ID: 900411172

View in Genome Browser
Species Human (GRCh38)
Location 1:2513367-2513389
Sequence AGGCTCGGCGTGTGAGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 212}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900411156_900411172 27 Left 900411156 1:2513317-2513339 CCCACAGCCCTGGCCTCAAAACC 0: 1
1: 0
2: 3
3: 33
4: 378
Right 900411172 1:2513367-2513389 AGGCTCGGCGTGTGAGGGGAGGG 0: 1
1: 0
2: 0
3: 11
4: 212
900411159_900411172 19 Left 900411159 1:2513325-2513347 CCTGGCCTCAAAACCCTCGACAC 0: 1
1: 0
2: 0
3: 7
4: 120
Right 900411172 1:2513367-2513389 AGGCTCGGCGTGTGAGGGGAGGG 0: 1
1: 0
2: 0
3: 11
4: 212
900411162_900411172 5 Left 900411162 1:2513339-2513361 CCTCGACACCCAGACTTCCGCTG 0: 1
1: 0
2: 0
3: 9
4: 117
Right 900411172 1:2513367-2513389 AGGCTCGGCGTGTGAGGGGAGGG 0: 1
1: 0
2: 0
3: 11
4: 212
900411157_900411172 26 Left 900411157 1:2513318-2513340 CCACAGCCCTGGCCTCAAAACCC 0: 1
1: 0
2: 3
3: 51
4: 477
Right 900411172 1:2513367-2513389 AGGCTCGGCGTGTGAGGGGAGGG 0: 1
1: 0
2: 0
3: 11
4: 212
900411158_900411172 20 Left 900411158 1:2513324-2513346 CCCTGGCCTCAAAACCCTCGACA 0: 1
1: 0
2: 0
3: 13
4: 188
Right 900411172 1:2513367-2513389 AGGCTCGGCGTGTGAGGGGAGGG 0: 1
1: 0
2: 0
3: 11
4: 212
900411165_900411172 -4 Left 900411165 1:2513348-2513370 CCAGACTTCCGCTGTCACAAGGC 0: 1
1: 0
2: 0
3: 2
4: 76
Right 900411172 1:2513367-2513389 AGGCTCGGCGTGTGAGGGGAGGG 0: 1
1: 0
2: 0
3: 11
4: 212
900411161_900411172 6 Left 900411161 1:2513338-2513360 CCCTCGACACCCAGACTTCCGCT 0: 1
1: 0
2: 0
3: 4
4: 77
Right 900411172 1:2513367-2513389 AGGCTCGGCGTGTGAGGGGAGGG 0: 1
1: 0
2: 0
3: 11
4: 212
900411160_900411172 14 Left 900411160 1:2513330-2513352 CCTCAAAACCCTCGACACCCAGA 0: 1
1: 0
2: 1
3: 7
4: 132
Right 900411172 1:2513367-2513389 AGGCTCGGCGTGTGAGGGGAGGG 0: 1
1: 0
2: 0
3: 11
4: 212
900411163_900411172 -3 Left 900411163 1:2513347-2513369 CCCAGACTTCCGCTGTCACAAGG 0: 1
1: 0
2: 1
3: 13
4: 130
Right 900411172 1:2513367-2513389 AGGCTCGGCGTGTGAGGGGAGGG 0: 1
1: 0
2: 0
3: 11
4: 212

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900411172 Original CRISPR AGGCTCGGCGTGTGAGGGGA GGG Intronic
900139274 1:1132704-1132726 AGCCTCGGAGGGGGAGGGGAAGG + Intergenic
900161919 1:1227944-1227966 AGGCTGGGGGTGTGTGGGGTTGG - Intronic
900411172 1:2513367-2513389 AGGCTCGGCGTGTGAGGGGAGGG + Intronic
900479236 1:2890088-2890110 AGACCCTGTGTGTGAGGGGATGG + Intergenic
901453960 1:9352828-9352850 AGGCTGGGGGAGGGAGGGGAGGG - Intronic
902372098 1:16013480-16013502 AGCCTGGGGGTGTGAGGGGTGGG + Intergenic
903151676 1:21414426-21414448 AGGGTCGCCCTGAGAGGGGAGGG - Intergenic
903339242 1:22643799-22643821 CAGCTTGGTGTGTGAGGGGAAGG + Intronic
903807121 1:26013391-26013413 AGGTCCTGTGTGTGAGGGGATGG + Intergenic
904025612 1:27501520-27501542 AGGTTTGGAGGGTGAGGGGAGGG + Intergenic
904778275 1:32925147-32925169 AGGCGAGGAGTGGGAGGGGACGG - Intergenic
904872952 1:33633392-33633414 GGGCTCGGCCAGTGTGGGGATGG - Intronic
905919613 1:41710748-41710770 AGGCTTGGGGTGTGAGGCCACGG - Intronic
906117097 1:43364272-43364294 AGGCTAGGAATGTGGGGGGATGG + Intronic
906318135 1:44800956-44800978 AGGCTCAGCGGGCGAGGGGTGGG + Intronic
906534665 1:46544763-46544785 AGGCTGGGCGTGTGGGAGGGAGG + Intergenic
906544564 1:46612120-46612142 AGCCTGGGCGGGTGAGGGTAGGG - Intronic
907315636 1:53569380-53569402 AGGCTGCGTGTGTGAGGGCAGGG + Intronic
912770019 1:112455137-112455159 AGACTCTGCGTGAGAGGGAAAGG - Intronic
913963267 1:143354943-143354965 AGGCTCTGAGTGTCAGGAGAGGG - Intergenic
914057623 1:144180529-144180551 AGGCTCTGAGTGTCAGGAGAGGG - Intergenic
914121523 1:144785837-144785859 AGGCTCTGAGTGTCAGGAGAGGG + Intergenic
914513488 1:148354110-148354132 AGGGTCGCCCTGAGAGGGGATGG - Intergenic
915511871 1:156391011-156391033 AGGAAGGGCGGGTGAGGGGATGG - Intergenic
916830986 1:168490983-168491005 AGGGTCGGCGGGAGTGGGGAGGG - Intergenic
918222802 1:182451269-182451291 AGACTGAGCGTGTGAGAGGAGGG - Intronic
919881615 1:201904696-201904718 AGGCTGGGGGTGGGAGGGAAAGG + Intronic
920084869 1:203407998-203408020 AGGCTGTGTGTGTGAGGGGCAGG - Intergenic
920388755 1:205585940-205585962 AGGCTGGGCAGGTGTGGGGAGGG - Intronic
920743769 1:208606335-208606357 AGGCTAGGCTTGTGTGGGGGTGG - Intergenic
923672600 1:236053585-236053607 GGGCTGGGGGTGTGAGGGAAGGG - Intronic
1063021549 10:2133987-2134009 AGGCTGTGCGTGTGGGGGGATGG + Intergenic
1064103829 10:12484846-12484868 GGGCTGGGCGTGTCATGGGAGGG + Intronic
1065557101 10:26927110-26927132 AGGCTGTGCATGTGTGGGGATGG + Intergenic
1065924893 10:30426729-30426751 AGGCTCTGCCTGTGAAGGGAGGG - Intergenic
1067406695 10:46030279-46030301 GGGCCCGGCGTGTGGCGGGAAGG + Intronic
1069966634 10:72123512-72123534 AGGCTGTGCGTGTGCAGGGATGG + Intronic
1070219614 10:74426932-74426954 AGGCTTGGGGGGTTAGGGGAGGG - Intronic
1070506576 10:77118612-77118634 GGGCTGGGCATGTGAGGGGTAGG - Intronic
1071568041 10:86681566-86681588 GGCCTCGGCGAGTGAGGAGAAGG - Exonic
1072622103 10:97086986-97087008 AGGCTGTGCTTGTGAGGGAATGG + Intronic
1073068772 10:100780373-100780395 AGGCCCGGGGTTTGAGGGGCTGG + Intronic
1074088623 10:110226922-110226944 GGGAGGGGCGTGTGAGGGGAGGG + Intronic
1074088667 10:110227072-110227094 GGGAGGGGCGTGTGAGGGGAGGG + Intronic
1076131581 10:128017521-128017543 AGGCTGTGCCTGTGTGGGGAGGG - Intronic
1076384412 10:130046232-130046254 AGGCTCGGCGTGGGACACGAGGG + Intergenic
1076649782 10:131979982-131980004 GGGCTCGGCGTGGGCGGGGTTGG - Intronic
1076787892 10:132760131-132760153 AGGCTGGGCATGTGAGCAGAGGG - Intronic
1076874917 10:133211209-133211231 AGCCTGGGCGTGTGGGGGCAAGG - Intronic
1077362719 11:2147862-2147884 AGGCTTGGGGTGTATGGGGAGGG - Intronic
1077610786 11:3642136-3642158 TGGCTCCGCCTGAGAGGGGAGGG + Exonic
1078163483 11:8862707-8862729 AGGCTAGGCGTGTGGGAGCATGG - Intronic
1081524834 11:43920310-43920332 AGGCGGGGCGTGTGGGGGGCGGG - Intergenic
1081670643 11:44940409-44940431 AGGGTGGAGGTGTGAGGGGAGGG - Intronic
1084102299 11:66957857-66957879 AGCCGCGGCGTGTAAGGCGAGGG - Intronic
1084872943 11:72109938-72109960 AGGCTGGGTGTGGGTGGGGAGGG + Exonic
1088504238 11:110513311-110513333 AGGGAGGGGGTGTGAGGGGAAGG + Intergenic
1088855827 11:113752703-113752725 AGGGTCGGGGTATGAGGGAAAGG - Intronic
1089515739 11:119030461-119030483 AGGCTCAGCCTGGTAGGGGAGGG + Intronic
1091409719 12:231241-231263 AGGCTCGCTGTTTGAGGGGCAGG - Intronic
1093411852 12:18877291-18877313 AGGCAAGGTGTGTGTGGGGAGGG - Intergenic
1096631325 12:52928476-52928498 AGGTTCTGTGTGTGAAGGGAGGG - Intronic
1097054653 12:56242403-56242425 AGGCTAGGAGTGGGAGGGAATGG + Exonic
1097068460 12:56337806-56337828 AGGTTGGGCGTGGGAGTGGAAGG - Intronic
1099133292 12:78863585-78863607 AGGCTCAGCGGGTGGGGGAAGGG - Intergenic
1099390202 12:82070148-82070170 AGGCTTGGCCTGTGATGTGAGGG + Intergenic
1102736327 12:115163802-115163824 ATGCTTGGTGTGTGAGGGCAAGG - Intergenic
1104937718 12:132375396-132375418 AGGCTGGGTGGGTGGGGGGAGGG - Intergenic
1104993481 12:132640144-132640166 CAGCTAGGCGTGTGAGGGAATGG - Intronic
1106791975 13:33164927-33164949 AGGCTCAGCATGTGTGGTGAGGG - Intronic
1107451922 13:40517463-40517485 CGGCTTGGCAGGTGAGGGGAAGG + Intergenic
1112365555 13:98752570-98752592 ACGCTCGGCGGGTGGGGGGCCGG - Intronic
1118894768 14:69936543-69936565 AGACTCGCAGTGGGAGGGGAAGG - Intronic
1119476769 14:74934951-74934973 AGGCTGGGTGTGTGGGGGCAGGG + Intergenic
1121284745 14:92726488-92726510 AGGCTCTGAGTGTGTGGGGGTGG + Intronic
1122117578 14:99535516-99535538 GGGCACGGCGTGGGAGGGGTTGG - Intronic
1122820802 14:104343840-104343862 GCGCTGGGGGTGTGAGGGGAAGG + Intergenic
1122842499 14:104473269-104473291 AGGCTTGGGGTGGGAGGGGCTGG - Intergenic
1124121793 15:26894329-26894351 AGGCGCGGCCTGTGAAGGGGTGG - Intronic
1125579269 15:40774170-40774192 AGGCACCGTGTGTGAAGGGATGG - Intronic
1125720782 15:41844213-41844235 AGGCTCGGGGGCTGAGGGCAAGG + Intronic
1127053329 15:55107302-55107324 ACTCTCGGCCTGTGATGGGAAGG - Intergenic
1127122014 15:55780039-55780061 AGGATGGGAGGGTGAGGGGATGG + Intergenic
1129110151 15:73332428-73332450 AGGCTGGGGGTGGGATGGGAAGG + Intronic
1131064391 15:89424472-89424494 AGGCTTGGAGAGGGAGGGGAGGG + Intergenic
1131605326 15:93897629-93897651 AGGTTAGGGGTGAGAGGGGAAGG + Intergenic
1131990544 15:98088820-98088842 AGGGTGGGCGTGTGAGCGGGGGG - Intergenic
1132099599 15:99014476-99014498 AGGGTGGGCGTGTGAGCGGGGGG + Intergenic
1132148427 15:99442746-99442768 GGGCACGGCTTGGGAGGGGAGGG - Intergenic
1132300256 15:100770977-100770999 GGGCTCAGAGTGGGAGGGGAAGG - Intergenic
1133769930 16:8861837-8861859 AGGCTGGCCCTGGGAGGGGAGGG + Intronic
1135159433 16:20080604-20080626 AGGCTATGCCTGTGTGGGGATGG - Intergenic
1136659328 16:31742300-31742322 GGGCTGGGTGGGTGAGGGGAAGG - Intronic
1137250541 16:46737671-46737693 AGGCTGGGTGAGGGAGGGGATGG - Intronic
1138517490 16:57544337-57544359 TGGCTCAGCGTGTGGGGGGATGG + Intronic
1139631438 16:68234273-68234295 AGGGTTGGGGGGTGAGGGGAAGG - Intronic
1141757526 16:86001919-86001941 AGACACAGCGAGTGAGGGGAAGG - Intergenic
1142982227 17:3678921-3678943 AGGCTCAGCCTGCGTGGGGAGGG - Intronic
1143820399 17:9556883-9556905 AGTATGGGAGTGTGAGGGGAAGG - Intronic
1145279424 17:21457084-21457106 GGGCCCGGCGACTGAGGGGAGGG - Intergenic
1146461065 17:33046492-33046514 AGGCTGGGAGTGTGAGGGAGTGG + Intronic
1148404100 17:47397043-47397065 CGGCTCGGCATGAGAGGGAAAGG - Intronic
1149570837 17:57671360-57671382 AGGGTGTGCGTGTGAGGGGGCGG - Intronic
1150358163 17:64506030-64506052 AGGCCTGGCGGGTGGGGGGATGG - Intronic
1150865860 17:68849385-68849407 AGGCTGTGCATGTGTGGGGAAGG + Intergenic
1151459745 17:74247502-74247524 AGGCCTGGCCTGGGAGGGGAAGG + Intronic
1151827261 17:76530307-76530329 TGACTCGGAGCGTGAGGGGAGGG - Intronic
1151829254 17:76540107-76540129 AGACTTGGCCTGGGAGGGGATGG + Exonic
1152662223 17:81547844-81547866 AGGCTCGGTGTGGGTGGGGCCGG - Intronic
1152897372 17:82920432-82920454 AGGTTGGGCGGGTGAGGGGCAGG + Intronic
1155786885 18:29913314-29913336 AAACTCGGGGTGTGAGGGAATGG - Intergenic
1156476499 18:37409030-37409052 AGGCTCAGGGTGTGGGGGCAGGG + Intronic
1157792699 18:50546681-50546703 AACCTGGGCCTGTGAGGGGAGGG + Intergenic
1160878821 19:1310455-1310477 AGGCTGGGGGTGGAAGGGGATGG + Intergenic
1161266315 19:3366338-3366360 AGGTTCGGGGTGGGAGGGGGAGG + Intronic
1163390563 19:17027456-17027478 AGGCCCAGCGAGAGAGGGGACGG - Intergenic
1164648252 19:29874214-29874236 AGGCTCGGGGCGAGGGGGGAGGG + Intergenic
1164916021 19:32052972-32052994 TGGCCCGGCCTCTGAGGGGAAGG + Intergenic
1165809884 19:38605876-38605898 AGGCTGGGGATGTCAGGGGAAGG - Intronic
1166475462 19:43120739-43120761 AGGCACGGTGGGTGATGGGAAGG + Intronic
1167066052 19:47186938-47186960 GAGCTCCGCGTGTGAGGGCAAGG + Intronic
1167267957 19:48492939-48492961 AGGCTTTGAGTGTGAGGGCAGGG - Intronic
1168115565 19:54220021-54220043 AGGCTGGGCTGGTGAGGGGCGGG - Intronic
1168121368 19:54254181-54254203 AGGCTGGGCCGGTGAGGGGGCGG - Intronic
1168124879 19:54277706-54277728 AGGCTGGGCTGGTGAGGGGTGGG - Intronic
1168132910 19:54332332-54332354 AGGCTGGGCTGGTGAGGGGCGGG - Intergenic
1168177107 19:54633843-54633865 AGGCTGGGCTGGTGAGGGGTGGG + Intronic
1168295793 19:55376901-55376923 GGGCTCGGCAGGTGAGGGGCTGG + Exonic
1202697106 1_KI270712v1_random:133202-133224 AGGCTCTGAGTGTCAGGAGAGGG - Intergenic
926127342 2:10279681-10279703 AGGCTGGGCCAGTGAGGGGAGGG - Intergenic
926252105 2:11160591-11160613 AGGCTCCGAGTGAGGGGGGAAGG - Intronic
927329079 2:21841531-21841553 AGGCCAGGCCTGTGACGGGAAGG - Intergenic
929069947 2:38020118-38020140 TGGATCCGCGGGTGAGGGGATGG + Intronic
931300036 2:60970646-60970668 AGCCTGGGCGGGGGAGGGGACGG + Intronic
932338716 2:70945999-70946021 GGGCACGGTGTGTGTGGGGAAGG - Intronic
934278268 2:91590218-91590240 AGGCTCTGAGTGTCAGGAGAGGG - Intergenic
935337996 2:102034762-102034784 AGGCTGAGGGAGTGAGGGGAAGG + Intergenic
936090593 2:109499221-109499243 AGCCTCGGCGTCTGTGGAGATGG + Intronic
938689442 2:133774059-133774081 AGGCTGAGGGTGTGTGGGGAGGG + Intergenic
941366953 2:164621342-164621364 AGACTCGGCGCGTGGGGAGAAGG + Exonic
942949303 2:181703996-181704018 AGGCCTGGCCTGTGATGGGAGGG + Intergenic
946190920 2:218007554-218007576 AGGCTCGGGGGGTGGGGGGGGGG + Intergenic
947796396 2:232896591-232896613 AGGGTAGGGGTGTGAGGGTAAGG + Intronic
948145235 2:235703578-235703600 AGGATGGGCGGGGGAGGGGAGGG - Intronic
1172616354 20:36288057-36288079 AGGCTCTGCGTATGTAGGGATGG - Intergenic
1173583121 20:44161235-44161257 AGGCTGAGTGTGTGAGGTGATGG + Intronic
1173670581 20:44796086-44796108 AGGCACGGCAGGGGAGGGGAGGG - Intronic
1173825133 20:46043347-46043369 AGACTCTGCCTGTGAGTGGATGG + Intronic
1175324036 20:58110306-58110328 AGGCTCAGGATGTGAGGGGTGGG - Intergenic
1175966592 20:62662834-62662856 GGTCCCGGCGTGTGGGGGGATGG - Intronic
1176000357 20:62828827-62828849 GGGCTCAGGGTGTGACGGGAGGG + Intronic
1176085580 20:63294127-63294149 GGGAGCGGAGTGTGAGGGGAGGG + Intronic
1176249186 20:64112182-64112204 AGGCTGGGCGAGTGGGGGCAAGG + Intergenic
1178777404 21:35565383-35565405 AGGCTGAGGGAGTGAGGGGAAGG + Intronic
1179281199 21:39935883-39935905 AGGGTTGGGGTGTGAGGGGAGGG - Intergenic
1182260587 22:29071185-29071207 AGGCTGGCTGGGTGAGGGGATGG + Intergenic
1183083764 22:35474118-35474140 AGGCTGGTGGTGAGAGGGGAGGG + Intergenic
1183211701 22:36455261-36455283 AGGCTCGGCGCGGGAGGGGCGGG + Intergenic
1184243866 22:43226275-43226297 TGGCTGGGAGTGTGATGGGAGGG + Intronic
1184642200 22:45878659-45878681 AGGGGCGGCGTGTGGGGGGCGGG - Intergenic
950119392 3:10471552-10471574 AGGCTAGGAGTGGGAGGAGAGGG + Intronic
950425658 3:12923612-12923634 AGGCTCAGAGTGGGAGGGGCTGG - Intronic
953705395 3:45226374-45226396 AGGCTCGGGGACTCAGGGGAGGG + Intergenic
959576143 3:107936107-107936129 TAGCTCAGCGTGTGAGTGGAAGG - Intergenic
959665878 3:108920870-108920892 AGGCTATGCATGTGTGGGGACGG - Intronic
959884767 3:111487112-111487134 AGGGGCGGGGAGTGAGGGGAGGG + Intronic
960812257 3:121636336-121636358 AGGCTGGGAGAGGGAGGGGACGG - Intronic
961795000 3:129402993-129403015 AGGCTCAGGGTTGGAGGGGAAGG - Intronic
967219016 3:187233799-187233821 AGGCCCAGCGTGTGGGGGGTTGG + Intronic
969032485 4:4226123-4226145 AGGCTCTGAGTGTCAGGAGAGGG + Intronic
985927888 5:3031974-3031996 AGGCTCTGCTTGTGTGGCGATGG + Intergenic
998350308 5:141496117-141496139 AGGCTCAGTGTGTGAGGGGCAGG - Intronic
998409247 5:141896615-141896637 GGGCGCGGCGGGTGACGGGACGG + Intergenic
1000522794 5:162318758-162318780 AGTCTGGGCCTGTGATGGGAGGG - Intergenic
1001938708 5:175726153-175726175 AGGCTGGGAATGGGAGGGGAAGG + Intergenic
1002101445 5:176860082-176860104 TGGCTGGGCGTGTGGGGGCAGGG - Intronic
1003277203 6:4662817-4662839 GGGCTTGGCCTCTGAGGGGAAGG - Intergenic
1003982209 6:11400623-11400645 AGGGTAGGAGGGTGAGGGGACGG + Intergenic
1007174597 6:39887370-39887392 ATGCTCCTGGTGTGAGGGGAAGG - Intronic
1008477403 6:51947241-51947263 AGGCTGGGCAAGTGAGGAGAGGG - Intronic
1010083093 6:71886696-71886718 AGGCGCGGCGGGAGAGGCGAGGG - Intronic
1010372119 6:75122409-75122431 AGGCTGGGCATGTGTGGGGAAGG + Intronic
1012177727 6:96109888-96109910 GTGCTCTGGGTGTGAGGGGAAGG - Intronic
1013276352 6:108588766-108588788 AGGCTTGGAGTGAGAGGGCAAGG - Intronic
1013465571 6:110414544-110414566 AGGCTCCGTGGGTGAGGGGTGGG - Intronic
1019179419 6:170177278-170177300 AGGGGCGGCCTGTGGGGGGAGGG + Intergenic
1019453064 7:1109699-1109721 GGGCCCGGCGGGGGAGGGGAAGG - Intronic
1019595942 7:1858446-1858468 GGGCTCTGCGTGTGAGAGGGTGG + Intronic
1019704871 7:2492779-2492801 CAGCTAGGCGTGTGAGTGGATGG - Intergenic
1024230137 7:47357656-47357678 AGGGTGGGCCTGGGAGGGGAAGG - Intronic
1024772386 7:52738498-52738520 AGGCTCTGCATGTGGGGGGCAGG - Intergenic
1031965761 7:128027268-128027290 AGGGTGGGCGTGGGTGGGGAAGG - Exonic
1032194357 7:129780765-129780787 AGGGTGGGCGTGTGAGGACATGG - Intergenic
1034061610 7:148096906-148096928 AGGCTCTGAGTCTGAGGAGAAGG + Intronic
1035555751 8:565876-565898 AGGCAGGGCGTGTGTAGGGAAGG + Intergenic
1035689348 8:1549503-1549525 GTGCTCGGCCTGTGAGGGGTTGG + Exonic
1038419712 8:27425520-27425542 AGGCTGTGCATGTGTGGGGAAGG - Intronic
1040843227 8:51806841-51806863 AAGCTTGGAGTGTGTGGGGATGG - Intronic
1042805802 8:72769613-72769635 AGGCTTGGAGAGTGAGTGGATGG + Intronic
1044814883 8:96101585-96101607 AGGTTTGGCGGGTGAGGGGAGGG - Intergenic
1046600881 8:116315552-116315574 AGGCCAGGCTTGTGATGGGAGGG + Intergenic
1048590188 8:135814141-135814163 AGGCTGGGAGGGTGAGTGGAAGG + Intergenic
1048593471 8:135843085-135843107 AGGCTCTGCCTGTGAGGAAAAGG - Intergenic
1049060621 8:140273561-140273583 AGGCCTGGGGTGGGAGGGGAAGG - Intronic
1049162198 8:141104761-141104783 AGGCCCAGCGAGAGAGGGGATGG + Intergenic
1049482360 8:142832612-142832634 AGGCTGGGGGTCTGAGTGGAGGG - Intergenic
1049483350 8:142838409-142838431 AGACTCGGGGTCTGAGTGGAGGG + Intronic
1049580527 8:143408634-143408656 AGGCTCGTGGGGTGAGGAGAGGG - Intergenic
1052647331 9:31253824-31253846 AGGCGCGGAGAGTGAAGGGAGGG - Intergenic
1055460208 9:76512280-76512302 CGGCTGGGCGTGGGGGGGGATGG - Intergenic
1061658022 9:132107705-132107727 AGGGTCAGTGTGCGAGGGGAAGG - Intergenic
1062030494 9:134359898-134359920 GGGCCTGGCCTGTGAGGGGATGG + Intronic
1062372668 9:136248031-136248053 AGGCAGGGCGGGGGAGGGGAAGG + Intergenic
1062411676 9:136428986-136429008 AGGCTTGGCCTATGAGAGGAGGG + Exonic
1062532659 9:137008673-137008695 GGGCAGGGCGGGTGAGGGGAGGG + Intronic
1187576140 X:20558228-20558250 AGGCTGGGGGTGAGAGGGGTTGG - Intergenic
1188466000 X:30481909-30481931 AGGCGGGGCGGGTGAGGGGGTGG - Intergenic
1190119586 X:47649534-47649556 AGGCTCATCGTCTGAGGGGAAGG + Intronic
1191873296 X:65768903-65768925 AGGCCAGGCCTGTGATGGGAGGG - Intergenic
1191955415 X:66638505-66638527 AAGCTCGGCGGGTGAGGGGGTGG + Intronic
1192058037 X:67793217-67793239 AGGGTGGGGGTGGGAGGGGAGGG - Intergenic
1195225769 X:102791557-102791579 GGGGTGGGGGTGTGAGGGGAGGG - Intergenic
1196892213 X:120302325-120302347 AGTCTCTGTGGGTGAGGGGAAGG - Intronic
1199573415 X:149290338-149290360 AGGCTGGGCCTCTGAGGGGGTGG - Intergenic