ID: 900409571

View in Genome Browser
Species Human (GRCh38)
Location 1:2506615-2506637
Sequence GAGTCTCAGCTCTGGGACAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 300
Summary {0: 1, 1: 0, 2: 3, 3: 27, 4: 269}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900409563_900409571 0 Left 900409563 1:2506592-2506614 CCGGGGCGGCACCTGAACCTGAG 0: 1
1: 0
2: 0
3: 9
4: 126
Right 900409571 1:2506615-2506637 GAGTCTCAGCTCTGGGACAGGGG 0: 1
1: 0
2: 3
3: 27
4: 269
900409561_900409571 8 Left 900409561 1:2506584-2506606 CCTGGGGCCCGGGGCGGCACCTG 0: 1
1: 0
2: 1
3: 42
4: 412
Right 900409571 1:2506615-2506637 GAGTCTCAGCTCTGGGACAGGGG 0: 1
1: 0
2: 3
3: 27
4: 269
900409562_900409571 1 Left 900409562 1:2506591-2506613 CCCGGGGCGGCACCTGAACCTGA 0: 1
1: 0
2: 2
3: 9
4: 129
Right 900409571 1:2506615-2506637 GAGTCTCAGCTCTGGGACAGGGG 0: 1
1: 0
2: 3
3: 27
4: 269

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900409571 Original CRISPR GAGTCTCAGCTCTGGGACAG GGG Intergenic
900380135 1:2379875-2379897 CAGTCTCACCTCTGGGGCTGTGG + Intronic
900409571 1:2506615-2506637 GAGTCTCAGCTCTGGGACAGGGG + Intergenic
900626118 1:3609431-3609453 GAGTCTGAGTTCTGTGACGGTGG - Intronic
901219566 1:7575663-7575685 GAGTCTGAGTTCTGGCTCAGAGG + Intronic
902027013 1:13391586-13391608 CAACCTCAGCTCTGGGCCAGAGG - Intronic
904938224 1:34146917-34146939 GAGTCTCAGCATTTGGACAGTGG + Intronic
904995211 1:34626213-34626235 GAGTCTCAGGCCTGGCACAGTGG + Intergenic
905212965 1:36386755-36386777 GACTCACACCTCTGGGACAAGGG - Intergenic
905632561 1:39526782-39526804 GGGGCTCAGCACTGAGACAGAGG + Intergenic
906088343 1:43155732-43155754 CAGTCTCAGTACTGGGACACTGG + Intronic
907438440 1:54463979-54464001 GAGTGTGAGCTGTGGGACCGAGG - Intergenic
910686151 1:89918583-89918605 CAGTATCATCTCTGGGGCAGTGG - Intronic
911981133 1:104568555-104568577 GAGTATCAGCTCTGCCACAGTGG + Intergenic
912252959 1:108030144-108030166 GATTCTCAGGCCTGGCACAGTGG + Intergenic
912448051 1:109752243-109752265 GAATCTCAGGGCTGGGACATAGG - Intronic
912448172 1:109752922-109752944 GACTCTCAGGGCTGGGACATAGG - Intronic
916126194 1:161573632-161573654 TATTCTCAGCTGTTGGACAGGGG + Intergenic
916136112 1:161655472-161655494 TATTCTCAGCTGTTGGACAGGGG + Intronic
916556389 1:165897511-165897533 GAGTCTCCGTTGTGTGACAGAGG + Intronic
917534963 1:175867862-175867884 GAGTCTGAGCTCTGAGGCTGGGG - Intergenic
919280713 1:195485486-195485508 GCGTCCCAGCCCTGGCACAGAGG + Intergenic
920247631 1:204600354-204600376 CAGTCTCAGCTGTGTGACCGTGG + Intergenic
923335689 1:232968089-232968111 ACTTCTCAGCTCTGGGACATCGG + Intronic
923653165 1:235892544-235892566 GGGGCCCAGCTCTAGGACAGGGG + Intergenic
924761955 1:246995785-246995807 GAGTCTCAGCTCTGTCACCCAGG - Intronic
1064212508 10:13372112-13372134 GAGTCTGTGCTCTGGCCCAGGGG + Intergenic
1064960921 10:20964251-20964273 AAGCCTCAGCTCTGGGACTCTGG + Intronic
1066618257 10:37318126-37318148 GACTGTCAGCTATAGGACAGGGG + Intronic
1068783350 10:60944396-60944418 GTGTCTGTGCTCTGGGACACGGG + Intronic
1068962151 10:62877641-62877663 GTTTCCCAGCTCTGGGAGAGGGG - Intronic
1069034272 10:63630680-63630702 GCGTCTCAGCGCTGGAACAGAGG - Intergenic
1072604957 10:96973044-96973066 GATTCTGATCTCTGGGAAAGGGG + Intronic
1072961146 10:99930415-99930437 GAGTCTCAGCCCTGGGACGAAGG - Intronic
1073465741 10:103693645-103693667 GAGTCTCGGGTCTAGGACAGGGG - Intronic
1073814796 10:107194831-107194853 GAGACTCAGCCCTGGAAGAGGGG - Intergenic
1074928848 10:118103057-118103079 AAAACTCAGCTCTGGGACAAAGG + Intergenic
1075312724 10:121428342-121428364 GAGTCTCTACTCTGGGACCAAGG - Intergenic
1075765018 10:124886323-124886345 GATTCTCAGCCCTGAGCCAGGGG - Intergenic
1075944361 10:126419461-126419483 GAGTCTCAGCTCTGTGTCCAGGG - Intergenic
1076197785 10:128532536-128532558 GAGTCCCAACCCTGGGACAAGGG - Intergenic
1076437847 10:130459048-130459070 GTCTCTGAGCTCTGGGAGAGAGG + Intergenic
1076919144 10:133442243-133442265 GAGTGTGGGCTCTGGGACAGGGG + Intergenic
1077518211 11:3015236-3015258 GGGCCACAGCTCTGGGGCAGGGG + Intronic
1077797307 11:5505993-5506015 GAGACTCAGTACTGGGAGAGAGG - Intronic
1078624455 11:12941173-12941195 GAGGCTGTGCTCTGGCACAGGGG - Intronic
1080037849 11:27727980-27728002 GAGAATCAGCCCTGGCACAGTGG - Intergenic
1080612375 11:33915616-33915638 GAGTCTCAGCTCTAAATCAGTGG - Intergenic
1080935656 11:36860459-36860481 GAGTCTCCACACTGGGACATAGG - Intergenic
1083463701 11:62831900-62831922 CCGTGTCAGCTCTGGGGCAGTGG - Intronic
1083892193 11:65601123-65601145 GAGTCTCAGGACTGGGGCTGCGG - Intronic
1084544688 11:69809036-69809058 GAGTCTCAGCTCTCTGACTCTGG + Intergenic
1084969686 11:72764307-72764329 AAGACCCACCTCTGGGACAGAGG + Intronic
1085052140 11:73385260-73385282 GAGCTTCAGTTCTGGGAAAGGGG + Intronic
1085756619 11:79207080-79207102 GACTATCGGCTGTGGGACAGGGG + Intronic
1086521368 11:87671899-87671921 GAGTGTCAGATGTGGGTCAGTGG + Intergenic
1086839407 11:91666879-91666901 CAGTCACAGCTCTGGCAAAGTGG + Intergenic
1088019757 11:105105221-105105243 GAGTCTCATCTCTCAGTCAGAGG - Intergenic
1088878443 11:113954996-113955018 GAGCATCAGCTCTGTGTCAGGGG + Intergenic
1090661548 11:128885792-128885814 TATGCTCAGATCTGGGACAGAGG - Intergenic
1092317520 12:7433635-7433657 CGGTCCCTGCTCTGGGACAGTGG - Exonic
1093443272 12:19225176-19225198 GACTCTCACCTTTGGGAAAGCGG - Intronic
1095307562 12:40656110-40656132 AATTCTCAGGTGTGGGACAGGGG - Intergenic
1096388412 12:51210820-51210842 GAGTCTGAGATCTGAGACAAAGG - Intronic
1097196516 12:57245081-57245103 GAGGCTCAGCTGTGGAACAGAGG - Intronic
1100588290 12:95999638-95999660 GAGTCTCACCTCTGGGAATTTGG + Intergenic
1102955341 12:117055032-117055054 GTGCCTCAGCTCTGGGACACTGG + Intronic
1103480785 12:121248569-121248591 GGGTCCCTGCTCTGGGTCAGGGG + Intronic
1103970321 12:124666781-124666803 TAGTCTCAGCCCTGGGCAAGGGG - Intergenic
1104158256 12:126153829-126153851 GATGCTCTGCTCTGGGCCAGAGG + Intergenic
1104759047 12:131286223-131286245 CCGTCTCAGCTCTGGGATTGGGG - Intergenic
1104821562 12:131680273-131680295 CCGTCTCAGCTCTGGGATTGGGG + Intergenic
1105003155 12:132704133-132704155 GAGACTCAGCACTGGGCCAGAGG + Intronic
1105580062 13:21687267-21687289 GTCTCTCAATTCTGGGACAGAGG - Intronic
1106462975 13:29989308-29989330 GTTTCTCAGGTCTGGGACATAGG + Intergenic
1106621505 13:31374874-31374896 GAGGCTGACCTCTGGGTCAGAGG + Intergenic
1108442483 13:50469443-50469465 CAGTCTGAGATCAGGGACAGCGG - Intronic
1110285001 13:73739569-73739591 GAGTCATTGCTCTGGGGCAGAGG + Intronic
1112443158 13:99439754-99439776 GATTCTCCACTCTGGGACACCGG + Intergenic
1113137848 13:107113584-107113606 GACTCTGGACTCTGGGACAGTGG + Intergenic
1113522874 13:110953111-110953133 GAGCCTCAGAGATGGGACAGAGG - Intergenic
1113546241 13:111153514-111153536 GAGGCCCAGCACTGGGCCAGAGG + Intronic
1113702502 13:112397710-112397732 GAGCCTCAGAGATGGGACAGAGG + Intronic
1117475909 14:56094982-56095004 GAGTCTTAGCTCTGTGTCAGGGG + Intergenic
1117791744 14:59349100-59349122 GAGTCTTTGCTCTGGGACAGTGG + Intronic
1119765174 14:77183287-77183309 GCTTCTCAGCGCTGGGACTGTGG - Intronic
1120257710 14:82141205-82141227 GAGTCTACCCTCTGGAACAGTGG - Intergenic
1122119513 14:99544602-99544624 GAATTTCTGCTCTGGGAGAGGGG - Intronic
1122476476 14:102013499-102013521 GAGTAGCAGGTCTGGGACAGGGG + Intronic
1122495178 14:102148512-102148534 GAGTCTCAGCTCTGTCACCCAGG - Intronic
1122822517 14:104354722-104354744 CAGACGCAGGTCTGGGACAGCGG + Intergenic
1202870680 14_GL000225v1_random:160383-160405 GTGTACCAGCTCTGGGACTGGGG - Intergenic
1123888435 15:24749910-24749932 GAGTCACAGCTCTGGTTCAGGGG - Intergenic
1127736009 15:61840018-61840040 GTTTCTGAGCTCTGGGACACAGG - Intergenic
1129224699 15:74162182-74162204 GGGTCTGAGCTCTGGGAGAGGGG - Intergenic
1130999084 15:88924100-88924122 GAGTCTCATCTCTCAGTCAGGGG - Intergenic
1131428316 15:92365631-92365653 GAGTCTCTGGGGTGGGACAGAGG - Intergenic
1132639568 16:971404-971426 GAGTGTCAGCTGTGAGGCAGGGG - Intronic
1133353252 16:5116971-5116993 GAGTCTCAGTTCTCAGAGAGAGG - Intergenic
1133525774 16:6603903-6603925 GTGTCTCAGCTCTGGGGCGAGGG + Intronic
1133674217 16:8055082-8055104 GAGTCCAAGCTTTGAGACAGGGG + Intergenic
1134114663 16:11539019-11539041 GATTCTCAGCTCAGGGAGGGAGG + Intergenic
1134335426 16:13295064-13295086 GAATCTCAGCTCTGTGATTGCGG - Intergenic
1135673533 16:24394796-24394818 GCGGCTCACCCCTGGGACAGTGG + Intergenic
1136630161 16:31485303-31485325 GAGACAAAGCTCTGGGACTGAGG + Intronic
1137645920 16:50074363-50074385 GAGTCTCAGCTCTGTCACCCAGG + Intronic
1137735962 16:50723397-50723419 GATTCTCTGCTCTGGGGAAGTGG + Intronic
1140672728 16:77294722-77294744 GATTCTAAGCTCTGGGAGAGGGG + Intronic
1141177345 16:81729768-81729790 AAGTCTCAGCACTAGGGCAGTGG + Intergenic
1142404932 16:89883163-89883185 GTGACTCAGCTCTGGCTCAGGGG - Intronic
1142740329 17:1928285-1928307 GAGGCTCAGGACTGGCACAGTGG - Intergenic
1144948196 17:18980525-18980547 GAGACTCCACACTGGGACAGAGG - Intronic
1144962126 17:19050491-19050513 GGGTTTCAGCACTGAGACAGTGG - Intergenic
1144973035 17:19124030-19124052 GGGTTTCAGCACTGAGACAGTGG + Intergenic
1146320141 17:31840541-31840563 GAGCATCTGCTCTGGGAGAGAGG + Intergenic
1146653960 17:34624314-34624336 GAGTCTCCTCTTTGGGACATAGG + Intronic
1147420978 17:40322076-40322098 GGAGCTCAGCTCTGGGCCAGTGG + Intronic
1148211893 17:45813595-45813617 GAGTCGCAGCTCTGCGATCGAGG + Intronic
1149045069 17:52235767-52235789 CAGACTCAGCTCTTGGTCAGGGG + Intergenic
1149231293 17:54537199-54537221 CAGTATCTGCTCTGGGTCAGAGG + Intergenic
1149594512 17:57856437-57856459 GAGTCTCAGCTCTGTCACCCAGG - Intergenic
1151310837 17:73291611-73291633 GTGACTCAGCTCTGGGGAAGTGG + Intronic
1151545263 17:74788996-74789018 AAGCTTCAGCTCTGGGACTGGGG - Intronic
1152093078 17:78257644-78257666 GAGGGTCAGTGCTGGGACAGGGG - Intergenic
1153997634 18:10455185-10455207 CCGTCTCAGCCCTGGGAGAGGGG + Intronic
1155249788 18:23943714-23943736 GAATCTCAGCACTGAGACAGAGG - Intronic
1155885263 18:31199974-31199996 GATTTGCAGCCCTGGGACAGGGG + Intergenic
1157225327 18:45857893-45857915 GAGACTCAGCTCTGGGATCCTGG - Exonic
1158915929 18:62129252-62129274 GAGACTCAGCTCTCTGAGAGAGG - Intronic
1159433179 18:68382865-68382887 GAGTCTTAGCTGTGGAGCAGGGG - Intergenic
1159915226 18:74182477-74182499 GAGCCTCAGCTCGGGGCCACGGG + Intergenic
1160968549 19:1757361-1757383 CAGTCTCAGCTCTGGGAGTCTGG + Intronic
1161225261 19:3141776-3141798 GAGTCTCAGCTGTGTGACCTTGG - Intronic
1161228866 19:3162538-3162560 GAGACCCAGCTCTGGGACTTCGG - Intronic
1161654573 19:5506303-5506325 GAGTCTCTGCACTGTCACAGAGG + Intergenic
1162043271 19:7983207-7983229 GAGACTCAGCTCTGGGGCCCTGG + Intronic
1162451132 19:10755949-10755971 GTGTCTCAGGTCAGGCACAGTGG - Intronic
1162803185 19:13122348-13122370 GAGTCTCATGGCTGAGACAGGGG - Intronic
1163026549 19:14516213-14516235 GAGGCTCAGCTCTTGCCCAGAGG + Intronic
1163242398 19:16072227-16072249 GAGGGTCAGTTCTGGGACTGAGG - Intronic
1164476143 19:28577454-28577476 GAAACTCAGCACAGGGACAGAGG + Intergenic
1165384434 19:35502099-35502121 ACTTCTCAGCTCTGGGACACAGG - Intronic
1165925245 19:39322026-39322048 GGGGTTCAGCTATGGGACAGGGG - Intergenic
1165956278 19:39503789-39503811 GAGTCTGTGCTCTTGGAAAGAGG - Intronic
1166067033 19:40366052-40366074 TTTTCTCAGCCCTGGGACAGGGG - Intronic
1167195648 19:48026255-48026277 CTGTCTCTGCTCTTGGACAGAGG + Intergenic
925437516 2:3853134-3853156 GAGAATCACCACTGGGACAGCGG - Intergenic
926222882 2:10947802-10947824 GAGGCTCGGTTCTGTGACAGGGG - Intergenic
926721435 2:15964282-15964304 GACTGTGAGCTCTGGTACAGGGG + Intergenic
928120917 2:28582895-28582917 GAGGCCCATCTCTAGGACAGGGG + Intronic
928555761 2:32423215-32423237 GAGTCTCAGGCCGGGAACAGTGG - Intronic
929147886 2:38722424-38722446 GGGTTACAGCTCTGGGCCAGAGG - Intronic
929262949 2:39886388-39886410 GAGACTCAATTCTGGGACACTGG + Intergenic
929815217 2:45225259-45225281 GAGTCCCAGCTCAGGGAGAAGGG - Intergenic
936060842 2:109294824-109294846 GATGCCCAGCTCTGGGGCAGAGG - Intronic
937334384 2:121052557-121052579 GAGACACAGCTCTGAGAGAGGGG - Intergenic
938293462 2:130162465-130162487 GAGCCCCAGGTCTGGCACAGAGG - Intronic
938463091 2:131510496-131510518 GAGCCCCAGGTCTGGCACAGAGG + Intergenic
941697335 2:168567326-168567348 CAGTTTTAGCTTTGGGACAGAGG + Intronic
945077161 2:206051253-206051275 GGGTCTCAGCTCTGTCGCAGTGG + Intronic
948252476 2:236541408-236541430 GAATCCCAGTTCTTGGACAGGGG - Intergenic
948528094 2:238585902-238585924 GAGGTTCAGCTCTAGGGCAGGGG - Intergenic
948591079 2:239050561-239050583 GATGGTCAGCTCTGAGACAGTGG - Exonic
1168790368 20:572134-572156 GAGTCTCAGCGCTGGGAGGAGGG + Intergenic
1169072233 20:2739651-2739673 TACCCTCAGCTCAGGGACAGAGG - Intronic
1171240925 20:23566447-23566469 TAACCTCAGCCCTGGGACAGAGG + Intronic
1171242697 20:23584927-23584949 TAACCTCAGCCCTGGGACAGAGG - Intergenic
1171287305 20:23951779-23951801 AAGTCTCAGCTCTGAGAAAATGG - Intergenic
1171487604 20:25495610-25495632 GAGTCACAGCTCTTGGGCAGGGG - Intronic
1173945009 20:46943557-46943579 GAGTCTCAGATCTGGGATTTGGG + Intronic
1173951709 20:46998554-46998576 GATTCTCTGCTTTGGCACAGAGG - Intronic
1174396860 20:50252024-50252046 GACTGTCAGCTCTGGGAAGGCGG - Intergenic
1175189726 20:57203164-57203186 GAGTATCTGCTCTGGTACACAGG - Intronic
1175201031 20:57277790-57277812 GAGACTCTGTTCGGGGACAGGGG - Intergenic
1176261814 20:64185808-64185830 GGGTGTTAGCTCTGGGACAAGGG + Intronic
1177566599 21:22831040-22831062 GAGTCACAGCTGTAGAACAGGGG + Intergenic
1178882340 21:36459579-36459601 GAGCCTCAGGTTGGGGACAGAGG + Intergenic
1180002819 21:45002758-45002780 GAGGCTCATCTCTGGGCCTGGGG + Intergenic
1181104473 22:20565638-20565660 CACTGTCAGCTCTGGGAGAGGGG - Intronic
1181433383 22:22896158-22896180 GGGTCACTGCTCAGGGACAGGGG + Intergenic
1181439472 22:22928346-22928368 AACTCTCAGCTGTGGGCCAGGGG + Intergenic
1183952620 22:41360148-41360170 GAGTGACATCTCGGGGACAGAGG - Intergenic
1185402522 22:50626268-50626290 TGGTCTCAGGTCTGGGACACAGG + Exonic
949348261 3:3097577-3097599 AAGTCACAGCTCAAGGACAGAGG + Intronic
949485392 3:4532963-4532985 GAATTTCTGCTCTGGGACAGAGG + Intronic
949924365 3:9029325-9029347 GAGGTTCACCTCTGGGACAAGGG - Intronic
950024847 3:9813169-9813191 AGGCCTCAACTCTGGGACAGTGG - Intronic
951625956 3:24663274-24663296 CTTTCTCAGGTCTGGGACAGAGG + Intergenic
953122398 3:40057591-40057613 AAGTATGAGTTCTGGGACAGGGG - Intronic
953631531 3:44622226-44622248 GGGCCAGAGCTCTGGGACAGTGG - Intronic
953978424 3:47400214-47400236 GAGGCTCAGATCAGGGAAAGAGG - Intronic
954010365 3:47631237-47631259 GGGTATTAGCTCTGGGACAACGG - Intronic
954361971 3:50126834-50126856 GAGTCTCAGGGCTGGGGTAGGGG + Intergenic
954363941 3:50136546-50136568 GAGACTCAGCTCTGGGAGGACGG - Intergenic
954371399 3:50171206-50171228 GAGTCCCAGCTTAGGGGCAGAGG - Intronic
955324772 3:58001487-58001509 GAATCCCAGCTCTGTGAGAGGGG - Intergenic
956687935 3:71848804-71848826 GAGCTGGAGCTCTGGGACAGAGG - Intergenic
956869654 3:73404244-73404266 GAGTCTCAGCTGGTGGACACGGG - Exonic
959640132 3:108623161-108623183 GAGTATCAGCTCAGCCACAGTGG - Intronic
960947167 3:122974632-122974654 GAGTTCCAGCCCTGGGCCAGGGG + Intronic
961001308 3:123375912-123375934 GAGTCCCAGCTCTGGGACTGTGG - Intronic
961001376 3:123376313-123376335 GAGTCCCAGCTCTGGGACGGTGG + Intronic
961868361 3:129971100-129971122 GATTCTAAGCTCTGTGAGAGAGG + Intergenic
962052073 3:131826742-131826764 CAGTCTCAGGTCAGGCACAGTGG + Intronic
964242830 3:154616426-154616448 GTTTCTCAGGTCTGGGACATAGG - Intergenic
965879891 3:173376106-173376128 AAGTCTCAGCTCAAAGACAGTGG + Intergenic
968265775 3:197362269-197362291 TCCTCACAGCTCTGGGACAGGGG + Intergenic
968735969 4:2296777-2296799 GAGTGACAGGTCTGGGACTGAGG - Intronic
970733840 4:19142110-19142132 GAGCCTCAGCTCAGGGACCAAGG - Intergenic
971425383 4:26510260-26510282 GAGGCCCAGCTCTGGGAGAAAGG - Intergenic
972036982 4:34536389-34536411 GAGTCGCAGCTCTGTGAGAGGGG + Intergenic
972386568 4:38572317-38572339 GAGGCTTAGTTCTGGGACTGTGG - Intergenic
972601547 4:40577228-40577250 CAGTTTCAGTTCTGGGAAAGGGG + Intronic
973793235 4:54397157-54397179 GAATGTCAGCTCTAGGGCAGGGG + Intergenic
974233846 4:59153999-59154021 GCGTCCCAGTTCTAGGACAGAGG + Intergenic
977550877 4:98442080-98442102 AAGTCTCTGCTCTGTGAGAGAGG - Exonic
977673574 4:99723217-99723239 TAGTCACAGATGTGGGACAGGGG + Intergenic
977726157 4:100299349-100299371 GAGCCCCAGCTGTGGGACAAAGG - Intergenic
978905144 4:113996704-113996726 GAGCCTCATCTCTGAGACAAGGG - Intergenic
980156891 4:129118085-129118107 GTTTCTCAGGTCTGGGACATAGG - Intergenic
981660268 4:147158328-147158350 CAGGCACAGCTCTGGGGCAGAGG - Intergenic
981782419 4:148443860-148443882 AAGTCTCAGCCCTGGGTTAGGGG - Intronic
983572217 4:169222437-169222459 GAGTCTCAGCTCTGTCACCCAGG - Intronic
983775581 4:171602770-171602792 GAGTCTCAAGTCAGGAACAGAGG - Intergenic
984653963 4:182297820-182297842 GAGGCCCAGGCCTGGGACAGAGG - Intronic
985869489 5:2542822-2542844 CTGTCCCAGCTCTGGGACAGCGG - Intergenic
986415702 5:7526004-7526026 GGGTATCAGAGCTGGGACAGGGG - Intronic
989565984 5:42901848-42901870 GAGTCTCCCCTGTGGGACACTGG + Intergenic
990552581 5:56898743-56898765 GAATCTCAGCTTTGGGAAATTGG + Intergenic
993661667 5:90645191-90645213 CAGTCTCAGCACCGGGACACGGG + Intronic
994036456 5:95207287-95207309 GGGGCTTATCTCTGGGACAGAGG + Intronic
995553213 5:113300698-113300720 GAGTCACAGCGGTGGGAGAGTGG - Intronic
998104770 5:139461610-139461632 GAGTCACAGGTCTGGGGCTGGGG - Intronic
998118145 5:139554319-139554341 GAGTCAGAGCCCTGGCACAGTGG - Intronic
1001922043 5:175608512-175608534 GGATGTCAGCTCTGGGAGAGGGG - Intergenic
1005181463 6:23112116-23112138 GAGTCTCATCTCTTAGTCAGGGG + Intergenic
1005999907 6:30956559-30956581 ATGTCTCATTTCTGGGACAGAGG - Intergenic
1006406380 6:33848129-33848151 GAGTCTCAGCTCGGGGTTAAGGG - Intergenic
1006945663 6:37783151-37783173 GAGTCTTTGCTCAGGGACAGGGG + Intergenic
1007324417 6:41049148-41049170 GAGGCCCAGCTCTGGGAGAAGGG - Intronic
1007340928 6:41191294-41191316 GAGTCTGAGCCCTGAGTCAGTGG + Exonic
1007663466 6:43500700-43500722 GAGGCTCAGCTCTGGACCACTGG - Intronic
1008090504 6:47289368-47289390 GATAGGCAGCTCTGGGACAGGGG - Intronic
1008369746 6:50718695-50718717 GAGTGTCAAGTCTGGGACTGTGG - Intronic
1012446879 6:99315841-99315863 GAGGCTCAGCTGTGGACCAGTGG - Intronic
1013276405 6:108589304-108589326 GACTCCCAGCTCCGGGGCAGGGG - Intronic
1013428198 6:110033895-110033917 GAGGCTCAGCTTTAGGAGAGAGG - Intergenic
1013592261 6:111629139-111629161 AAGGCTCAGCTCTGGCATAGGGG + Intergenic
1014411375 6:121125851-121125873 GAGTATCTGCTGTGGGACACAGG + Intronic
1015648468 6:135423753-135423775 GAGTATCAACTCTGGTTCAGAGG - Intronic
1016093743 6:140010937-140010959 GACTTTCAGCTCAGTGACAGTGG + Intergenic
1016377713 6:143440604-143440626 GTGTCCCAGTTCTGTGACAGTGG + Intronic
1016503228 6:144746508-144746530 GAGTCTCAACTCTGGCACCCAGG + Intronic
1016837881 6:148497308-148497330 CAGTCTTTTCTCTGGGACAGGGG + Intronic
1018838248 6:167501090-167501112 CAGTCTCAGCTGTGAGACTGAGG - Intergenic
1018941272 6:168310121-168310143 GGGTCTCATCTCAGGCACAGGGG - Intronic
1018988614 6:168656581-168656603 GAAGCTCAGCTGTGAGACAGGGG + Intronic
1019117436 6:169776586-169776608 GTGTCTCAGCTCTGAGGCAACGG - Exonic
1022896633 7:34756433-34756455 GGGTCTAAGGTCTAGGACAGGGG + Intronic
1023483294 7:40658250-40658272 GAGTCTCAACTCTGAGATAGAGG + Intronic
1023942106 7:44775816-44775838 AAGTCACAGCTCGGGGTCAGGGG + Intergenic
1024418012 7:49130392-49130414 GAGTCACAGCACTGAGACAGGGG + Intergenic
1026151310 7:67790249-67790271 GAGACTCAGATATGGGAGAGAGG + Intergenic
1027262885 7:76477595-76477617 TAGTCTCAGCTGGGTGACAGAGG + Intronic
1027314267 7:76975704-76975726 TAGTCTCAGCTGGGTGACAGAGG + Intergenic
1029626250 7:101722074-101722096 GAGTTTGAGGGCTGGGACAGGGG + Intergenic
1032360909 7:131253654-131253676 GAGACTCTGCTCTGGAACTGTGG - Intronic
1034106071 7:148490972-148490994 GTATCTCCCCTCTGGGACAGAGG + Intergenic
1034501512 7:151453652-151453674 GAGTCTGAACACTGGGCCAGTGG + Intergenic
1035748915 8:1981706-1981728 GTGTCCCAGCTCCAGGACAGGGG - Intronic
1038291438 8:26253095-26253117 CAGTCTCACCTGTGGCACAGTGG - Intergenic
1040915663 8:52564914-52564936 GATTCCCAGCTCTCGGAAAGAGG - Intronic
1041434988 8:57829271-57829293 GAGTCTCAGGTCTGGGACCATGG + Intergenic
1041544312 8:59024767-59024789 GTGTCTGAGCTCTGGAAAAGCGG + Intronic
1043942252 8:86209185-86209207 AAGTGTCAGCTCTGTGCCAGAGG - Intergenic
1049017432 8:139930763-139930785 GGGTCTCATCTATGAGACAGCGG - Intronic
1049312971 8:141943160-141943182 GAGGCACAGCTGTGGGACAGAGG - Intergenic
1049613947 8:143568251-143568273 CACTCTGAGCTCTGGGATAGGGG + Exonic
1050016163 9:1236711-1236733 GAGGCTCAGGTCAGGGAGAGTGG - Intergenic
1052857728 9:33417507-33417529 GAGTCTCAGGGTTTGGACAGAGG - Intergenic
1057002910 9:91529303-91529325 GAGCCTCTGCTCCGGCACAGTGG - Intergenic
1057278165 9:93687184-93687206 CAGTCTTAGCTCTGGGTCCGAGG + Intergenic
1058461634 9:105189252-105189274 GAGTCTATGCTGTGGGACAGGGG + Intergenic
1058814578 9:108671398-108671420 GAGTCCCTCCTCTGGGACACTGG - Intergenic
1059324148 9:113493451-113493473 GGGCCTCAGCTCTGGGCCATGGG + Intronic
1060206475 9:121685400-121685422 TAGTCTGAGGCCTGGGACAGAGG + Intronic
1060790799 9:126484317-126484339 AAGTCTCAGCTTTGGGAAGGTGG + Intronic
1061495572 9:130972325-130972347 GAGTCACAGCACAGAGACAGAGG - Intergenic
1061495575 9:130972361-130972383 GAGTCACAGCACAGAGACAGAGG - Intergenic
1062165063 9:135103554-135103576 GATGCTCAGCTCTGAGCCAGTGG + Intronic
1062633036 9:137475222-137475244 GAGTCTCAGGCCAGGCACAGTGG + Intronic
1203733777 Un_GL000216v2:116208-116230 GTGTACCAGCTCTGGGACTGGGG + Intergenic
1186796363 X:13050409-13050431 GACTCTCAGCTCAGGGACATGGG + Intergenic
1186899025 X:14033338-14033360 GGGTCCCAGCTGGGGGACAGGGG - Intergenic
1190032021 X:46983274-46983296 GAGCCACAGCTCTGGCGCAGTGG + Intronic
1192631192 X:72779200-72779222 GACTCTCAGATGTGGGGCAGAGG - Intronic
1192650517 X:72941601-72941623 GACTCTCAGATGTGGGGCAGAGG + Intronic
1194527593 X:94996464-94996486 GATTATCTGCTTTGGGACAGAGG - Intergenic
1195243860 X:102979087-102979109 AAGTCCCAGCTGTGGGACTGAGG + Intergenic
1200838879 Y:7759941-7759963 AAGTCTCACCACTGTGACAGTGG - Intergenic
1202627236 Y:56872213-56872235 GTGTACCAGCTCTGGGACTGGGG - Intergenic