ID: 900412624

View in Genome Browser
Species Human (GRCh38)
Location 1:2519814-2519836
Sequence GGCCGACTTCCCGAAGCTGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 94}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900412623_900412624 -9 Left 900412623 1:2519800-2519822 CCTTGGTCGGCGGTGGCCGACTT 0: 1
1: 0
2: 0
3: 2
4: 20
Right 900412624 1:2519814-2519836 GGCCGACTTCCCGAAGCTGCTGG 0: 1
1: 0
2: 0
3: 2
4: 94
900412614_900412624 24 Left 900412614 1:2519767-2519789 CCTGCTCTCTGGCGGCAGAGGCC 0: 1
1: 0
2: 5
3: 26
4: 390
Right 900412624 1:2519814-2519836 GGCCGACTTCCCGAAGCTGCTGG 0: 1
1: 0
2: 0
3: 2
4: 94
900412612_900412624 28 Left 900412612 1:2519763-2519785 CCATCCTGCTCTCTGGCGGCAGA 0: 1
1: 0
2: 1
3: 21
4: 236
Right 900412624 1:2519814-2519836 GGCCGACTTCCCGAAGCTGCTGG 0: 1
1: 0
2: 0
3: 2
4: 94
900412620_900412624 3 Left 900412620 1:2519788-2519810 CCGGGGTGAGCACCTTGGTCGGC 0: 1
1: 0
2: 0
3: 8
4: 60
Right 900412624 1:2519814-2519836 GGCCGACTTCCCGAAGCTGCTGG 0: 1
1: 0
2: 0
3: 2
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900412624 Original CRISPR GGCCGACTTCCCGAAGCTGC TGG Exonic
900412624 1:2519814-2519836 GGCCGACTTCCCGAAGCTGCTGG + Exonic
901853194 1:12029073-12029095 GGCCTTCTTCTCCAAGCTGCAGG + Exonic
904006256 1:27364781-27364803 GGCCGACCTCCCTGACCTGCAGG - Exonic
907520164 1:55018596-55018618 CCCCGGCTTCCCGAGGCTGCAGG - Intergenic
912431157 1:109629136-109629158 GGCCAACTTCCAGGAGATGCTGG + Exonic
912793404 1:112674933-112674955 GGCCCGCCTCCCGGAGCTGCCGG - Exonic
922822309 1:228493085-228493107 GACCGACTACAAGAAGCTGCGGG + Exonic
1063167020 10:3472562-3472584 GGAGGACTTCCCGAACCTGCCGG - Intergenic
1065188693 10:23192303-23192325 GGCGGACTTCCTGGAGCTGAGGG - Intergenic
1080452733 11:32392126-32392148 GGCTGACTTCCGGCAGCTGGAGG + Intronic
1085053074 11:73389613-73389635 GGCCAGCTGCCCGGAGCTGCAGG + Intronic
1089983227 11:122789658-122789680 GTCTGATTTCCCGAAGCAGCTGG + Intronic
1091384995 12:88057-88079 AGCTGGCTTCCCGAAGCAGCAGG + Intronic
1091679011 12:2512848-2512870 GGGAGATTTCCAGAAGCTGCGGG + Exonic
1093583272 12:20807656-20807678 GGCGCACTTTCCGCAGCTGCTGG + Intergenic
1101592759 12:106138756-106138778 GGCCGCCTCCCTGATGCTGCGGG - Exonic
1101772003 12:107760742-107760764 AGCCCCCTTCCCGAAGCTTCTGG - Exonic
1103322191 12:120098749-120098771 GGCCGCCTTCTCCATGCTGCTGG - Intronic
1104428298 12:128696010-128696032 GGCAGACTTCATGAAGCTGGAGG + Exonic
1104893582 12:132151505-132151527 GGCCGCCTTCGCCAAGCGGCTGG + Exonic
1116730857 14:48620773-48620795 AACCTACTTCCTGAAGCTGCAGG + Intergenic
1122463217 14:101913029-101913051 GCCGGACGTCCCGGAGCTGCCGG + Intronic
1123507961 15:20964346-20964368 GCCCTTCTTCCCCAAGCTGCCGG - Intergenic
1123565179 15:21538088-21538110 GCCCTTCTTCCCCAAGCTGCCGG - Intergenic
1123601442 15:21975375-21975397 GCCCTTCTTCCCCAAGCTGCCGG - Intergenic
1125599918 15:40909871-40909893 GGGGGACTTCCTGAAGCTCCCGG - Intergenic
1129153259 15:73702454-73702476 GGCCCTCTTCCCGGACCTGCTGG + Exonic
1129153574 15:73703858-73703880 GGCCCTCTTCCCGGACCTGCTGG + Exonic
1202973550 15_KI270727v1_random:265194-265216 GCCCTTCTTCCCCAAGCTGCCGG - Intergenic
1136129540 16:28211450-28211472 GGGGGACTTCCCGAGTCTGCCGG - Exonic
1142354571 16:89596516-89596538 GGCCGAGGTCCCGAAGCAGGTGG + Exonic
1145296221 17:21594192-21594214 GGCCGCCATCCCTGAGCTGCAGG - Intergenic
1147978086 17:44259318-44259340 CGCCGACTTCCTGGAGCAGCCGG - Exonic
1151582424 17:74987933-74987955 GCCCGAGTTCCCGACGCTGGAGG + Exonic
1151780171 17:76240331-76240353 GGCCGACTGCCCGCCGCGGCCGG + Exonic
1160445367 18:78923157-78923179 AGCCGACTTCAGGAAGCAGCGGG + Intergenic
1161104004 19:2434362-2434384 GGCCGAGTACCAGGAGCTGCTGG - Exonic
1161341572 19:3745969-3745991 GGCTGCCCTCCTGAAGCTGCTGG + Intronic
1161636983 19:5395183-5395205 GGCCTGCCTCCCGCAGCTGCTGG - Intergenic
1162415717 19:10535823-10535845 GGGCGACTTGCCCAAGCTGGAGG + Intergenic
1162461766 19:10817840-10817862 GGCCGCCTTCCTGGTGCTGCCGG - Intronic
1163611681 19:18304993-18305015 AGCCAACTTCCAGAAGCTTCCGG - Intergenic
1167756167 19:51415091-51415113 CTCAGACTCCCCGAAGCTGCTGG - Exonic
1168242675 19:55095304-55095326 GACCCCCTCCCCGAAGCTGCCGG - Exonic
929824524 2:45299860-45299882 GGCCAAGGTCCCAAAGCTGCTGG + Intergenic
936118854 2:109724734-109724756 GGCTGGCTTCCTGAAGCTTCTGG - Intergenic
947863426 2:233379214-233379236 GGAAGACTTCCCGAAGGTGGTGG + Intronic
1169075913 20:2759739-2759761 GGCAGGCCTCCCGAGGCTGCGGG - Exonic
1171947369 20:31390300-31390322 GGCAAACCTCCCGAAGCTGCAGG + Intronic
1173515835 20:43665166-43665188 AGCCCCCTTCCAGAAGCTGCTGG - Intergenic
1175722700 20:61296934-61296956 AGCTGACTTCCTGGAGCTGCTGG + Intronic
1175878042 20:62239540-62239562 GGCAGTCATCCCAAAGCTGCCGG - Intronic
1179155528 21:38847764-38847786 GGGCGACTTCCAGAAGCTCAGGG - Intergenic
1181583180 22:23838945-23838967 GGCCGAGTTCCTGCAGGTGCCGG - Exonic
950635103 3:14308653-14308675 GGCTGCCTTCCAGATGCTGCTGG - Intergenic
950790806 3:15470372-15470394 GCACCACTTCCAGAAGCTGCTGG - Intronic
960717957 3:120596278-120596300 GGCGCACTTCCTGAAGCTGAAGG + Intergenic
963085502 3:141431762-141431784 GGCCAACATCGGGAAGCTGCTGG - Intronic
964790577 3:160450297-160450319 TGGCGACTTCCCGGAGCAGCGGG - Intronic
966448989 3:180036723-180036745 GGCCGAGTACCCGGAGCTCCAGG - Exonic
968964992 4:3765369-3765391 GGCCCACTTCCCAGCGCTGCTGG - Intergenic
982282944 4:153704623-153704645 GGCGGACATCCTGAACCTGCTGG - Exonic
984932177 4:184857794-184857816 GGCCTAGTTTCTGAAGCTGCAGG + Intergenic
985587917 5:750541-750563 GGCCCATTTCCCGAGGATGCTGG + Intronic
985602586 5:843008-843030 GGCCCATTTCCCGAGGATGCTGG + Intronic
986794655 5:11197640-11197662 GGCCGACACCCAGAAGCTGTTGG + Intronic
988503052 5:31799356-31799378 GGCGGCCATCCAGAAGCTGCAGG + Exonic
997261171 5:132466573-132466595 AGCCGGCTTCCCAAGGCTGCAGG + Intronic
998040286 5:138947152-138947174 GGGCTACTTCCAGGAGCTGCTGG - Exonic
1000051264 5:157564784-157564806 GTCCGACTTCACACAGCTGCAGG - Intronic
1001567329 5:172707988-172708010 GGGCGAAATCCAGAAGCTGCTGG + Intergenic
1003117192 6:3290866-3290888 GGGAGACTTCCCGAAGCGGAGGG + Intronic
1003614981 6:7646871-7646893 GGCCTACTTCTCAAAGATGCTGG + Intergenic
1006770320 6:36547480-36547502 GCGCGACTTCCCGGAGCGGCCGG + Intergenic
1022103659 7:27183702-27183724 AGGGGGCTTCCCGAAGCTGCGGG + Intronic
1023485404 7:40681265-40681287 GCCCCACTTCCCCAAGCTTCAGG + Intronic
1023830953 7:44038816-44038838 GGGCGTCTTCGCGAAGCTGAGGG + Intergenic
1026730377 7:72906373-72906395 GCCTGAGTTCCCGAAGCAGCTGG - Intronic
1027113596 7:75460743-75460765 GCCTGAGTTCCCGAAGCAGCTGG + Intronic
1027285846 7:76645338-76645360 GCCTGAGTTCCCGAAGCAGCTGG + Intergenic
1029463009 7:100706977-100706999 GGCCCGCTGCCAGAAGCTGCTGG + Exonic
1029741287 7:102493125-102493147 GGGCGTCTTCGCGAAGCTGAGGG + Exonic
1029759277 7:102592294-102592316 GGGCGTCTTCGCGAAGCTGAGGG + Exonic
1029776646 7:102688204-102688226 GGGCGTCTTCGCGAAGCTGAGGG + Intergenic
1034256956 7:149729931-149729953 AGCAGACTTTCCAAAGCTGCTGG + Intronic
1039870764 8:41543331-41543353 GGCTGACTTGGCAAAGCTGCTGG - Exonic
1043428508 8:80171721-80171743 GGCCGACTTCCAGCCGGTGCGGG - Intronic
1044260597 8:90115366-90115388 GGAAGACTTTCTGAAGCTGCTGG - Intergenic
1048300990 8:133251146-133251168 GGCCGACTTCCCCAAGGCTCTGG - Intronic
1049031808 8:140043734-140043756 GCCCAGCTTCCTGAAGCTGCTGG + Intronic
1050105058 9:2156870-2156892 GGCCGTCTTCCCTCAGCCGCTGG + Intronic
1057964428 9:99489257-99489279 GGCTGAGTTCCAGAAGCTTCTGG - Intergenic
1060968375 9:127724162-127724184 GGAGGACTTCCTGAAGGTGCTGG + Exonic
1062393045 9:136341581-136341603 GGCCGACTTCCTGAGGTGGCTGG + Intronic
1185529093 X:802994-803016 GGAGGACTTCCCAGAGCTGCTGG + Intergenic
1189309660 X:40010440-40010462 GGCATACTTTCCTAAGCTGCTGG + Intergenic
1200079710 X:153570167-153570189 GGCCGCCTTCCCGGGGCTGGAGG + Intronic