ID: 900410422

View in Genome Browser
Species Human (GRCh38)
Location 1:2510149-2510171
Sequence CAGGATGACCTGCAGGAGGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 480
Summary {0: 1, 1: 0, 2: 5, 3: 54, 4: 420}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900410417_900410422 -9 Left 900410417 1:2510135-2510157 CCTGAGTTGCACGCCAGGATGAC 0: 1
1: 0
2: 0
3: 4
4: 73
Right 900410422 1:2510149-2510171 CAGGATGACCTGCAGGAGGAGGG 0: 1
1: 0
2: 5
3: 54
4: 420

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900410422 Original CRISPR CAGGATGACCTGCAGGAGGA GGG Exonic
900180669 1:1309648-1309670 CAGGGTGACCGTCAGGAGGGTGG - Intronic
900410422 1:2510149-2510171 CAGGATGACCTGCAGGAGGAGGG + Exonic
900415903 1:2534548-2534570 CAGGCTGACCTGGGGAAGGAGGG + Intergenic
900711878 1:4119590-4119612 CAGGGAGACAGGCAGGAGGAGGG + Intergenic
902180588 1:14685382-14685404 CAGGCTGAGCTCCAGCAGGAGGG + Intronic
902839340 1:19065346-19065368 CAGGGTAACCGGGAGGAGGACGG + Intergenic
903363674 1:22792942-22792964 GAGGACGGCCTCCAGGAGGAGGG + Intronic
903603012 1:24556024-24556046 CAGGATCACCTGCACGGGGCGGG + Intergenic
904531791 1:31174821-31174843 CAGCATGAACTGCAGGAGTCAGG - Intergenic
906107355 1:43302775-43302797 GAGGATGAGTTGCAGAAGGAGGG + Intronic
906191973 1:43904758-43904780 CAGGAAGAGGAGCAGGAGGAGGG - Intronic
906192249 1:43905754-43905776 CAGGAAGAGGAGCAGGAGGAGGG - Intronic
906192337 1:43906081-43906103 CAGGAAGAGGAGCAGGAGGAGGG - Intronic
906192381 1:43906225-43906247 CAGGAAGAGGAGCAGGAGGAGGG - Intronic
906212076 1:44017558-44017580 GATGGTGACCGGCAGGAGGATGG + Intronic
907864407 1:58385692-58385714 CAGGATGCAAAGCAGGAGGAAGG + Intronic
908107688 1:60862069-60862091 CATGATGACCTGAATGAGGCTGG + Intergenic
912559426 1:110539299-110539321 CAGGCTGACCAATAGGAGGAAGG + Intergenic
915205678 1:154268928-154268950 CACCATCACCTGCAGCAGGATGG + Exonic
915323501 1:155069034-155069056 CAAGATCCCCTGGAGGAGGAGGG + Exonic
915544162 1:156586455-156586477 CTGGATGACCTGAAAGAGGCAGG - Exonic
915584773 1:156838491-156838513 CAGGTTGACCTGGAGAAGGAAGG - Intronic
915632550 1:157163491-157163513 CAGGATCACCTGCAGGGGGCAGG - Intergenic
915843831 1:159240940-159240962 CAGGATGATGGGCAGCAGGAAGG - Intergenic
916205353 1:162311108-162311130 CATGAGGACCTGCAGGATGGTGG - Intronic
916746330 1:167687623-167687645 CAGGCTGAGCTACAGGAGTATGG - Intronic
917849352 1:179047274-179047296 CAGGATGGTCTGGAGGAGGGAGG - Intronic
919817858 1:201452944-201452966 CAGGATGCCCTGAGGTAGGAAGG + Intergenic
919865801 1:201782162-201782184 CAGGTTTGCCTGCAAGAGGACGG - Exonic
920498680 1:206472895-206472917 CAGAATGACCTGCCTCAGGAGGG + Intronic
920572940 1:207031659-207031681 CAGATTTACCTGCAGAAGGAAGG - Intronic
920776056 1:208938347-208938369 GAGGATGAGATGAAGGAGGAGGG - Intergenic
921184097 1:212655517-212655539 GAGGATGGCCTGCAGAGGGAGGG + Intergenic
921221451 1:212976853-212976875 AAGGAAGACCTGCAGGAAGAGGG + Intronic
921221723 1:212978419-212978441 AAGGAAGACCTGCAGGAAGAGGG + Intronic
921797330 1:219361713-219361735 CACGATGACCTCCAGAAGAAAGG + Intergenic
921890617 1:220350084-220350106 CAGGCTGTCAAGCAGGAGGAGGG + Intergenic
923786145 1:237071165-237071187 CAGGAAGACCTGCCTGCGGAAGG - Intronic
924225964 1:241921861-241921883 CAGTATGACCTGTAAGAAGAGGG + Intergenic
924412086 1:243817065-243817087 CAGGATGACCTGCTAGAGAGAGG + Intronic
1062791401 10:308692-308714 CAGGAGGCCCTGCAGGCTGAGGG - Intronic
1063244799 10:4206739-4206761 CGGGATGAGCAGAAGGAGGATGG - Intergenic
1063277835 10:4590598-4590620 CAGGATGAACAGCAGGAGCCAGG + Intergenic
1064138782 10:12772733-12772755 CAGGTTGTCCTGGAGGAGGCTGG + Intronic
1066455413 10:35567905-35567927 CAGGAAGTCCTGCAGAGGGAGGG - Intronic
1066650051 10:37646107-37646129 AAGGAAGACCTTCAGCAGGAAGG - Intergenic
1067032947 10:42891600-42891622 AAGGAAGACCTTCAGCAGGAAGG - Intergenic
1067097072 10:43308554-43308576 CAGAATGGGCTGCAGGAAGAGGG - Intergenic
1067277972 10:44851316-44851338 CAGGAAGACTTTCTGGAGGAAGG + Intergenic
1067324013 10:45249181-45249203 CAGGAAGAGCTGCAGGAGCAGGG - Intergenic
1067723397 10:48747908-48747930 CAGAATGGCCTGAATGAGGATGG - Intronic
1068137487 10:52965219-52965241 CAGGACTACCAGCAGCAGGAGGG - Intergenic
1069833854 10:71296564-71296586 GGGGATCTCCTGCAGGAGGAGGG - Exonic
1071954560 10:90743671-90743693 CAGGAGGGCCTGCACAAGGAGGG - Exonic
1073054568 10:100690851-100690873 CAGGAGGATGTGAAGGAGGAAGG + Intergenic
1074357771 10:112801156-112801178 CAGGATGGCCAGCAGGAGGTGGG + Intronic
1074821038 10:117178643-117178665 CAGGAAGACCTGAAGCAGGAAGG - Intergenic
1075032023 10:119030030-119030052 CAGGACGACGAGGAGGAGGAGGG - Exonic
1075148045 10:119899998-119900020 CAGGAGGAGAAGCAGGAGGAAGG - Intronic
1076056127 10:127374675-127374697 CTGGATTACCTGCAAGGGGAGGG + Intronic
1076298149 10:129403330-129403352 GAGGATGACCTGCAGGCTGCTGG - Intergenic
1076858552 10:133129020-133129042 CACGTGCACCTGCAGGAGGAGGG + Exonic
1081684535 11:45032927-45032949 CAGGAAGACCTCCTGGAGGAGGG - Intergenic
1081756908 11:45551287-45551309 CAGGAGGACCTGCAGGAGATGGG - Intergenic
1083323965 11:61863967-61863989 CAGGATGACCCTCAGGGAGATGG - Intronic
1083350204 11:62022602-62022624 CAGGATGACATATAGGGGGAGGG - Intergenic
1083393731 11:62374112-62374134 CAGGATGGCCCGCACGAGGCAGG - Intronic
1083756972 11:64797013-64797035 CAGGATGACCTCTGGGAGGGAGG + Exonic
1083895775 11:65619031-65619053 CGGGGGGAGCTGCAGGAGGAAGG + Exonic
1083949793 11:65947608-65947630 CAGGACTCCCTGCAGAAGGAGGG + Exonic
1084218424 11:67663973-67663995 CAGGAAGCCCTGCAGGATCATGG + Intronic
1085046527 11:73356827-73356849 CAGGGAGACCTGCAGGTAGAGGG - Intronic
1085258920 11:75193254-75193276 CAGGACCACCAGCAGGAAGATGG - Exonic
1085260220 11:75200312-75200334 CAGGCTGACCAGGAGCAGGAAGG - Exonic
1085738064 11:79056715-79056737 CAAGATGATCTGCAGCAGGATGG + Intronic
1085882597 11:80485298-80485320 CATGATGACAGGCAGTAGGATGG + Intergenic
1086191836 11:84088860-84088882 CAGGAAGACCTTCATGAGAAGGG - Intronic
1087203721 11:95372322-95372344 CAGGAGGATGTGAAGGAGGAGGG + Intergenic
1089248252 11:117137978-117138000 CAGGGTGACCTGCGGGGTGAAGG + Intergenic
1089258459 11:117206583-117206605 CAGGGTGACCTGCGGGGTGAAGG - Intronic
1089428628 11:118401830-118401852 CGGGATGGCCTGCAGGTGGAGGG + Exonic
1089668480 11:120035337-120035359 CAGGATTATCTGCAGAAGGAAGG - Intergenic
1090017317 11:123097749-123097771 CAGGAGGACAAGAAGGAGGAGGG + Intronic
1090071322 11:123546934-123546956 CAGAATGACCAGTAGGAGCAGGG + Intronic
1090465960 11:126933387-126933409 CGTGATGACTTGAAGGAGGAAGG - Intronic
1091122087 11:133065138-133065160 CATGAAGTCCCGCAGGAGGAAGG + Intronic
1091337883 11:134786134-134786156 CAGTCTGAGATGCAGGAGGAAGG - Intergenic
1092108472 12:5942011-5942033 CAGGATGTTCTGCAGGCTGAAGG + Intronic
1092113660 12:5982826-5982848 CTTGATGACATACAGGAGGATGG + Intronic
1094078876 12:26510642-26510664 CAGGAGGACCCGCAGGAGTAAGG + Intronic
1095803126 12:46289477-46289499 CAGCATGACCTGTAGTAGGGTGG + Intergenic
1096753105 12:53775823-53775845 CACAATGACCTTCAGGATGAAGG + Intergenic
1097130845 12:56809861-56809883 CAGGATGACCTGCCTGCAGAGGG - Intergenic
1099970215 12:89492661-89492683 CAGGATGAGGTGCAGGTGTATGG - Intronic
1101443757 12:104722722-104722744 AAAGATGACCTGCAGGGGGATGG - Intronic
1101703752 12:107200412-107200434 GAGGCTGAAGTGCAGGAGGATGG - Intergenic
1101800048 12:108013826-108013848 CTGGAAGACCTGAAGGAGGAAGG - Intergenic
1103702285 12:122854106-122854128 CTGGATGACCTGGATGAGGGGGG - Exonic
1104277183 12:127340379-127340401 GATGATGACCGGCAGGAGTATGG + Intergenic
1104645655 12:130495471-130495493 CAGGGTGACCTGGAGGGAGAGGG - Intronic
1104727051 12:131084635-131084657 CGGGACCACCTGCATGAGGATGG - Exonic
1105279122 13:18952988-18953010 CAGGATGGGCTCCAGGAGGCAGG + Intergenic
1105303919 13:19156290-19156312 CAGGATGAAGAGCAGGTGGAAGG - Intergenic
1105635550 13:22212209-22212231 CAGCAGGGCCTGCAGGATGATGG + Intergenic
1105743069 13:23349101-23349123 CTGGAAAACCTGCAGCAGGAGGG + Intronic
1106458634 13:29948988-29949010 CGCCATGCCCTGCAGGAGGAGGG + Intergenic
1108709151 13:53016103-53016125 CAGGATGCCCTGTGAGAGGAGGG - Intergenic
1109048998 13:57453606-57453628 CAGGATGACCTGAAGAAATATGG - Intergenic
1110803300 13:79725720-79725742 CAGGATGGGGGGCAGGAGGATGG - Intergenic
1112009316 13:95280667-95280689 AAGGATGAGGTGCAGCAGGAAGG - Intronic
1112121762 13:96420095-96420117 AAGGAAAACCTGCAGCAGGAAGG - Intronic
1113463927 13:110501007-110501029 CAGTATGAGCTGCAGCAAGAAGG + Intronic
1113634717 13:111911825-111911847 CAGGCTGACCTGCTAGAAGAAGG - Intergenic
1113797009 13:113064290-113064312 CATTATGACCTGGAGGAGAAAGG - Exonic
1114183223 14:20382297-20382319 CAGGATGTGCTGCAGCAGCAGGG + Exonic
1114190463 14:20436315-20436337 CTGTATGACCTACAGGTGGAAGG - Intergenic
1114349557 14:21835516-21835538 CAGGATGACCAGCAGCAGAAAGG - Intergenic
1114645974 14:24256327-24256349 CAGGCTGCTCTGCTGGAGGATGG + Intronic
1114871791 14:26667155-26667177 TAGGAAGACCAGAAGGAGGAAGG - Intergenic
1115662708 14:35512728-35512750 CAGGAGCACCTGCAGAAGAAGGG - Intergenic
1116070576 14:40039343-40039365 CAGGTGGACCTGTAGGAGGGAGG + Intergenic
1116345285 14:43785834-43785856 AAGAATGTCCTTCAGGAGGAAGG - Intergenic
1116755812 14:48946657-48946679 CAGGAGGATGGGCAGGAGGAGGG - Intergenic
1118186422 14:63542718-63542740 CAGGAGGACCGGGAGGAAGAAGG + Intronic
1119021992 14:71124015-71124037 CAGGATCACCAGGAGGAGGCGGG - Intergenic
1119766791 14:77195571-77195593 CAGAATCATCTGCAGGAGGAGGG - Intronic
1120192297 14:81450325-81450347 CAGGAGGAGCTGCAGGTTGATGG + Intergenic
1120994343 14:90405194-90405216 CAGGATGACGTGCAGAAAAATGG + Exonic
1121835545 14:97088867-97088889 GAGGATGACCTGGAGGAGGAAGG + Intergenic
1122274682 14:100585486-100585508 CAGGAGTGCCTGCAGGAGTAGGG + Intronic
1122616237 14:103019914-103019936 CAAGAAGAACTGCAGGCGGAGGG + Intronic
1122903150 14:104790253-104790275 CACCCTGACCTGCAGGAGCAAGG + Intronic
1123007889 14:105333200-105333222 CAGGAGCACATGCAGCAGGAGGG - Intronic
1124047253 15:26161710-26161732 CAGCAGTACCAGCAGGAGGAAGG - Intergenic
1124094158 15:26633318-26633340 CAGGGTCAGCTGCAGTAGGATGG - Intronic
1124345638 15:28919765-28919787 CAGGATGACCTGGGGGAGCGGGG - Intronic
1125454252 15:39841512-39841534 CAGGAAGACCCACAGGAAGAAGG + Intronic
1125955665 15:43789345-43789367 TGGGATGACCTGAGGGAGGAGGG + Intronic
1128898574 15:71398356-71398378 GAGGGTGACCTGAAGAAGGAAGG + Intronic
1129205365 15:74034349-74034371 ACGGATGCCCTGCAGGGGGACGG - Intronic
1129510970 15:76122169-76122191 CAGGCTGGCCTGCTAGAGGATGG - Intronic
1129741175 15:77990328-77990350 CAGGATGCCTTGCCGGAGGCTGG + Intronic
1129844539 15:78762224-78762246 CAGGATGCCATGCTGGAGGCTGG - Intronic
1130183193 15:81651906-81651928 CAGGATGACCTGCTGCAGAAAGG + Intergenic
1130459819 15:84152636-84152658 CAGGCTGACGGGCAGGCGGACGG + Intergenic
1131151402 15:90049568-90049590 GAGGATGACCTGTAGGAGCTTGG - Intronic
1132724866 16:1334187-1334209 TACGAGGACCTGCGGGAGGAGGG - Intronic
1132887427 16:2188845-2188867 CAGGATGAGCTGCAGGGGCTGGG - Intronic
1133468095 16:6047326-6047348 CAGGATGCCGTGCATGAGGAAGG + Intronic
1136103353 16:28011297-28011319 GAGGATGCCCTGCAGGCGGCTGG - Intronic
1136156096 16:28383263-28383285 CAGGTTGATGTGCAGGTGGAAGG + Exonic
1136206990 16:28732025-28732047 CAGGTTGATGTGCAGGTGGAAGG - Exonic
1136480046 16:30535438-30535460 CAGGAAGACGTGAAGCAGGAAGG + Intronic
1137222797 16:46472482-46472504 GGGGATGACCTCCATGAGGAGGG + Intergenic
1137701667 16:50502213-50502235 CAGGCTGACCTGGAGGAGAAGGG + Intergenic
1138077711 16:54058646-54058668 CAGTTATACCTGCAGGAGGATGG - Intronic
1138135014 16:54513850-54513872 CAGGAGGTCCTACAGGAGTATGG - Intergenic
1139410302 16:66753260-66753282 GTGGATGACCTGAAGCAGGAAGG + Intergenic
1139985690 16:70896730-70896752 AAGGATGACCTGGAGCATGAAGG - Intronic
1140718890 16:77752526-77752548 AAGGATGACTTTTAGGAGGAGGG + Intergenic
1140754689 16:78056704-78056726 AAGAATGAGCTGCAGGAGGTGGG - Intronic
1141009808 16:80386999-80387021 CTGAATGACGTGGAGGAGGAGGG - Intergenic
1141817819 16:86425011-86425033 CAGGATGAACAGCAGCAGGAGGG + Intergenic
1141951503 16:87342879-87342901 CAGGATGTCCGGCGGGAGGCAGG - Exonic
1142622503 17:1173793-1173815 CAGGAGGACCGGCAGGAACAGGG - Intronic
1142658819 17:1413374-1413396 CAGGCAGCCCTGCTGGAGGATGG + Intergenic
1142889145 17:2931757-2931779 CAGGCTGACCTGCAAGAAGAGGG - Intronic
1143149499 17:4798831-4798853 CAGGATGACTGGCAGGAAGCAGG - Intergenic
1143604818 17:7976757-7976779 CAGGGACTCCTGCAGGAGGAAGG + Intergenic
1143619503 17:8072997-8073019 CAGGGCCACCGGCAGGAGGAGGG - Intronic
1144154801 17:12488954-12488976 ATGGATCACCTACAGGAGGAAGG + Intergenic
1144677884 17:17173469-17173491 CTGGTTCACCTGCAGGAGGACGG + Intronic
1145208456 17:20996726-20996748 GAGGAAGAGGTGCAGGAGGAAGG - Intergenic
1146585432 17:34077937-34077959 CAGGATGTCCTGGAGGAAGGAGG - Intronic
1146647255 17:34583475-34583497 CAGGCAGCCCTGGAGGAGGAGGG - Intronic
1147522747 17:41190118-41190140 CAGGGTGTGCTGCAGCAGGAAGG - Exonic
1147526284 17:41226886-41226908 CAGGGTGTGCTGCAGCAGGAAGG - Exonic
1147527319 17:41238253-41238275 CAGGGTGTGCTGCAGCAGGAAGG - Exonic
1147528444 17:41249937-41249959 CAGGGTGTGCTGCAGCAGGAAGG - Exonic
1147528966 17:41255602-41255624 CAGGTTGTGCTGCAGCAGGAAGG - Exonic
1147529873 17:41265609-41265631 CAGGGTGTGCTGCAGCAGGAAGG - Exonic
1147530455 17:41271542-41271564 CAGGGTGTGCTGCAGCAGGAAGG - Intergenic
1147530868 17:41275914-41275936 CAGGGTGTGCTGCAGCAGGAAGG - Exonic
1147578736 17:41617038-41617060 CAGGATGTCCTGCAGGGAGATGG + Intergenic
1147608774 17:41789126-41789148 CAGGGTGACAAGCAGGTGGATGG - Intergenic
1147976615 17:44251560-44251582 CAGGATGGGCTCCATGAGGATGG + Exonic
1148606161 17:48930593-48930615 CAGGAACACCTGCTGAAGGAAGG - Exonic
1150647458 17:66988202-66988224 CAGGATGAGCTCCAGGCAGATGG - Intronic
1151003213 17:70402156-70402178 CAGGATGACCGGCTGGTGGGAGG - Intergenic
1151215568 17:72574570-72574592 ATGGACAACCTGCAGGAGGAAGG - Intergenic
1151460788 17:74252912-74252934 CAGAATGATCTGCAGGAGGCAGG + Intronic
1152271828 17:79329376-79329398 CAGGATCACCGGCAGGAGTGTGG - Intronic
1152296251 17:79468805-79468827 CAGGAAGACAGGCAGGAGGATGG + Intronic
1152348609 17:79770233-79770255 TAGGATGCCCTGGAGGAGAAGGG - Intergenic
1152648263 17:81480273-81480295 CAGGAGGACCCCCAGGAAGAGGG + Intergenic
1152704307 17:81834814-81834836 CAGGGTGACCTGGAGCAGGTGGG - Exonic
1152726308 17:81948425-81948447 CAGGCTGTCCTGCAGGACCAGGG - Intergenic
1152918205 17:83052553-83052575 CAGGAGGTCCTCCAGGAGGAGGG + Intergenic
1152918242 17:83052655-83052677 CAGGAGGTCCCCCAGGAGGAGGG + Intergenic
1152918284 17:83052757-83052779 CAGGAGGTCCCCCAGGAGGAGGG + Intergenic
1152918325 17:83052859-83052881 CAGGAGGTCCCCCAGGAGGAGGG + Intergenic
1152978141 18:244344-244366 AAGGATGTTCTTCAGGAGGAAGG - Intronic
1153928768 18:9859451-9859473 CTGGAAGACCTGCAGGGGGCGGG + Exonic
1156291015 18:35748514-35748536 CAGGAAGACCTGCAGGATGATGG + Intergenic
1157331718 18:46708795-46708817 CAGGAGGCCCTGCAGGACCATGG - Intronic
1157748338 18:50156983-50157005 AAGGATGACCTGGGGGAGGGTGG - Intronic
1158954322 18:62524242-62524264 CAGGGTGACCCGCTGGTGGAAGG - Exonic
1159228757 18:65576916-65576938 GAAGCTGACATGCAGGAGGAGGG + Intergenic
1160016107 18:75141853-75141875 CAGGAGAGCCTGCAGCAGGAAGG - Intergenic
1160099524 18:75906990-75907012 CAGGCTGAGCTGGAGGAAGAAGG + Intergenic
1160342627 18:78102490-78102512 CAGGATGACCTGAAGGCGGGGGG + Intergenic
1160538632 18:79608714-79608736 CAGGCTGAGCTGCGGGAGGATGG + Intergenic
1160607142 18:80059672-80059694 AAGGGTGTCCTGCAGGAAGAGGG + Intronic
1160761105 19:784928-784950 GAAGATGACCAGGAGGAGGAAGG + Intergenic
1161167360 19:2795446-2795468 GAGGATGAACAGCAGCAGGAGGG - Intronic
1161888829 19:7019135-7019157 GTGGATGAAGTGCAGGAGGAGGG - Intergenic
1162026965 19:7899946-7899968 CAGGAAGACCTGCAAGGAGAAGG - Exonic
1162327063 19:10005807-10005829 GAGGTTGACCTGCTGGGGGAGGG + Exonic
1162554913 19:11380922-11380944 CAGGATGACCACGAGGATGAGGG + Exonic
1162739486 19:12765943-12765965 CAGAAAGCCCTGCAGGAGCAGGG - Exonic
1162916011 19:13874802-13874824 CAGAGTCACCGGCAGGAGGATGG - Intronic
1163023193 19:14494921-14494943 CAGTGTGGCCAGCAGGAGGAGGG + Intronic
1163198682 19:15746053-15746075 GAGGAGGACGTGGAGGAGGAAGG - Intergenic
1163444113 19:17336891-17336913 CAGGAAGACTTCCTGGAGGAGGG + Intronic
1163510885 19:17734259-17734281 CAGGGTCACCTGCAGGTGGAGGG - Exonic
1163584514 19:18156539-18156561 CAGGAGGACCAGAGGGAGGAAGG + Intronic
1164682401 19:30144687-30144709 GGGTATGGCCTGCAGGAGGAGGG + Intergenic
1165100174 19:33434577-33434599 CAGGATTCCCCGCAGGACGAGGG + Intronic
1165112559 19:33510902-33510924 AGGGAAGAGCTGCAGGAGGAAGG - Intronic
1165406508 19:35634106-35634128 CAGGAGGACCTGGGGGAGGGAGG + Intronic
1166361468 19:42254500-42254522 CGGGATGGCCTCTAGGAGGAGGG - Intronic
1167153388 19:47723056-47723078 AAGGAGGACTTCCAGGAGGAGGG - Intronic
1167315977 19:48762879-48762901 CAGGATGAGCTGCAGGGTGTGGG + Intergenic
1167409487 19:49336663-49336685 GAGGAGGAGCTGAAGGAGGAAGG + Intronic
1167744469 19:51342433-51342455 CAGGAAGACTTCCTGGAGGAGGG + Intergenic
1168140263 19:54381208-54381230 CAAGAAGACCTGAAGGAGAAGGG - Intergenic
1168316382 19:55486529-55486551 CAGGAACACCGGCAGGAGGAGGG - Exonic
925147454 2:1590763-1590785 CCGGAAGGTCTGCAGGAGGAAGG + Intergenic
925154259 2:1637974-1637996 CAGGAGGACCTGCAGCTGCACGG + Intronic
925201379 2:1969812-1969834 CAGCAGGAGGTGCAGGAGGATGG + Intronic
925585725 2:5462097-5462119 CAGGATGAGCTGAAGGTGGGAGG + Intergenic
926053126 2:9757351-9757373 GAGGAGGACCTGCAGGAGTGGGG - Intergenic
926135198 2:10331354-10331376 CAGGAGGAAACGCAGGAGGAGGG - Intronic
927217429 2:20675934-20675956 CAGGAGGAACTGCAGCTGGATGG - Intergenic
928546979 2:32337459-32337481 CAAGATGAGGTTCAGGAGGAGGG - Intergenic
928804141 2:35130158-35130180 CAGGAGGACCTGTTGGGGGATGG + Intergenic
929446002 2:42001921-42001943 CAGGCTGAACTGCTGGAGGAAGG - Intergenic
932322990 2:70835492-70835514 AAGGACGGCCTGCAGCAGGACGG + Exonic
932598932 2:73111286-73111308 CAGGAAGGCTTGCTGGAGGAGGG - Intronic
933801123 2:85961227-85961249 CAGGATGACCAGCTGCAGAAAGG - Intergenic
933878683 2:86646080-86646102 AAGGCTGTCCTGCAGGAGAATGG - Intronic
934552187 2:95269287-95269309 CAGAAAGACCTGCTGTAGGAAGG - Intergenic
935217856 2:100988812-100988834 CAGGGGGACCTGGAGGAGCAGGG - Intronic
936044038 2:109172386-109172408 AAGGAAGACCTCCAGGAGCAGGG - Intronic
937261915 2:120591918-120591940 CAGGACGACAGGCTGGAGGAAGG - Intergenic
937329937 2:121020071-121020093 CCAGATGTCCTGCAGAAGGAGGG - Intergenic
938083143 2:128380882-128380904 CAGGATGAACTGGAGGGTGAGGG - Intergenic
938322260 2:130373058-130373080 CAGGAGGACCTGGAGGCGGGGGG + Intronic
938463934 2:131514795-131514817 CAGGATGAGGAGCAGGTGGAAGG + Intergenic
938546023 2:132332490-132332512 CAGAATGAGCTGCAGGAAGGCGG + Intergenic
938945324 2:136207172-136207194 CAGGAGGCATTGCAGGAGGAAGG + Intergenic
939017594 2:136920280-136920302 CAGGACGACCTGCCTGTGGAAGG - Intronic
940879186 2:158929449-158929471 AAGGATGAGCAGGAGGAGGAAGG - Intergenic
941840270 2:170075337-170075359 CAGGATGACATGGAGTAAGAGGG + Intronic
941962927 2:171271308-171271330 AAGGATGACCTACAAGTGGATGG - Intergenic
944347233 2:198684216-198684238 CAGGCTGCCCTGCTGAAGGAAGG - Intergenic
945044932 2:205773632-205773654 CAAGGGGACCTGCTGGAGGAAGG - Intronic
947464261 2:230326967-230326989 CAGCAAGACCTGCAGGACCAGGG - Intergenic
947473171 2:230416002-230416024 CAGCAAGACCTGCAGGACCAGGG - Intronic
947541614 2:230983799-230983821 CAGGATGGCCTGGAAGAGGCAGG - Intergenic
947933787 2:233985826-233985848 CAGGTTGACCAGCAGGATGTTGG - Exonic
948055076 2:235005051-235005073 CAGGGGGATCTGCAGGCGGATGG - Intronic
948379099 2:237540761-237540783 GAGGCTGACCAGCAGCAGGAGGG - Intronic
948912050 2:241009710-241009732 CAGGGTGACTTCCTGGAGGAGGG - Intronic
1169026077 20:2372540-2372562 ATGGATTACCTGCAGGAGGCAGG - Intergenic
1169118288 20:3081310-3081332 CAGGAGGGAGTGCAGGAGGAGGG - Intergenic
1169208383 20:3752532-3752554 CAGGAGGAGCCGCAGGAGGAAGG + Exonic
1169366717 20:4998513-4998535 CAGCTTAACCTGGAGGAGGATGG + Intronic
1170711458 20:18794814-18794836 TAGGATGACATGCGGCAGGAAGG + Intergenic
1170764079 20:19275293-19275315 CAGCATTCCCTGCAAGAGGATGG + Intronic
1171349450 20:24491515-24491537 CAGCATGCCCTGCTGCAGGAGGG + Intronic
1171874886 20:30565223-30565245 CAGAATGAGCTGCAGGAAGGCGG + Intergenic
1172299819 20:33841462-33841484 CAGGCTCACCTGCAGGACAAGGG - Intronic
1174771020 20:53300591-53300613 AAGGATGACATGGAGGGGGAAGG - Intronic
1174860423 20:54086270-54086292 CTGGAGGACATGCAGGAGAAGGG - Intergenic
1175497443 20:59424300-59424322 GAGAATGACCTGCAGTGGGAGGG + Intergenic
1175675847 20:60945954-60945976 CAGGATGACCAGCAGCAGACAGG + Intergenic
1176064893 20:63189200-63189222 GAGGATGATCGCCAGGAGGATGG + Intergenic
1176308323 21:5135967-5135989 CAGGATGCTGGGCAGGAGGATGG - Exonic
1178172152 21:30053416-30053438 CATGACCACCTGGAGGAGGAAGG - Intergenic
1179169555 21:38962414-38962436 CAGGATGCCCAGCAGGAAGTGGG - Intergenic
1179229380 21:39487841-39487863 CCTGGTGACCTGAAGGAGGAAGG + Intronic
1179486219 21:41712365-41712387 GAGGGGGACCTGCAGGGGGAGGG + Intergenic
1179537386 21:42061315-42061337 CAGGCTGGCCTGCAGCAGGCAGG + Intergenic
1179714907 21:43281619-43281641 CAGGATGAACATCGGGAGGAGGG - Intergenic
1179848737 21:44126065-44126087 CAGGATGCTGGGCAGGAGGATGG + Exonic
1181774132 22:25147563-25147585 CAAGAGGACCTCCAGGAGGAAGG - Intronic
1182444212 22:30380775-30380797 CAGGAGGAAGTGCAGGAGGATGG - Intronic
1182842889 22:33406276-33406298 AGGGAAGACCTGCAGGTGGAGGG - Intronic
1183344433 22:37299231-37299253 CTGGAGGACCTGCAGGTTGATGG - Exonic
1183422960 22:37723057-37723079 CAGTGAGACCTGTAGGAGGAGGG + Intronic
1183426808 22:37744405-37744427 CAGGATGACAGGCAGGAGCCAGG + Intronic
1183583294 22:38738237-38738259 GACGAAGACCTGCAGCAGGAGGG - Exonic
1183667434 22:39253847-39253869 CAGGAGGACCTGGGGAAGGAAGG - Intergenic
1184330216 22:43822310-43822332 CTGGCTGGCCGGCAGGAGGATGG + Intergenic
1184783293 22:46659667-46659689 CATGCTGACCTGCAGGAGGCGGG - Intronic
1184886138 22:47345408-47345430 GAGGGTGTCCTGCATGAGGAGGG + Intergenic
1184900803 22:47445342-47445364 CAGGTGGACAGGCAGGAGGATGG - Intergenic
1185044376 22:48521868-48521890 CAGGATGAGCTTCATGTGGAGGG + Intronic
1185330593 22:50250552-50250574 CAGGGTCACCAGCAGGAGCAGGG + Intronic
950282339 3:11719302-11719324 CGGGATGCCCTGCGGGAGGGAGG - Intronic
950457546 3:13101631-13101653 CAGGCTGGGCTGCAGGCGGAAGG + Intergenic
950634909 3:14307828-14307850 CAGTATGTGCTGGAGGAGGAGGG - Intergenic
950795687 3:15509211-15509233 CAGGAGGACCTGCACTAGGCAGG + Intronic
954873846 3:53787725-53787747 CATGAGGACCAGCAGGAAGAGGG + Intronic
955927628 3:64023391-64023413 CTGGAGAACCTGGAGGAGGAGGG - Exonic
956239415 3:67112845-67112867 AAGGATTATCTGCAGGAGCATGG + Intergenic
956696668 3:71924347-71924369 TAAGATGATCTGCAGAAGGAAGG - Intergenic
957636383 3:82790956-82790978 TAGGATGACCTGCCTGTGGAGGG + Intergenic
958451843 3:94282681-94282703 AAGGATGCCCTGAAAGAGGAAGG - Intergenic
960039543 3:113136019-113136041 CAGGAGGCCCTGCCAGAGGAAGG + Intergenic
960252497 3:115471536-115471558 TAGGATGACATGTAGGAGGAGGG + Intergenic
961975147 3:131016315-131016337 AAGGAAGAGCTGCAGGAAGATGG - Exonic
962940906 3:140124102-140124124 CAGTATGAACTGCTGGAGAAAGG + Intronic
966700206 3:182841027-182841049 CAGGATGAGCTAGAGGTGGAAGG - Intronic
967081663 3:186055168-186055190 CAGGTTTACCTGCAGCTGGACGG + Intronic
967126773 3:186431092-186431114 GAGGAGGACCTGCAGGAGCCAGG - Intergenic
967924312 3:194633896-194633918 TAGGATGACATCCAGGAGCAGGG - Intergenic
968439111 4:612657-612679 CAGGAAGACCAGCAGGAGCCTGG + Intergenic
968577432 4:1374430-1374452 CAGGCTGTGGTGCAGGAGGAGGG + Intronic
969414105 4:7047669-7047691 CAGGATGTCCTGCGGAGGGAAGG + Intronic
969565052 4:7972386-7972408 TAGGAGGGCCTCCAGGAGGAGGG - Intronic
969674643 4:8608031-8608053 TAGGACGACCTGCTGGGGGAGGG + Intronic
970004700 4:11399568-11399590 CAGGATGAGCAGCAGCCGGATGG + Exonic
972721716 4:41706217-41706239 CAGGATTTGGTGCAGGAGGAAGG + Intergenic
973737159 4:53883469-53883491 CAGGAAGTCCTTCAGGCGGAAGG - Intronic
974201898 4:58653540-58653562 CAAGCAGACCTGCAGGAGAAAGG - Intergenic
974666332 4:64967471-64967493 CAGGATTTACTGCTGGAGGAAGG + Intergenic
975205253 4:71638202-71638224 CAGGAAGACCTGAAGTGGGAAGG - Intergenic
976563664 4:86529740-86529762 CAGAAAGCCCTGCAGAAGGATGG + Intronic
976768061 4:88619105-88619127 CAGGATGACCAGCCACAGGAAGG - Intronic
977589801 4:98813666-98813688 AAGGATGGCCTGCAGCAGGGTGG - Intergenic
978197925 4:105991972-105991994 CAGGAGGACATGAAGAAGGATGG - Intronic
979649463 4:123113993-123114015 CAGGATGACCAGCAGCAGAGAGG - Intronic
981182763 4:141765094-141765116 GAGGATGAAGGGCAGGAGGAGGG - Intergenic
982004265 4:151049363-151049385 GAGGATGGTCTGCCGGAGGATGG + Intergenic
982004269 4:151049378-151049400 GAGGATGGCCTGCCGGAGGATGG + Intergenic
982004274 4:151049393-151049415 GAGGATGGCCTGCCGGAGGATGG + Intergenic
982004278 4:151049408-151049430 GAGGATGGCCTGCCGCAGGATGG + Intergenic
982004283 4:151049423-151049445 CAGGATGGCCTGCCGGAGGATGG + Intergenic
982505608 4:156213602-156213624 CAGGAAGACTTGAAGCAGGAGGG + Intergenic
982541190 4:156673695-156673717 CAGGCTAGCCTGCTGGAGGATGG + Intergenic
985944239 5:3164156-3164178 CGGGATGATCTACTGGAGGATGG - Intergenic
986784909 5:11105247-11105269 CAGGATTATCTGAAGGAGGTTGG - Intronic
987016429 5:13824811-13824833 CAGGATTACCTGAAGGAGGAAGG + Intronic
987444636 5:18002460-18002482 CTGGATAGCCTGAAGGAGGAAGG + Intergenic
988294074 5:29331951-29331973 CAGGAAAAGCTGGAGGAGGATGG + Intergenic
989607454 5:43258076-43258098 GAGGATGACGAGCAGGTGGAGGG - Intronic
989730426 5:44641610-44641632 CAGGAAGACCTGCTGCAGAAAGG - Intergenic
993899742 5:93577146-93577168 CAGGAGAAGCAGCAGGAGGAAGG - Intergenic
994198547 5:96946096-96946118 CAAGATCACCTGCAGGAGTTTGG + Intronic
996481200 5:123976631-123976653 CAGGTTAGCCTGCAGGAAGAAGG - Intergenic
997380830 5:133436369-133436391 GAGGATGACCTGTGGCAGGAAGG + Intronic
998092553 5:139379826-139379848 CAGCATGATCTGAAGGAGGGGGG + Exonic
999222564 5:149992946-149992968 CAGAATGGACTGCAGGAGAAAGG + Intronic
1000017934 5:157294780-157294802 CAGAATGAGATGCTGGAGGAAGG + Exonic
1000881576 5:166703869-166703891 CTTGATCACTTGCAGGAGGATGG + Intergenic
1001989086 5:176101052-176101074 CTGGAAGACCTGGAGGAGCATGG + Exonic
1002227784 5:177737085-177737107 CTGGAAGACCTGGAGGAGCATGG - Exonic
1003656667 6:8017601-8017623 CAGGATGACAAACAGGATGAAGG + Intronic
1003666089 6:8112617-8112639 CAGGATGAATTGGAGGAGGAAGG - Intergenic
1004253639 6:14043203-14043225 CAGGAGTCCCTGCATGAGGATGG + Intergenic
1005441484 6:25873800-25873822 CTGGGTGACCTGGAGGAAGAGGG - Intronic
1005463609 6:26091317-26091339 CAGGATGACCTGCAGGGTGTGGG - Exonic
1007170608 6:39860642-39860664 CAGGGTGACCTGAAGCAGGAGGG + Intronic
1011368695 6:86609220-86609242 CAGGATGACCAGCAGGTTGGGGG - Intergenic
1011509847 6:88088383-88088405 CAGGAGAACCTGCAGAAGGGAGG + Intergenic
1012258378 6:97060381-97060403 GAGGATGAGCTGAAGAAGGAGGG + Intronic
1012981971 6:105840669-105840691 CAGGAAGAGCTGTAGAAGGAGGG - Intergenic
1013375554 6:109510298-109510320 CAGGATGACCAGCTGCAGAAAGG + Intronic
1014027598 6:116668054-116668076 AACGATGACCTGTAGTAGGAAGG - Intronic
1015718468 6:136216061-136216083 CAGCATGAGCTGCAGGAGAGAGG + Intergenic
1015785743 6:136921180-136921202 CAGGACAACCGGCAGGCGGAGGG - Intergenic
1015854054 6:137604586-137604608 CAGGATGAGTGGCAGAAGGAAGG + Intergenic
1017827894 6:158095901-158095923 CTGCAGGACCTGCAGGTGGAAGG - Exonic
1018365005 6:163110987-163111009 CAGAATGTCCAGCAGGAAGAGGG - Intronic
1018978543 6:168583684-168583706 CAGCATGGCCAGCAGGAGGTTGG - Intronic
1018990612 6:168670879-168670901 CAGCATGACCTGCAGGCCGCAGG + Intronic
1019503314 7:1376484-1376506 CACGATGCCCTGCTGGTGGATGG - Intergenic
1019565228 7:1675687-1675709 CAGGAGGCCCTGCAGGGAGAGGG + Intergenic
1019951234 7:4374551-4374573 GAGGATGACCTTGAGGAGGAAGG - Intergenic
1020659588 7:10966299-10966321 CAGGACTACCTGCCTGAGGATGG - Intergenic
1021175424 7:17444376-17444398 CAGGAAAACCTTCAGGAAGATGG - Intergenic
1022470162 7:30677092-30677114 CAAGATGAGGTGCAGGAGGAGGG + Intronic
1023089894 7:36608024-36608046 GAGGATGGCCTGCAGGGGCAAGG - Intronic
1023939671 7:44761512-44761534 CAGGTTGTGCTGCAGGCGGAAGG - Exonic
1024331504 7:48159988-48160010 CAGGAAGGCCAGCAGGAAGAAGG - Intergenic
1024531121 7:50393422-50393444 CAGGATGACATGAAGGGGGAAGG + Intronic
1026370130 7:69690947-69690969 CAGGATGACCTGCTGTGGAAGGG - Intronic
1026398309 7:69982441-69982463 CAGGATAGCCTGGAGCAGGAGGG - Intronic
1026562024 7:71458299-71458321 CAGGATGTGCTGCAGGGGCATGG + Intronic
1026567175 7:71499000-71499022 AAGGATGACCTGCAGGACATTGG + Intronic
1027535147 7:79390532-79390554 CAGTATGAGATGCTGGAGGAGGG + Intronic
1027645342 7:80790523-80790545 CAGCAAGACCTACAGTAGGAGGG - Intronic
1027828596 7:83149085-83149107 AAGGGTGACCTGCCTGAGGAAGG - Intronic
1028078779 7:86548247-86548269 GAGGATGAGCTGAAGCAGGATGG - Intergenic
1029750378 7:102539626-102539648 CAGGAGGACCGTGAGGAGGACGG + Intronic
1029768330 7:102638734-102638756 CAGGAGGACCGTGAGGAGGACGG + Exonic
1029899336 7:104022619-104022641 CAGGATGACCAGCTGCAGGGAGG + Intergenic
1030247688 7:107402702-107402724 CAGGAAGAGCTGCAGGTGGATGG + Intronic
1031918135 7:127582267-127582289 CAGGATCGGCTGCTGGAGGAGGG - Exonic
1032081713 7:128862248-128862270 CTGAAGGACCTGCAGGATGAAGG - Intergenic
1032298165 7:130661403-130661425 CAGGTTGAGCTGCTGGAGTAGGG - Intronic
1032503288 7:132416198-132416220 CAGGATAACCAGCTGGAGGAAGG + Intronic
1034554135 7:151839254-151839276 CAGACTGGCCTGCAGAAGGAAGG + Intronic
1035132776 7:156670835-156670857 AAGGATGCCTTGCATGAGGAAGG + Intronic
1035163872 7:156972089-156972111 CAGTAAGACCTTCTGGAGGAAGG - Exonic
1036037045 8:5031060-5031082 CAGGAAGACCTGAAGGAGAGGGG - Intergenic
1036179828 8:6574773-6574795 AAGGAAGACCTGCAGGATGGAGG + Intronic
1036233830 8:7021316-7021338 GAGAATCACCTGCGGGAGGATGG - Intergenic
1036238653 8:7064407-7064429 CCTGGTGACCTGCAGGAAGATGG + Intergenic
1036257813 8:7219522-7219544 TAGCATGACCTGAAGGATGATGG - Intergenic
1036259062 8:7226519-7226541 TAGCATGACCTGAAGGATGATGG - Intergenic
1036309861 8:7678118-7678140 TAGCATGACCTGAAGGATGATGG - Intergenic
1036311115 8:7685115-7685137 TAGCATGACCTGAAGGATGATGG - Intergenic
1036358411 8:8060993-8061015 TAGCATGACCTGAAGGATGATGG + Intergenic
1036626818 8:10479298-10479320 CAGGGCGACCCGCAGCAGGAGGG + Intergenic
1036644941 8:10607184-10607206 GAGGATGCTCTGGAGGAGGAAGG + Exonic
1036665262 8:10733385-10733407 CTGGAAGACCTGGAGGAGAAAGG + Intronic
1036892543 8:12605959-12605981 TAGCATGACCTGAAGGATGATGG - Intergenic
1037909818 8:22737670-22737692 CAGGCTGCCCTGCAGGAGAATGG - Intronic
1038035444 8:23682785-23682807 CAGGATGTCCTGGATGAGGAAGG + Exonic
1040487637 8:47888930-47888952 CAGGAGCAGCTGCAGGAGCACGG + Intronic
1042196795 8:66238008-66238030 CAGGATGACCAGCTGCAGAAAGG - Intergenic
1044053726 8:87542470-87542492 CAGGATGACCTGCCTGCAGAAGG - Intronic
1044725479 8:95191189-95191211 CAGGGTGACATGCAGGTGGATGG + Intergenic
1047039630 8:120978591-120978613 CAGGATGAGATCCAGAAGGAAGG + Intergenic
1047632120 8:126719524-126719546 CAAGTTGAATTGCAGGAGGATGG + Intergenic
1048072693 8:131039416-131039438 GAGGATGACCTGCAGCAGCGAGG + Exonic
1048443832 8:134478713-134478735 CTCGGTGACCTGCGGGAGGAGGG + Exonic
1048555581 8:135472668-135472690 AAGGATGTCATGCAGGAGAATGG + Intronic
1049389842 8:142362018-142362040 CCCGATGGCCTGCAGCAGGAGGG + Intronic
1049425694 8:142537011-142537033 GTGGTTGACCGGCAGGAGGAGGG + Exonic
1049558185 8:143294087-143294109 CAGGAGGGGCAGCAGGAGGAGGG - Intronic
1050900956 9:10948035-10948057 CATGATTACCTCCAGGAGAAAGG + Intergenic
1052900820 9:33793576-33793598 CAGGAAGAAAAGCAGGAGGAAGG + Intronic
1052902362 9:33804271-33804293 CAGGAAGAAAAGCAGGAGGAAGG + Intergenic
1053292937 9:36894029-36894051 CAGAAAGACCTCCAGGAGGTTGG + Intronic
1055612857 9:78041126-78041148 CGGGTTGATCTGCAGGAGGTTGG + Intergenic
1055723123 9:79197909-79197931 CAGGATGAGGAGGAGGAGGAAGG - Intergenic
1056456533 9:86766163-86766185 CAGCAGCAGCTGCAGGAGGAGGG + Intergenic
1056879716 9:90379665-90379687 CAGGATGACATGCTGCAGGGGGG - Intergenic
1057049714 9:91914537-91914559 CAAGGTGACCGGCAGGAGGATGG - Intronic
1057273784 9:93665569-93665591 CAGGATGGCCTCCAGGAGGCAGG - Intronic
1057786020 9:98087804-98087826 GAGGTTGACGTGCAGGAGGCGGG - Exonic
1059580089 9:115536076-115536098 CAGGATGATCTTCAAGAGGGAGG - Intergenic
1059760034 9:117329054-117329076 CAGGTTAACCTGCAGCTGGAGGG + Intronic
1060279223 9:122204772-122204794 AAGGATGACCTGCAAGAGGAGGG + Exonic
1061201109 9:129139022-129139044 CAGGATAAGCTGGAGGAGCAGGG + Intronic
1061678271 9:132230402-132230424 CATGATGACCTGCAGGGTGTGGG - Intronic
1061865785 9:133491149-133491171 GAGGAGGACTTGGAGGAGGAGGG + Intergenic
1062329150 9:136029247-136029269 CAGGATGGCCTACCTGAGGAGGG + Intronic
1062500798 9:136851211-136851233 CAAGATGCCCTGGAGGACGATGG - Intronic
1062712469 9:137984124-137984146 CACGATGACCTGCAACGGGATGG - Exonic
1062729815 9:138102643-138102665 CAGGAGGAGCGGCAGCAGGAGGG - Intronic
1192337204 X:70231942-70231964 CAGGAAGACCTGGAGTGGGAGGG + Intergenic
1194566915 X:95500508-95500530 CAGGATGACATGCAGAAAAATGG + Intergenic
1195682695 X:107560759-107560781 TTTGATGACCTGCAGGAGGGAGG - Exonic
1196758669 X:119180087-119180109 CAGAATCACCTGGAGGAGGAGGG - Intergenic
1196758948 X:119182359-119182381 CAGAATCACCTGGAGGAGGAGGG - Intergenic
1196811952 X:119635949-119635971 CAGGATGGAGTGAAGGAGGAGGG + Intronic
1196824710 X:119732019-119732041 CAGCAGGACCAGCAGAAGGAAGG + Intergenic
1198936299 X:141904703-141904725 CTGGAGCACCTGCAAGAGGAAGG - Exonic
1199360001 X:146907027-146907049 CAGGATGACCAGCAGCAGAGAGG - Intergenic
1199444857 X:147910620-147910642 CAGGATGACCTGCCCCAGGCAGG - Intergenic
1200002322 X:153068476-153068498 GAGGAGGAGGTGCAGGAGGAGGG + Intergenic
1200005409 X:153081549-153081571 GAGGAGGAGGTGCAGGAGGAGGG - Intergenic
1201240502 Y:11953589-11953611 CAGGAAGACTGGCAGGGGGAGGG + Intergenic
1202379426 Y:24262530-24262552 CAGGCTGACAAGCAGGCGGATGG - Intergenic
1202491356 Y:25407591-25407613 CAGGCTGACAAGCAGGCGGATGG + Intergenic