ID: 900409858

View in Genome Browser
Species Human (GRCh38)
Location 1:2507622-2507644
Sequence GCCATTTCTGGCCCCCACTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900409858_900409864 -2 Left 900409858 1:2507622-2507644 CCACAGTGGGGGCCAGAAATGGC No data
Right 900409864 1:2507643-2507665 GCCACTGGGCACCTCTGGGCAGG No data
900409858_900409863 -6 Left 900409858 1:2507622-2507644 CCACAGTGGGGGCCAGAAATGGC No data
Right 900409863 1:2507639-2507661 AATGGCCACTGGGCACCTCTGGG No data
900409858_900409869 15 Left 900409858 1:2507622-2507644 CCACAGTGGGGGCCAGAAATGGC No data
Right 900409869 1:2507660-2507682 GGCAGGCCAGGTCTCCATGAGGG No data
900409858_900409868 14 Left 900409858 1:2507622-2507644 CCACAGTGGGGGCCAGAAATGGC No data
Right 900409868 1:2507659-2507681 GGGCAGGCCAGGTCTCCATGAGG No data
900409858_900409862 -7 Left 900409858 1:2507622-2507644 CCACAGTGGGGGCCAGAAATGGC No data
Right 900409862 1:2507638-2507660 AAATGGCCACTGGGCACCTCTGG No data
900409858_900409872 20 Left 900409858 1:2507622-2507644 CCACAGTGGGGGCCAGAAATGGC No data
Right 900409872 1:2507665-2507687 GCCAGGTCTCCATGAGGGAGGGG No data
900409858_900409871 19 Left 900409858 1:2507622-2507644 CCACAGTGGGGGCCAGAAATGGC No data
Right 900409871 1:2507664-2507686 GGCCAGGTCTCCATGAGGGAGGG No data
900409858_900409866 3 Left 900409858 1:2507622-2507644 CCACAGTGGGGGCCAGAAATGGC No data
Right 900409866 1:2507648-2507670 TGGGCACCTCTGGGCAGGCCAGG No data
900409858_900409870 18 Left 900409858 1:2507622-2507644 CCACAGTGGGGGCCAGAAATGGC No data
Right 900409870 1:2507663-2507685 AGGCCAGGTCTCCATGAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900409858 Original CRISPR GCCATTTCTGGCCCCCACTG TGG (reversed) Intergenic