ID: 900408821

View in Genome Browser
Species Human (GRCh38)
Location 1:2503857-2503879
Sequence CAGAAGAGAGAGAGGGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 5386
Summary {0: 1, 1: 1, 2: 37, 3: 604, 4: 4743}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900408821_900408825 -10 Left 900408821 1:2503857-2503879 CCTGCCTCCCTCTCTCTCTTCTG 0: 1
1: 1
2: 37
3: 604
4: 4743
Right 900408825 1:2503870-2503892 CTCTCTTCTGCTTCTCCCTCTGG 0: 1
1: 0
2: 4
3: 68
4: 633

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900408821 Original CRISPR CAGAAGAGAGAGAGGGAGGC AGG (reversed) Intronic
Too many off-targets to display for this crispr