ID: 900407250

View in Genome Browser
Species Human (GRCh38)
Location 1:2498171-2498193
Sequence CAGGCTGAGAACTCTGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 356
Summary {0: 1, 1: 0, 2: 0, 3: 32, 4: 323}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900407250_900407264 30 Left 900407250 1:2498171-2498193 CCCTCCTCAGAGTTCTCAGCCTG 0: 1
1: 0
2: 0
3: 32
4: 323
Right 900407264 1:2498224-2498246 CCCCACCCCTCATACCCCCAGGG 0: 1
1: 0
2: 4
3: 46
4: 398
900407250_900407256 -10 Left 900407250 1:2498171-2498193 CCCTCCTCAGAGTTCTCAGCCTG 0: 1
1: 0
2: 0
3: 32
4: 323
Right 900407256 1:2498184-2498206 TCTCAGCCTGAGTGGGCCCTGGG 0: 1
1: 0
2: 1
3: 28
4: 226
900407250_900407262 29 Left 900407250 1:2498171-2498193 CCCTCCTCAGAGTTCTCAGCCTG 0: 1
1: 0
2: 0
3: 32
4: 323
Right 900407262 1:2498223-2498245 ACCCCACCCCTCATACCCCCAGG 0: 1
1: 0
2: 2
3: 28
4: 295
900407250_900407257 -9 Left 900407250 1:2498171-2498193 CCCTCCTCAGAGTTCTCAGCCTG 0: 1
1: 0
2: 0
3: 32
4: 323
Right 900407257 1:2498185-2498207 CTCAGCCTGAGTGGGCCCTGGGG 0: 1
1: 0
2: 1
3: 42
4: 415

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900407250 Original CRISPR CAGGCTGAGAACTCTGAGGA GGG (reversed) Intronic
900407250 1:2498171-2498193 CAGGCTGAGAACTCTGAGGAGGG - Intronic
900993685 1:6109178-6109200 CTCCCTGAGAACTCTTAGGAGGG - Intronic
901001485 1:6150999-6151021 CAGGCCAAGAACTCTCTGGAAGG + Intronic
903230722 1:21920818-21920840 CAGGCTGAGAGGTCTGAGGTGGG + Intronic
903295632 1:22341638-22341660 CAGGCAGAAAACTGTGAGGTTGG - Intergenic
904842205 1:33379659-33379681 GAGGGTGAGCACACTGAGGATGG - Intronic
904843625 1:33391177-33391199 CAGCCTCAGAAGTCTGGGGATGG - Intronic
906161150 1:43650027-43650049 TAGGCTGAGCACACTGAGGTCGG + Intergenic
906512596 1:46419207-46419229 CGGGCTGTGAGCACTGAGGAAGG - Intergenic
906712861 1:47944603-47944625 CAGGCTGAGAAATGTGTAGAGGG - Intronic
907434949 1:54439590-54439612 CAGGCAGAGATCTCCAAGGATGG + Intergenic
908429160 1:64038871-64038893 AAGGCCGTGAACTTTGAGGATGG - Intronic
908443958 1:64183690-64183712 AGGGCTGAAAGCTCTGAGGAAGG + Intergenic
913488589 1:119357143-119357165 CAGGCTCATGACTGTGAGGAGGG - Intergenic
916553700 1:165874592-165874614 CAGGCTAAGAAATCTGAGAGTGG - Intronic
921968217 1:221116264-221116286 CAGGCTGTGATGACTGAGGAGGG - Intergenic
922432890 1:225573393-225573415 TACTCTGAGAACTCGGAGGAAGG - Intronic
924333285 1:242962263-242962285 AAGACTGAGAAGTCTAAGGAAGG - Intergenic
1062920191 10:1273617-1273639 CACGCTGAGAGCTCTGAGCTGGG + Intronic
1063175018 10:3543546-3543568 CAGCCTCAGAGCTGTGAGGAGGG + Intergenic
1063566735 10:7177744-7177766 GAGGCTGAGAAGGCTGAGGCAGG + Intronic
1065368943 10:24963064-24963086 CATGCTGAGAAATCTGAGAATGG - Intergenic
1065607409 10:27432524-27432546 CAGGCTGAAAACTCTTGGGCAGG - Intergenic
1065816209 10:29485070-29485092 CAGGTTGAGAGTTCAGAGGAGGG - Intronic
1065956692 10:30699827-30699849 CAGGTTGAGAGTTCAGAGGAGGG + Intergenic
1066465081 10:35643150-35643172 CAGGCTGGAAACTCTGGGGCTGG + Intergenic
1067229757 10:44397905-44397927 CAGGCTGATGACTCAGAAGAAGG - Intergenic
1067242503 10:44508496-44508518 CAGGCTTGGAATGCTGAGGATGG - Intergenic
1068150200 10:53121662-53121684 CAGGGTGAGGACACTGAGGTTGG + Intergenic
1068485003 10:57646512-57646534 CAGGCTGAGGACGATGGGGAAGG + Intergenic
1068957020 10:62827421-62827443 CAGGCTGATAACCCAGAGGGTGG - Intronic
1069700602 10:70422122-70422144 CTGGCTGGGAAGTCTGGGGAAGG + Exonic
1069719375 10:70539777-70539799 CAGGCTGAGGCCTCTGGGGAGGG + Intronic
1072201688 10:93165670-93165692 CAGGCTGAGGAGTCTGAGTTTGG - Intergenic
1073122055 10:101128040-101128062 GAGGCTGAAAACTATGGGGAAGG - Intronic
1075010166 10:118861224-118861246 CTGGCTGAGATCCCTGAGGAAGG + Intergenic
1075652602 10:124138939-124138961 CAGGCTGACAACTCTGGACAAGG + Intergenic
1075925000 10:126244434-126244456 CAGGATGAGAAATGTGAGAATGG + Intronic
1076090866 10:127684460-127684482 CAGGCTGGGACCTCTGAGCCTGG + Intergenic
1076494056 10:130885312-130885334 GAGACAGAGAGCTCTGAGGAAGG + Intergenic
1077008216 11:369102-369124 CAGGCGGACAACACGGAGGAGGG - Intergenic
1078431171 11:11289933-11289955 CAGGCAGAGGAGTCTGAAGAGGG + Intronic
1078522854 11:12077285-12077307 CAGCCTGGGAACCTTGAGGAGGG + Intergenic
1079369056 11:19834527-19834549 AAGGCTGAGACCTCAGAAGAAGG + Intronic
1081100627 11:38997269-38997291 CAGCCTGAGCACTGGGAGGATGG - Intergenic
1081657748 11:44868541-44868563 AAGGCTGGGGTCTCTGAGGAAGG - Intronic
1081936147 11:46905194-46905216 TGGCCTGAGAACTCTGAGAAGGG + Intronic
1083951570 11:65959413-65959435 CAGGCAGAGAGCCCAGAGGAAGG + Intronic
1084106711 11:66985293-66985315 CAGGCAGAGAACTCTGGGCTGGG - Intergenic
1085218948 11:74856725-74856747 CAGGCTCACACCACTGAGGAAGG - Intronic
1085416843 11:76324212-76324234 CAAGCTGGGCAGTCTGAGGAAGG + Intergenic
1086264469 11:84981337-84981359 GAGGCTGAGAGTTATGAGGAAGG + Intronic
1086575895 11:88338534-88338556 CAGGGTGAGAAGGGTGAGGAAGG + Intergenic
1087878136 11:103383051-103383073 CAGACTTAGACCTCTGAGGAAGG + Intronic
1088846066 11:113669162-113669184 AAGGCTGAGAACTAAGAGAAAGG + Intergenic
1089259547 11:117214478-117214500 CAGGCAGAGAAGGCAGAGGAGGG + Intronic
1089499026 11:118922133-118922155 CAGGCTGAGTTCTCCCAGGAGGG + Intronic
1089914806 11:122143257-122143279 GAGGGTAAGAAATCTGAGGATGG - Intergenic
1089973962 11:122716633-122716655 CAGACTGAAAGCTCTGAGCAAGG - Intronic
1090088181 11:123669814-123669836 CTGGTAGAGAACTCTGAGGATGG + Intergenic
1090905796 11:131073601-131073623 ATGGCTGAGATTTCTGAGGAGGG + Intergenic
1091022944 11:132117339-132117361 CAGACTGGAAACTCTGAGCATGG + Intronic
1091349650 11:134882726-134882748 GAGGCTGTGAGCTCTGTGGATGG + Intergenic
1091824054 12:3496479-3496501 CAGGCATAGTTCTCTGAGGATGG + Intronic
1091838530 12:3602819-3602841 CAGGATGAGGACTCCGGGGATGG - Intergenic
1091974119 12:4811057-4811079 CAGGCGGATGACTCGGAGGATGG - Exonic
1092002808 12:5045337-5045359 CAGGCGGATGACTCGGAGGATGG - Exonic
1092019450 12:5188680-5188702 CAGGCTGGGAACTCAGACAAAGG + Intergenic
1095762945 12:45860842-45860864 AAGGCTGAGAACTGTTAGGCTGG - Exonic
1095993757 12:48060134-48060156 CAGGCAGTGATCCCTGAGGAAGG - Intronic
1096787553 12:54026194-54026216 GAGGCTGGGAACTCTGAGAGAGG + Intronic
1097256202 12:57676483-57676505 GAGGCTTAGGCCTCTGAGGATGG + Intergenic
1100238952 12:92690625-92690647 CAGGCAGAGAACTGTGAGAAAGG + Intergenic
1101023992 12:100582894-100582916 CAGGCTGTGAAGACGGAGGAGGG - Intronic
1101309410 12:103562751-103562773 CCCACTGAGAATTCTGAGGAAGG - Intergenic
1103001511 12:117388731-117388753 TAGGCTGAGACTTCTGAGAAAGG + Intronic
1103459000 12:121089101-121089123 CAGGCTGAACAGTGTGAGGAGGG + Intergenic
1104033101 12:125079257-125079279 CTTGCTCAGAACCCTGAGGATGG - Intronic
1104357956 12:128104811-128104833 CAGGCTGGAAACTCTCAGGCAGG - Intergenic
1104746834 12:131215941-131215963 CAGGCTGAGAAGACTGAAGTTGG - Intergenic
1104895572 12:132162105-132162127 CAGGCTGAGAAAACCGAGGCAGG - Intergenic
1106116774 13:26824495-26824517 CAGGGAGAGAACTCTCAAGAAGG - Intergenic
1106554194 13:30796131-30796153 CAGGGGGAGAATGCTGAGGATGG + Intergenic
1108272685 13:48777478-48777500 GAGGCAGAGAACTCTGAAGCTGG + Intergenic
1110125025 13:71931969-71931991 CACTCTGACAACTCTGAGGAAGG + Intergenic
1110946752 13:81430843-81430865 GAGGCTGAGCAGTCTTAGGATGG + Intergenic
1111375912 13:87379186-87379208 AAAGCTGAGAATTCTGGGGATGG + Intergenic
1112254397 13:97816335-97816357 CAGGTTGAAATCCCTGAGGAGGG + Intergenic
1113412734 13:110104816-110104838 CAGGCAGAGAAGCCTGAGGTGGG - Intergenic
1113429603 13:110238026-110238048 CAAGCAGAGAACTTTGAAGATGG - Intronic
1114339467 14:21727862-21727884 GAGGCACAGAACTCTGAGCAGGG + Intergenic
1115221460 14:31062433-31062455 TAGGTTGAGAACCCTGAGGAGGG - Intronic
1117786085 14:59286995-59287017 CAGGCTAATATCTCTGATGAAGG + Intronic
1118199098 14:63655682-63655704 CAGGCTGAGAAGGCTGAGGCAGG + Intergenic
1119137048 14:72230664-72230686 CAGGCTGGAAACTCTCAGGCAGG + Intronic
1119164468 14:72480733-72480755 CAGGCTGAGCTCTCTCAGGTGGG + Intronic
1119413612 14:74455108-74455130 CAGGCTGGAAACTCTCAGGCAGG - Intergenic
1120356660 14:83442805-83442827 CAGGGTTAGGACTCTGAAGAAGG + Intergenic
1120813127 14:88825041-88825063 GAGGCTGAAAATTGTGAGGAGGG - Intronic
1121420307 14:93808379-93808401 CAGGCTGTGAACGTGGAGGAAGG + Intergenic
1122290675 14:100678811-100678833 CAGGCTGAGAATGCAGGGGAGGG - Intergenic
1122557342 14:102588673-102588695 CAGGTTCAGAACTCTTAGGATGG + Intergenic
1124377460 15:29137170-29137192 CAGGATGTGACCTCTGCGGAAGG + Exonic
1125550350 15:40540157-40540179 CAGGCTCAGAGCTCTGACTAGGG + Intronic
1125917094 15:43497443-43497465 CAGGATGAGAATTTTGAGGAGGG - Intronic
1126105660 15:45145357-45145379 CAGGCTGAGATGAGTGAGGATGG - Intronic
1127535158 15:59883312-59883334 CAGGCAGAGAAGTCTGATGGTGG + Intergenic
1129232496 15:74204483-74204505 CAGTCTGAGACCCCTGAGCAGGG - Intronic
1129787752 15:78320733-78320755 GAGGCTGAGCACTCCGAGGATGG + Intergenic
1129882073 15:79013653-79013675 CAGGCTCAGAATTCAGAGGTGGG + Intronic
1130060254 15:80564426-80564448 GAGGCTGAGGACTCAGAGGGTGG - Intronic
1130252461 15:82308796-82308818 CATGTTGAGTACGCTGAGGAGGG + Intergenic
1131059767 15:89397524-89397546 CAGCCTGAGAGCTCTCAGTAGGG + Intergenic
1132205591 15:99984122-99984144 CAGGCCGCGAATTCAGAGGAAGG - Intronic
1132957969 16:2606407-2606429 CTGACTGAGGAATCTGAGGAGGG + Intergenic
1132970445 16:2685655-2685677 CTGACTGAGGAATCTGAGGAGGG + Intronic
1133612677 16:7448262-7448284 CCTTCTGAGAACTCTAAGGAAGG + Intronic
1135070655 16:19348842-19348864 AAGCCAGAGGACTCTGAGGAGGG - Intergenic
1135194050 16:20379878-20379900 GAGGCTGATATCTCAGAGGAGGG - Intronic
1136341208 16:29644720-29644742 CAGGCTGATGTCTCTGAGAAGGG - Intergenic
1136402825 16:30027910-30027932 GGGGCTGAGGCCTCTGAGGATGG + Intronic
1136688249 16:32008757-32008779 CAGGCTGTGAGCGCTGAGGGTGG + Intergenic
1137369210 16:47889090-47889112 CTGTCTGAAAACTCTGATGAAGG + Intergenic
1138204291 16:55113676-55113698 CAAGCTGAGAAGTCTGAGAAGGG + Intergenic
1138504923 16:57473511-57473533 CAGGCTCAGAACTCAGAGCTAGG + Intronic
1139583605 16:67887118-67887140 TAGGCAGAGGAATCTGAGGAAGG + Intronic
1141632505 16:85296056-85296078 CAGGCTGAGAACCAGGAGGCCGG + Intergenic
1141711057 16:85699203-85699225 CTGGCTGAGGACTCTGAGCTGGG - Intronic
1203091048 16_KI270728v1_random:1213801-1213823 CAGGCTGTGAGCGCTGAGGGTGG + Intergenic
1143181354 17:4986334-4986356 CAGGATGAGAAGTATGAGGTAGG + Intronic
1143729489 17:8873002-8873024 GGGGCTGAGAAAGCTGAGGAGGG - Intergenic
1143974490 17:10820034-10820056 CAGGCTCAGGGCTCTGGGGATGG + Intergenic
1144036152 17:11367728-11367750 GAGGCTGAGGATGCTGAGGATGG + Intronic
1144872257 17:18378475-18378497 CTGGGTGAGAGCTCTGGGGAGGG - Intronic
1145325157 17:21816526-21816548 TAGACTGGGGACTCTGAGGAAGG + Intergenic
1146176340 17:30668302-30668324 ATGGCTGGGAACTCGGAGGAGGG + Intergenic
1146349800 17:32084416-32084438 ATGGCTGGGAACTCGGAGGAGGG + Intergenic
1147149241 17:38504463-38504485 CAGGCTGTGAGCTCTGAGGGTGG + Intronic
1147506667 17:41024820-41024842 CTGACTCAGAATTCTGAGGATGG + Intergenic
1147537410 17:41329522-41329544 CAGGCTGACCACACTGCGGAAGG + Intergenic
1149551968 17:57547083-57547105 GAGGCAGAGAACTGTGAGAAAGG + Intronic
1149620466 17:58041039-58041061 CAGGCTGGGCACTTAGAGGAGGG + Intergenic
1149982723 17:61324049-61324071 CACACTGAGAACACAGAGGAAGG - Intronic
1150259659 17:63778500-63778522 CAGACTGTGAACTCTGAGTATGG + Intronic
1151643033 17:75410387-75410409 CAGGCTGCAGACTCTGTGGAGGG - Intergenic
1151749013 17:76026547-76026569 CTGGGTGAGAACTCTGGGGAGGG + Intronic
1152202071 17:78952924-78952946 CAGGCTGAGACCATGGAGGAGGG + Intergenic
1152803173 17:82341347-82341369 CAGGCTGAGGAAGCTGAGGCTGG - Intergenic
1153698841 18:7671983-7672005 CAGGCTGAATGCTTTGAGGAGGG - Intronic
1153999253 18:10469845-10469867 CTGGCTGAGAACCCTGTGGCTGG + Intronic
1155221695 18:23690633-23690655 CTGGCTGAGACCTGTGAGTAAGG - Intronic
1155554348 18:27001669-27001691 CATTCTGAGGTCTCTGAGGAAGG - Intronic
1160220970 18:76977465-76977487 CAGGCTGAGAGCCAAGAGGAGGG - Intergenic
1160815898 19:1035558-1035580 CAGGCCAAGAATTCTGGGGATGG - Intronic
1161332657 19:3695656-3695678 GAGGCTGAGGACACTGGGGACGG - Intronic
1161579712 19:5074152-5074174 CTGGCTGTGAACCCCGAGGAGGG + Intronic
1162567946 19:11454357-11454379 CAGGGTGAGCACTCTGGGGTGGG - Exonic
1166865706 19:45835484-45835506 TAGGCTGAGAACTGAGGGGAGGG + Intronic
1166939666 19:46355169-46355191 CAGGGAGCGAACTCTGAGGTGGG - Intronic
1166970808 19:46566188-46566210 CAGGCTGGAAACTCTCAGGCAGG - Intronic
1167360130 19:49025653-49025675 GAGGCCGATAAATCTGAGGAAGG - Intronic
1167360956 19:49030128-49030150 AAGGCCGATAACTCTGAAGAAGG + Intronic
1167365055 19:49050408-49050430 GAGGCCGATAACTCTGAGGAAGG - Intergenic
1167367300 19:49061552-49061574 AAGGCTGATAACGCTGAGGAAGG - Exonic
926206931 2:10840436-10840458 CTGGCTGAGAAGTCTCTGGAGGG + Intergenic
926915089 2:17883626-17883648 CAGGCTGAGGATTCTAAGGCAGG + Intronic
927776246 2:25905990-25906012 CAGGCAGATAAAACTGAGGAAGG - Intergenic
928991984 2:37242299-37242321 CAGCCTGAGAAGGCTGAGGCAGG - Intronic
929554466 2:42916785-42916807 CAGGCTGAGATCTGGGAAGAGGG - Intergenic
930048786 2:47197484-47197506 CTGGCTGACAAGGCTGAGGAAGG - Intergenic
931027056 2:58122556-58122578 CACGTTGAGTACGCTGAGGAAGG + Intronic
932405524 2:71510525-71510547 AGGGCTCAGAACACTGAGGAAGG - Intronic
932542036 2:72665012-72665034 CACTCTGAGAACACTGAAGAGGG + Intronic
932855317 2:75227636-75227658 AAGGCTGAGAACCCTGAGCTTGG + Intergenic
934781039 2:96969879-96969901 AGGGCTGGGAACTTTGAGGAGGG + Intronic
934930665 2:98420060-98420082 CAGGCATCGAACTCTGAGCAAGG + Intergenic
935292241 2:101620509-101620531 CAGGCTGAGGATGGTGAGGAAGG - Intergenic
935318391 2:101860567-101860589 CAGTCTTAGAATTCTGAGCAAGG + Intronic
937260189 2:120580599-120580621 GAGGCTGAGAACTGGAAGGAAGG - Intergenic
937312035 2:120908532-120908554 TGGGCTGAGAACTATGAGGCAGG + Intronic
938205890 2:129422930-129422952 CAGGTTGAGAAAGCTGAGGGTGG - Intergenic
939284093 2:140106552-140106574 AATGCTGTGAACTCTGAGAAAGG + Intergenic
939375170 2:141355980-141356002 CAGGCTGTGTAGACTGAGGAAGG - Intronic
939928085 2:148199103-148199125 CAGGCTGAAAACTCTCGGGCAGG + Intronic
941069029 2:160935534-160935556 CAGGCTGGAAACTCTCAGGCAGG + Intergenic
941595347 2:167470053-167470075 CAGGATGAGGATTCAGAGGAAGG - Intergenic
943564503 2:189501409-189501431 GAGGCTAAGATCTTTGAGGATGG + Intergenic
944784815 2:203058518-203058540 GAGGTTCAGACCTCTGAGGAAGG + Intronic
945049537 2:205809966-205809988 GGGGCTGAGAACTACGAGGAAGG + Intergenic
946894929 2:224313956-224313978 CAGGATCAGGACTCTGGGGAAGG - Intergenic
947252127 2:228119138-228119160 CAGGCAGAGATTACTGAGGAAGG + Intronic
947302432 2:228703163-228703185 CAGTCTGAGAAATCTGATGATGG - Intergenic
947524399 2:230869557-230869579 CAGGCTGAGAACAGGGAAGATGG - Intronic
947572996 2:231250090-231250112 CAGGCTGAGAGCTCAGGGAAAGG - Intronic
948863700 2:240764894-240764916 CAGGCTGGGAACTCGGGGCAGGG - Intronic
1168897979 20:1337045-1337067 CTGGCTGAGCACCCTGAGGGTGG + Intronic
1170122755 20:12928016-12928038 CAGGCTGAGAGCTCTGGACATGG + Intergenic
1170669509 20:18418195-18418217 CAGGCTGAAAACTGTGACGATGG - Intronic
1171302067 20:24071842-24071864 CAGGCAGAGAGCTCTGAGTTAGG + Intergenic
1171451476 20:25238918-25238940 GAGGCTGAAAAGTCTAAGGATGG - Intergenic
1172669189 20:36622701-36622723 CTGGCTGTGAAGACTGAGGAAGG - Intronic
1172805772 20:37610623-37610645 CCGGCTGAGGACTCAGAGAAAGG - Intergenic
1172813594 20:37669286-37669308 CAGGCTGAGCACTCAGTGGATGG + Intergenic
1172843271 20:37914894-37914916 CAGCCTGGGGGCTCTGAGGAAGG - Intronic
1173396869 20:42688351-42688373 GATTCTGAGACCTCTGAGGAGGG - Intronic
1173775672 20:45704267-45704289 CCTGCTCAGAACTCAGAGGAAGG + Intronic
1175458976 20:59136629-59136651 CAGGATGAAAGCTCAGAGGAGGG - Intergenic
1175799110 20:61790962-61790984 GAGGGTGAGAGCACTGAGGATGG - Intronic
1176664940 21:9677823-9677845 AAGGCTGAGAAGTCCAAGGATGG + Intergenic
1176938122 21:14890145-14890167 CAGGCTGAAAATTCTTAGGCAGG - Intergenic
1177648984 21:23936672-23936694 GGGACTGAGATCTCTGAGGATGG - Intergenic
1179465347 21:41568073-41568095 CAGGAAGAGACCTCAGAGGAGGG - Intergenic
1179535758 21:42050385-42050407 CAGACTGAGAGCTCTGAGAGGGG + Intergenic
1181761646 22:25062756-25062778 CAGGCTGGGAACTGAGAGGATGG + Intronic
1182977865 22:34640371-34640393 CAGGCTGAGGACTCGGGGGCAGG + Intergenic
1182990761 22:34765299-34765321 CACCATGAGAACTCAGAGGAGGG + Intergenic
1183598553 22:38826735-38826757 TAGGCTGAGGACCCTGAGGGTGG + Exonic
1183660234 22:39215807-39215829 CCAGCTGAAGACTCTGAGGATGG - Intergenic
1183922058 22:41177438-41177460 GTGGCTGAGCAGTCTGAGGAGGG - Exonic
1184510543 22:44930716-44930738 CAGGCAGAGCACTCTGGGGCAGG + Intronic
1184674405 22:46032631-46032653 CAGGCTCTGGACTCTGGGGAAGG - Intergenic
1184986433 22:48139328-48139350 CAGACTGAGAGCTGTGAGGGAGG - Intergenic
1185114501 22:48923997-48924019 GAGGGTCAGAACGCTGAGGACGG + Intergenic
950460741 3:13120880-13120902 CAGGCTGAGTTCTCTGAGAGAGG - Intergenic
950540118 3:13607413-13607435 CAGGCTGAGTAGGCTTAGGAGGG + Intronic
952977451 3:38708260-38708282 CATGCTGAGAACTCTGACCAAGG + Intronic
953581372 3:44160106-44160128 TAGGCCCACAACTCTGAGGATGG + Intergenic
953604691 3:44404131-44404153 GAAGCTGAGATTTCTGAGGAAGG - Intronic
954161091 3:48723041-48723063 GAGGCTGAGAAGTCAGAGAATGG + Intronic
955768241 3:62367187-62367209 CAGGCTTAAAATTCTGAAGAGGG - Intergenic
960043111 3:113170276-113170298 CAGACTGCGAACTGTGAGGCTGG - Intergenic
961498715 3:127315303-127315325 CAGGCAGAGGCCTCTGAGGCGGG - Intergenic
962506357 3:136050402-136050424 CAGGCTGAGAAACCTCAGGAAGG - Intronic
962995236 3:140620831-140620853 CAGCCTGAGAACTGAGAGGCTGG + Intergenic
965178778 3:165372805-165372827 CAGGCTCAAAATTCTAAGGATGG - Intergenic
967941154 3:194767689-194767711 CAGCCTCAGAACTCAGAGGCTGG + Intergenic
968460236 4:721088-721110 GAGGCTGAGGACCCTGGGGAGGG + Intronic
968485989 4:862209-862231 CCGGCTGAGATCACTGATGAAGG + Intronic
970544354 4:17112181-17112203 GGGACTGAGACCTCTGAGGAAGG + Intergenic
971455564 4:26840863-26840885 CAGGCTGAGAAGTGAGAAGAAGG - Intergenic
973540951 4:51935017-51935039 CATGCTGAGTCCTCTGAGGCTGG - Intergenic
973779266 4:54272897-54272919 AAGGCTGAGGACTCGGGGGAGGG - Intronic
976768205 4:88620768-88620790 CAGGGTAAACACTCTGAGGAGGG - Intronic
977634982 4:99286792-99286814 CAGGCTGGGAAATCTTAGGATGG + Intronic
980080991 4:128343928-128343950 CAGGATGAGTAGGCTGAGGAGGG + Intergenic
980208982 4:129760554-129760576 CAGGCTGAAAATTTTGAGAATGG - Intergenic
980693722 4:136329137-136329159 CATTCTCAGAACGCTGAGGAGGG + Intergenic
983124709 4:163936528-163936550 GAGGCTCAGATCTCTGAGGATGG + Intronic
984411378 4:179402849-179402871 GATGCAGAGAACTCTAAGGAAGG + Intergenic
984641362 4:182167771-182167793 GAGGCTGAGGAGTCTGAGGTGGG + Intronic
985887736 5:2693170-2693192 CAGGCTGGAAACTGTCAGGAAGG + Intergenic
985949302 5:3211061-3211083 CCTGCTGAGAACTCAGAGGTTGG + Intergenic
986751019 5:10787973-10787995 CAAGCTGAGAACGCTGAGCCTGG + Intergenic
989118622 5:37981167-37981189 TACGCTGAGAATTCTGTGGAAGG + Intergenic
990145580 5:52756752-52756774 CAAGCTGTGAACTCTGGGCAGGG - Intergenic
992695080 5:79278116-79278138 CAGGCTGAGAACTATGAAACAGG - Intronic
994221332 5:97198580-97198602 TGGGCTGGGAACTCTGGGGAGGG + Intergenic
994264038 5:97693310-97693332 ATGGCTGGGAACTCTGGGGAAGG - Intergenic
996023810 5:118621014-118621036 CATTCTGTGAACTCTGATGAGGG - Intergenic
996602361 5:125279115-125279137 CAGGCTTAGAACTCTGTAGCTGG + Intergenic
996976294 5:129438951-129438973 CAGTCTGGGAACTATCAGGAAGG + Intergenic
998105821 5:139468573-139468595 CAGGCTGAGGAGTCTGCAGAGGG - Intergenic
998328008 5:141299056-141299078 CTGGCTCAGACCTCTAAGGAGGG - Intergenic
999684772 5:154092341-154092363 CAAGTTGGGAACTCTTAGGAAGG + Intronic
1000210300 5:159101553-159101575 CATGCTGAAAAGCCTGAGGAGGG - Intergenic
1001680042 5:173549893-173549915 TAGGCTGAGGACTCTGACGTGGG - Intergenic
1001719175 5:173842458-173842480 CAGGTTGAGTAGGCTGAGGAGGG + Intergenic
1002063770 5:176642148-176642170 CAGGCAGAGAACACTCAGGTGGG + Exonic
1002174085 5:177391563-177391585 CAGGCTGGGTACTCCCAGGAAGG + Intronic
1002984885 6:2179616-2179638 GAGGCTGAGAAGTCTGATCAAGG - Intronic
1003414086 6:5892683-5892705 TAGGCAGAGCACACTGAGGATGG + Intergenic
1003781951 6:9439228-9439250 TAGGCTGAGAAGGATGAGGAGGG + Intergenic
1006837312 6:37006844-37006866 CAGGCTGAGGCCTCTGTGGCAGG - Intronic
1008372949 6:50756604-50756626 CAGGCTGTGAATTGTGAGAAGGG - Intronic
1011138026 6:84120460-84120482 CAGGATGAGAACACAGAAGATGG - Intergenic
1012345344 6:98179101-98179123 CTGGCTGGGAAGTCTGTGGAAGG - Intergenic
1012659061 6:101863391-101863413 CCAGCAGAGAACTCTGGGGATGG - Intronic
1012987157 6:105887316-105887338 CAGCCTGGGAACTGTGAGGGAGG + Intergenic
1013597392 6:111672417-111672439 CAAGCTGAGTCCTGTGAGGATGG - Intronic
1014141798 6:117952226-117952248 AAGTCTGAGAACTCTCAGGTGGG + Intronic
1014474606 6:121857137-121857159 CAGGCTGTGCACTGTGAGGCTGG - Intergenic
1015095315 6:129408642-129408664 CTGGCTGATCACCCTGAGGAAGG + Intronic
1015876810 6:137830699-137830721 CATGCTGAGATCTCTTAGGTGGG - Intergenic
1019647534 7:2139141-2139163 CAGGGCGAGGACTGTGAGGAGGG + Intronic
1019706122 7:2498058-2498080 CAGGCTGGGGGCGCTGAGGATGG + Intergenic
1020194307 7:6025557-6025579 CAGTCAGGGAACTCTGAGAATGG + Intronic
1020665921 7:11043928-11043950 CAGGCTGAGCAGTATCAGGAGGG - Intronic
1021452600 7:20797142-20797164 TAGGTTTAGAAGTCTGAGGAAGG + Intergenic
1021523876 7:21564928-21564950 CAGGATGAGGACACAGAGGAAGG - Intronic
1023145099 7:37143265-37143287 CAGACTGTGAACTCAGAGCATGG + Intronic
1023266375 7:38410440-38410462 AAGGCTGTGAACTCAGAGGTTGG - Intronic
1023998337 7:45175523-45175545 CAGGCTGACAGCACTGAGAAGGG - Intronic
1027051604 7:75024791-75024813 CAGCCTGGGGACCCTGAGGAAGG + Exonic
1029198421 7:98822666-98822688 CATGCTGAGAACGCAGAGAAGGG - Intergenic
1030270449 7:107663589-107663611 CAGGAAGAGAACTCTAAGGAAGG - Intronic
1032074007 7:128827706-128827728 CAGGCTCAGGTTTCTGAGGACGG + Intergenic
1032447755 7:131999251-131999273 CAGGCGGAGAAGTCTCAGGCAGG + Intergenic
1033402480 7:141039699-141039721 CAGAGTGAGAATTTTGAGGAAGG - Intergenic
1033764730 7:144476169-144476191 CATAGTCAGAACTCTGAGGACGG + Intronic
1034072282 7:148198101-148198123 CAGGCTGAGAAGCCTGAGGGTGG + Intronic
1034489864 7:151387423-151387445 CAGGCTGAGGACCCTGGGGCTGG - Intronic
1034570458 7:151951588-151951610 GAGGCAAAGAAGTCTGAGGATGG + Intergenic
1034582388 7:152056507-152056529 CATGCAGAGTAGTCTGAGGATGG - Intronic
1034635594 7:152565050-152565072 CAGCCTGGCACCTCTGAGGAAGG + Intergenic
1034844272 7:154430028-154430050 AAGGCTGAGAACTGGGAGGGTGG - Intronic
1036690366 8:10941175-10941197 GAGGCTGTGAACCCGGAGGAAGG - Intronic
1037934429 8:22905732-22905754 CAGGCTGAGACCTGTGAGGTGGG - Intronic
1038238505 8:25785274-25785296 CAGGCTCAGAACTTTGAAGCTGG + Intergenic
1038334303 8:26634130-26634152 CAGGCTAGAAACTCTGAGGGCGG - Intronic
1039558836 8:38496633-38496655 CAGGCTGAGTCCTAAGAGGAGGG + Intergenic
1039802422 8:40970846-40970868 CAGCCTGAGCACTGGGAGGACGG - Intergenic
1041394026 8:57373718-57373740 GAGGCAGAGAGGTCTGAGGAAGG + Intergenic
1041684680 8:60632564-60632586 AGGGCTGAGAGCTCTGGGGAGGG - Intergenic
1041798459 8:61772170-61772192 CAGGCTGATTTCTCTGAAGAAGG + Intergenic
1041943522 8:63416037-63416059 CAGGCTGGAAATTCTGAGGTAGG + Intergenic
1042765062 8:72312425-72312447 CTGGCTAAGAATTGTGAGGAGGG - Intergenic
1043064798 8:75555118-75555140 CAGGCTGAAAACTCTTTGAATGG - Intronic
1044338347 8:91016692-91016714 TAAACTAAGAACTCTGAGGATGG + Intronic
1045051770 8:98333934-98333956 GAGGCTGAAAACTCTCAAGAGGG - Intergenic
1045381712 8:101634176-101634198 AAGCCTGAGAGCTCTGAGGAAGG - Intronic
1045824142 8:106376852-106376874 CTGGCTGAGAACCCACAGGAAGG - Intronic
1047274831 8:123397853-123397875 CTGGCTGAGAAGTCTGACAAAGG + Intronic
1048276529 8:133070212-133070234 CAGTGTGACATCTCTGAGGACGG + Intronic
1049935951 9:502499-502521 AAGGCTGGGAATTCTGGGGATGG + Intronic
1050574570 9:6979958-6979980 TAGGATGAGAACTCTGTGGTGGG + Intronic
1051224975 9:14889661-14889683 CAGACTCAGAACTCTGGAGAGGG + Intronic
1052007827 9:23371473-23371495 CAGGCTAATAACACTGATGACGG + Intergenic
1052344528 9:27395979-27396001 CTGGCTGGGAGCTTTGAGGACGG + Intronic
1057862102 9:98648792-98648814 CAGACTGAGTCCTCTGGGGAAGG - Intronic
1057907483 9:98993865-98993887 CAGGCTGGAAAGGCTGAGGATGG - Intronic
1059255025 9:112922090-112922112 CAGGATGGGATCTCTGAGAAAGG + Intergenic
1061209943 9:129185305-129185327 CTGGCTGAGAGGTCTGAGTATGG - Intergenic
1061381854 9:130263621-130263643 CACTCTGGGAACTCAGAGGAAGG - Intergenic
1061819542 9:133218642-133218664 CAGGCTGTGATCCCTGAGAATGG + Intergenic
1061896927 9:133653045-133653067 CAGCCTGAGCCATCTGAGGAAGG + Intronic
1062008204 9:134252333-134252355 AAGGCTGTGGACTCTGAGGCTGG + Intergenic
1062029443 9:134355648-134355670 CAGGCTGAGGACCCAGAGGCCGG + Intronic
1062433229 9:136535181-136535203 GGGGCTGAGGACTCGGAGGATGG + Intronic
1062536241 9:137022260-137022282 CAGGCTGAGCATCCTGAGGATGG + Intronic
1062718932 9:138024738-138024760 CAGGCTGGGAAGGCTGAGGTGGG - Intronic
1203661161 Un_KI270753v1:43926-43948 AAGGCTGAGAAGTCCAAGGATGG - Intergenic
1188111237 X:26197929-26197951 CAAGCTGAGGACCGTGAGGATGG + Intergenic
1188440958 X:30215185-30215207 CAAGGTGAGGACTCTGAGGGCGG + Intergenic
1188667058 X:32837120-32837142 CATGCCGAGAACTCTGATGTTGG - Intronic
1189111432 X:38294236-38294258 CTGGCTGAAAAAGCTGAGGAAGG + Intronic
1189624259 X:42878710-42878732 CAGGTTGGGAAGTCTTAGGAAGG + Intergenic
1190036069 X:47025244-47025266 CTGGTTGAGAATTCTGAGGCAGG + Intronic
1191933045 X:66395116-66395138 CTGGCTGATAACCCCGAGGAGGG - Intergenic
1192038936 X:67596581-67596603 CAGACTGAACACACTGAGGAAGG - Intronic
1196371316 X:114982701-114982723 GGGCCTCAGAACTCTGAGGAGGG + Intergenic
1197277135 X:124492819-124492841 GAGGCAGGGAACTCTAAGGAAGG + Intronic
1198618304 X:138481398-138481420 CAAGGTGAGAACTCAGAGAATGG + Intergenic
1198960313 X:142175507-142175529 CAAGAAGAGAACTCTGTGGAAGG - Intergenic
1200115274 X:153767287-153767309 CAGGCTGAGGACCCTGGTGACGG + Exonic
1200938721 Y:8760919-8760941 CAGGCTGACAGCTCTGACAAAGG - Intergenic
1201583215 Y:15532704-15532726 GAGGCTGAGGAGGCTGAGGAGGG - Intergenic