGG - Intergenic
952721465 3:36537538-36537560 GTTGGGGCAGGGGCGTGGTGGGG + Intronic
952880307 3:37981402-37981424 GTGTGTGGCGGGGGGTGCTGAGG + Exonic
952902359 3:38118653-38118675 GGGTGTGCAGAGGCAGGCTGAGG + Intronic
953241751 3:41155756-41155778 GTGTGTGTAGGGTCGGGGTGGGG + Intergenic
953541680 3:43824700-43824722 GTGTGTGCACAGGTGTGCTTAGG + Intergenic
953574153 3:44099387-44099409 GTGTGTGGAGGGGAGGGATGGGG + Intergenic
953903859 3:46858492-46858514 GTGCGTGCAGAGGCATGATGGGG + Intronic
954619562 3:51987784-51987806 GTGGGTGCTGGGGAATGCTGTGG + Intronic
955445774 3:59008023-59008045 GTGTCTGCAATGGAGTGCTGGGG - Intronic
956369196 3:68539704-68539726 GTGTGTGCATGTGTGTGGTGGGG + Intronic
957911188 3:86621668-86621690 GTTTTTACAGGGGAGTGCTGAGG - Intergenic
958863037 3:99467772-99467794 TTGTGTGAAGTGGCTTGCTGAGG + Intergenic
959515236 3:107258690-107258712 GTGTGTGCTTGTGCGTGCTTTGG - Intergenic
959783271 3:110262292-110262314 GTGTGTTGGGGGGCGTGGTGAGG - Intergenic
960590765 3:119363384-119363406 GGGTGTGATGGGGGGTGCTGTGG - Intronic
961411682 3:126726815-126726837 GTGTGTGGAGGGAAGTGGTGGGG + Intronic
961653166 3:128427501-128427523 GTGTGTGCATGGGCGTGAGCAGG - Intergenic
961831447 3:129625105-129625127 CTGTGTGCCGGGCCCTGCTGTGG - Intergenic
962704450 3:138029661-138029683 GTGTGTTCAGGGGCATGGTCAGG + Intronic
962977527 3:140458576-140458598 CTTTGTGGAGGGGGGTGCTGAGG - Intronic
963070927 3:141304569-141304591 GTGTGTGCAGGGGGTTGCTGGGG - Intergenic
964376416 3:156052346-156052368 AGGTGTGCAGGTGCGTGGTGTGG + Intronic
966161277 3:176971299-176971321 GTGTGTGCATGCACGTGCTTCGG + Intergenic
966323655 3:178730398-178730420 GTGTGTGTGGGGGGGTGTTGGGG - Intronic
966417141 3:179701201-179701223 GTGTGTGCGGGGGTGGGGTGGGG + Intronic
966440599 3:179940378-179940400 GTGTGTGTTGGGGGGCGCTGGGG + Intronic
966857125 3:184202430-184202452 GTGTGTGCATGTGTGTGCAGTGG - Intronic
967815149 3:193792164-193792186 GTGTGTGGCGGGGTGTGGTGGGG + Intergenic
967987458 3:195106412-195106434 GTGTGTGCGGGGCCGTGCTGGGG - Intronic
968472559 4:788703-788725 GTGGGGCCAGGGGTGTGCTGGGG + Intronic
968584600 4:1410309-1410331 GTGTGTGCAGGGGCGAGAAGAGG - Intergenic
968637754 4:1690803-1690825 GTGTGTGCATGTGTGTGGTGGGG - Intergenic
968648302 4:1750532-1750554 GTGGGTCCAGGGCAGTGCTGGGG + Intergenic
968816552 4:2824534-2824556 GTGTTCACAGGGGGGTGCTGTGG + Intronic
968959330 4:3734975-3734997 GTGTGTGAAGGCGCGTGGTGTGG + Intergenic
969539900 4:7781736-7781758 CTGTGTGCAGGAGAGTGTTGGGG - Intronic
969597770 4:8158667-8158689 ATGAGTGCAGGTGGGTGCTGGGG - Exonic
971257729 4:25030054-25030076 GTGTGTGTAGGGGCGTGCATAGG - Intronic
972312163 4:37891420-37891442 GGCGGGGCAGGGGCGTGCTGCGG - Intronic
972771044 4:42197109-42197131 TTCTGTGCAGAGGTGTGCTGGGG - Intergenic
973543623 4:51958734-51958756 GTTGTTGCAGGGGGGTGCTGGGG + Intergenic
975485860 4:74933580-74933602 GTTTGTGCGGGCGCGGGCTGCGG - Intronic
975601784 4:76107943-76107965 GTGTGTGCATGTGTGTGTTGGGG + Intronic
980238666 4:130143212-130143234 GTGTGTGGAGGGGGGTGGTCGGG + Intergenic
982533051 4:156571736-156571758 GTGTGTGTTGGGGGGTGGTGGGG + Intergenic
983672166 4:170250617-170250639 GTGTGTGCGCGTGCGAGCTGTGG + Intergenic
984845386 4:184103861-184103883 GTGTGGCCAGGGGCTCGCTGGGG - Intronic
985730604 5:1545634-1545656 ATGTGTGCAGGTGTGTGCAGAGG - Intergenic
985730616 5:1545740-1545762 ATGTGTGCAGGTGTGTGCAGAGG - Intergenic
986085656 5:4442454-4442476 GTGACTGCAGGGGCGGGGTGGGG + Intergenic
986643627 5:9895149-9895171 GTGTGTGAAGGGGGGTGATGGGG + Intergenic
986980677 5:13445245-13445267 GTGTGGGCAGAGGTGAGCTGAGG - Intergenic
987381266 5:17288092-17288114 GTGTGAGAAGGGGTGTGCAGTGG - Intergenic
989983837 5:50672844-50672866 GTGTGTGCAGGGGTGAGGAGGGG + Intronic
991224409 5:64252917-64252939 GTGTGTGCTGGGGCGGGGGGTGG - Intronic
992081075 5:73234486-73234508 GTGTGTGAAGGGGCGGGGAGGGG - Intergenic
992795677 5:80253488-80253510 TTCTGAGCAGGGGCGAGCTGTGG - Intronic
993426013 5:87765004-87765026 GTGTGTGCGGGGGGGAGGTGGGG + Intergenic
993855564 5:93070435-93070457 GTGTGTGCGGGGGCGGGGGGCGG + Intergenic
995022822 5:107385070-107385092 GTGTGTGCATACGTGTGCTGGGG - Intronic
996780867 5:127185252-127185274 GTGTGAGCAGCGTTGTGCTGTGG + Intergenic
996900866 5:128539248-128539270 GTCCGTGCAGGGGTGTGCTCTGG + Intronic
997236087 5:132272650-132272672 GTGTGTGCAAAGGTGAGCTGGGG + Exonic
997883568 5:137611802-137611824 GAGTGTGCAGGGGAAGGCTGAGG - Intergenic
999270984 5:150296281-150296303 GTGTGTGCATGTGTGTCCTGGGG - Intergenic
999385747 5:151153047-151153069 TTGTGAGCAGAGGAGTGCTGTGG - Intronic
999722300 5:154407754-154407776 TTCTGTGCAGGGGCCTGGTGGGG + Intronic
1000895230 5:166847275-166847297 GTGTGTGCACGTGTGTGTTGGGG + Intergenic
1001266516 5:170278335-170278357 GGGAGTGCAGGGGGGGGCTGGGG + Intronic
1003604047 6:7542925-7542947 GTGTGGGCAGGGGAGTGGGGGGG + Intronic
1004135596 6:12962973-12962995 GTGTGTGCATGCATGTGCTGAGG - Intronic
1005423765 6:25679490-25679512 GTGTGTGCAGGGGATTGAAGGGG + Intronic
1006407478 6:33853568-33853590 GTGGGTGCAGGGAGGTTCTGCGG + Intergenic
1007005312 6:38356917-38356939 GTTTGTGGATGGGGGTGCTGGGG + Intronic
1008009302 6:46446298-46446320 GTGTGTGGGTGGGGGTGCTGGGG + Intronic
1008821286 6:55634259-55634281 GTGTGTGGAGGGGCATGGGGAGG + Intergenic
1015440761 6:133242877-133242899 GTGTGTGCGGGAGAGTGGTGTGG + Intronic
1015550015 6:134402473-134402495 GAGTTTGCAGGGCAGTGCTGAGG - Intergenic
1015865942 6:137726707-137726729 GTGTGTGGTGGGGCTTGGTGGGG - Intergenic
1017048979 6:150372688-150372710 GTGTGTGTGGGGGTGTGTTGGGG + Intronic
1017597949 6:156049654-156049676 GTGTGTGCTGGGGAGGGCGGTGG + Intergenic
1017643476 6:156516735-156516757 GTGTGGGCAGGGGCAGGGTGGGG - Intergenic
1017760224 6:157562777-157562799 GTGTGTGAAGTGTAGTGCTGTGG + Intronic
1017811919 6:157989846-157989868 GTGTCTGCGGGAGGGTGCTGGGG + Intronic
1017973983 6:159338224-159338246 GTGTGTGCAGGCACCTGCTGTGG - Intergenic
1018094852 6:160376345-160376367 GTGGGGGCAGGGGGGTGGTGCGG + Intronic
1018326192 6:162671952-162671974 GTGAGTGCTGGGAGGTGCTGCGG + Intronic
1018367065 6:163131256-163131278 GTGAGTGCAGTGGCGTGATCTGG - Intronic
1018576344 6:165264049-165264071 CTGTGTGCAGGCCAGTGCTGGGG - Intergenic
1018669701 6:166168183-166168205 GTGCGGGCTGGGGCGGGCTGGGG - Intronic
1019553882 7:1619100-1619122 GTGTGTGTAGGGGTGTGTAGGGG + Intergenic
1019618668 7:1978842-1978864 GTGTGTGCCGTGGCGTCCTTAGG - Intronic
1019689152 7:2400312-2400334 GTGTCTCCAGGGCCGAGCTGAGG + Intergenic
1019709137 7:2510446-2510468 GTGGGTGCCGGGCTGTGCTGAGG + Intergenic
1019905199 7:4057201-4057223 GTGTGTGCAGTTGCTAGCTGTGG - Intronic
1021107625 7:16656540-16656562 GTGTGTGCGCGCGCGCGCTGGGG - Intronic
1023376965 7:39566294-39566316 GTGTGCGCGGAGGCGGGCTGTGG - Intergenic
1024633122 7:51265369-51265391 GGGTGTGGCTGGGCGTGCTGGGG - Intronic
1024684450 7:51730265-51730287 ATGTGTGTAGGTGAGTGCTGGGG - Intergenic
1025014959 7:55431845-55431867 AGTTCTGCAGGGGCGTGCTGGGG + Exonic
1027052204 7:75027606-75027628 ATGTGTGTCGGGGCGCGCTGGGG + Intronic
1028471318 7:91209663-91209685 GTGTGTGCAGTGATGTGCTAAGG - Exonic
1028916403 7:96264078-96264100 GTAGGTGCAGGGGCGTGCAAGGG - Intronic
1029283379 7:99450706-99450728 GTGTGTGCCGGTGCCTGCAGAGG - Exonic
1029494109 7:100888060-100888082 GTGTGGGTAGGGGAGTCCTGGGG - Exonic
1029670989 7:102030798-102030820 GTGGGGGCAGGGGAGTGCTAAGG - Intronic
1031925607 7:127635335-127635357 GTGTGTTGAGGGGGGTGCAGTGG + Intergenic
1032516399 7:132509242-132509264 CTGTGTGCAGAGGCCTGCTGTGG - Intronic
1033062467 7:138122066-138122088 GGGAGTGCTGGGGGGTGCTGGGG + Intergenic
1033361230 7:140640462-140640484 GGGGGTGCAGGGTCGAGCTGGGG - Intronic
1033659108 7:143391581-143391603 GTCTGGGCAGGGGAGGGCTGCGG - Intronic
1034400393 7:150857958-150857980 GGGTGTGCAGGCGAGTGCCGTGG - Exonic
1034413113 7:150951421-150951443 GTGTGCCCAGGGGCGGGCGGCGG - Intronic
1034869547 7:154671849-154671871 GTGTGTGCATGTGTGTGTTGGGG - Intronic
1035024574 7:155817425-155817447 CTGTGTGTTGGGGCGTGCTGGGG + Intergenic
1035096728 7:156361890-156361912 GGGTGAGCAGGGGCGAGCTGAGG - Intergenic
1035199189 7:157249277-157249299 GTCTCTGCATGGGCCTGCTGTGG + Intronic
1035979062 8:4348591-4348613 GTGTGTGCGTGGGTGTGTTGGGG + Intronic
1036759492 8:11497465-11497487 GTGTGTGCTGGTGGTTGCTGGGG - Intronic
1037903011 8:22698940-22698962 CTGGGTCCAAGGGCGTGCTGGGG - Intergenic
1038642364 8:29338489-29338511 TTCTGTGCAGGGGGGTCCTGTGG - Exonic
1039947185 8:42140242-42140264 CTCCGTGCAGGGGCGAGCTGCGG - Intergenic
1040669113 8:49665728-49665750 GTGTGTGTTGGGGGGTGGTGGGG + Intergenic
1040840370 8:51778457-51778479 GTGTGTGGAGAGGAGTGATGAGG - Intronic
1043873020 8:85455956-85455978 GTGTGTGCAGGGTCATGTGGGGG + Intergenic
1045066061 8:98445803-98445825 ATGTCTGCAGAGGCTTGCTGAGG - Intronic
1045538648 8:103059869-103059891 GTGTGTGTGTGTGCGTGCTGGGG - Intronic
1045864526 8:106850148-106850170 GTATGTGTAGGGGCTTGGTGTGG - Intergenic
1045870762 8:106924347-106924369 GTGTGTGGAGGGGAGGGCAGGGG + Intergenic
1048203899 8:132400540-132400562 GTGTGTGCAGGGACCCGCGGTGG - Intronic
1048254127 8:132892655-132892677 GTGTGTGTATGTGTGTGCTGTGG + Intronic
1048495396 8:134931283-134931305 TTGTGTGCGGGGGTGTGATGTGG - Intergenic
1048865369 8:138757032-138757054 GTGTGTGCACGTGTGTGCAGGGG - Intronic
1048906462 8:139093863-139093885 GGGTGTGCAGGGGGCTGCTAAGG + Intergenic
1049393191 8:142382525-142382547 CTGTGTGCAGCTGCGTGCAGGGG - Intronic
1049522696 8:143102402-143102424 GTGTCTGCCGGGGTGAGCTGGGG + Intergenic
1049542387 8:143214519-143214541 GTGTGTGGTGGGGCACGCTGTGG - Intergenic
1049542401 8:143214562-143214584 GTGTGTGGTGGGGCATGCTGGGG - Intergenic
1049744079 8:144255758-144255780 GCGTGTGCACGCGCGTGGTGGGG + Intronic
1049784012 8:144441981-144442003 GTGTGTGCAGGGGTGAGCCTGGG - Intronic
1050042078 9:1506611-1506633 GTGTGTGCACGTGTGTGGTGTGG + Intergenic
1050669938 9:7984573-7984595 GTGTGTGCGAGGGGGTGGTGGGG + Intergenic
1052457083 9:28713672-28713694 GTGTGTGGAGGGGTGTGGTCAGG + Intergenic
1052861698 9:33441724-33441746 GTGTGTGCATGTGTGTGCAGGGG - Exonic
1053089348 9:35259779-35259801 GTGTGTGTAGGGGGATGCGGGGG + Intronic
1053217987 9:36288687-36288709 ATGTGTGCAAGTGCGTGGTGTGG + Intronic
1053261236 9:36666913-36666935 GTGTGTGTGGGGGGGTGCGGTGG + Intronic
1053568787 9:39281981-39282003 GTGTGTGGAGGGGCGGGTGGAGG + Intronic
1053834756 9:42123012-42123034 GTGTGTGGAGGGGCGGGTGGAGG + Intronic
1054128357 9:61337026-61337048 GTGTGTGGAGGGGCGGGTGGAGG - Intergenic
1054595783 9:67064516-67064538 GTGTGTGGAGGGGCGGGTGGAGG - Intergenic
1055011121 9:71566603-71566625 GTGTGTTTAGGGGGGTGGTGGGG - Intergenic
1056754268 9:89372332-89372354 GTGTGTGGGGGGGTGTGGTGTGG + Intronic
1056885437 9:90438792-90438814 GTCTGTGCAGGGGAAAGCTGGGG - Intergenic
1059336187 9:113569792-113569814 GGGTGGGGAGGGGGGTGCTGTGG + Intronic
1060375924 9:123115163-123115185 GAGTGTGAAGGGCCTTGCTGTGG - Intronic
1060826870 9:126692814-126692836 GTGTGTGCATGCCTGTGCTGTGG + Intronic
1061625803 9:131840073-131840095 GTGTGTCCAGTGTCCTGCTGGGG + Intergenic
1062160592 9:135077522-135077544 GTGTGACCAGGGGCTGGCTGGGG - Intronic
1062181748 9:135194647-135194669 GTGTTTGCAGAAGCCTGCTGAGG - Intergenic
1062325558 9:136010915-136010937 GTGTGTGCAGGGGTGTGGTGAGG - Exonic
1186509144 X:10117448-10117470 GCGTGTCCAGGGGCGAGCTTGGG - Exonic
1190726674 X:53194588-53194610 GTGTGGGCAGGTGCTGGCTGGGG - Exonic
1195412915 X:104588214-104588236 GTGTGTGGAGGGGCGGGGAGGGG - Intronic
1195779746 X:108449028-108449050 GTGTTTTCAGGGTGGTGCTGTGG - Intronic
1195840242 X:109168207-109168229 GTGTGTGCAGGTGACTTCTGTGG + Intergenic
1198530764 X:137548382-137548404 CTGTGCGCAGGGGTGTGCTGAGG + Intergenic
1200005972 X:153084461-153084483 GTCTGTTCAGGGGTGAGCTGGGG + Intergenic
1201963513 Y:19707596-19707618 GTGTGGGCAGGTGCCAGCTGGGG - Exonic