ID: 900412672

View in Genome Browser
Species Human (GRCh38)
Location 1:2520026-2520048
Sequence CCGCGCGTGCCTCCTGCCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 67
Summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 64}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900412672_900412683 8 Left 900412672 1:2520026-2520048 CCCATGGCAGGAGGCACGCGCGG 0: 1
1: 0
2: 1
3: 1
4: 64
Right 900412683 1:2520057-2520079 TAAATGGGCCCTCATCGCGTGGG 0: 1
1: 0
2: 0
3: 1
4: 17
900412672_900412680 -8 Left 900412672 1:2520026-2520048 CCCATGGCAGGAGGCACGCGCGG 0: 1
1: 0
2: 1
3: 1
4: 64
Right 900412680 1:2520041-2520063 ACGCGCGGGCAGGGGGTAAATGG 0: 1
1: 0
2: 0
3: 2
4: 39
900412672_900412688 23 Left 900412672 1:2520026-2520048 CCCATGGCAGGAGGCACGCGCGG 0: 1
1: 0
2: 1
3: 1
4: 64
Right 900412688 1:2520072-2520094 CGCGTGGGACCAAAGGCAGGAGG 0: 1
1: 0
2: 0
3: 4
4: 125
900412672_900412682 7 Left 900412672 1:2520026-2520048 CCCATGGCAGGAGGCACGCGCGG 0: 1
1: 0
2: 1
3: 1
4: 64
Right 900412682 1:2520056-2520078 GTAAATGGGCCCTCATCGCGTGG 0: 1
1: 0
2: 0
3: 1
4: 18
900412672_900412687 20 Left 900412672 1:2520026-2520048 CCCATGGCAGGAGGCACGCGCGG 0: 1
1: 0
2: 1
3: 1
4: 64
Right 900412687 1:2520069-2520091 CATCGCGTGGGACCAAAGGCAGG 0: 1
1: 0
2: 1
3: 2
4: 37
900412672_900412689 26 Left 900412672 1:2520026-2520048 CCCATGGCAGGAGGCACGCGCGG 0: 1
1: 0
2: 1
3: 1
4: 64
Right 900412689 1:2520075-2520097 GTGGGACCAAAGGCAGGAGGCGG 0: 1
1: 0
2: 3
3: 57
4: 449
900412672_900412681 -7 Left 900412672 1:2520026-2520048 CCCATGGCAGGAGGCACGCGCGG 0: 1
1: 0
2: 1
3: 1
4: 64
Right 900412681 1:2520042-2520064 CGCGCGGGCAGGGGGTAAATGGG 0: 1
1: 0
2: 0
3: 4
4: 44
900412672_900412685 16 Left 900412672 1:2520026-2520048 CCCATGGCAGGAGGCACGCGCGG 0: 1
1: 0
2: 1
3: 1
4: 64
Right 900412685 1:2520065-2520087 CCCTCATCGCGTGGGACCAAAGG 0: 1
1: 0
2: 1
3: 0
4: 25

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900412672 Original CRISPR CCGCGCGTGCCTCCTGCCAT GGG (reversed) Intronic
900412672 1:2520026-2520048 CCGCGCGTGCCTCCTGCCATGGG - Intronic
919972949 1:202592383-202592405 CCACCCCTGCCTCCTCCCATCGG - Exonic
1067838288 10:49655140-49655162 CCACGCGTCCCTCCTGGAATCGG - Exonic
1069907229 10:71738985-71739007 CAGCAAGCGCCTCCTGCCATGGG - Intronic
1071435091 10:85641533-85641555 CCACTCGTGCCTCTTCCCATGGG - Intronic
1071875343 10:89837831-89837853 CCGCGCGTACCTTGTCCCATCGG + Intergenic
1072122964 10:92420191-92420213 CCGCGCGTACCTGGTCCCATCGG - Intergenic
1075643715 10:124084175-124084197 CAGCGCGTGGCCCCTGCCCTTGG - Intronic
1076916879 10:133427394-133427416 CCAAGGGTGGCTCCTGCCATCGG + Intergenic
1076936980 10:133572194-133572216 CCGAGGGTGGCTCCTGACATCGG + Intergenic
1077040399 11:518667-518689 TCGTGCGTGCCTCCTCCCCTGGG - Intergenic
1091555058 12:1566798-1566820 CCCCTCGTGCCTCCTGCAGTGGG + Exonic
1103700394 12:122846173-122846195 CAGCCCCTGCCTCCTGCCCTGGG + Intronic
1104838682 12:131809221-131809243 CGACGCGTCCCTCCTGCCCTGGG - Intergenic
1114764114 14:25350890-25350912 CCTCTCGTTCCTCCTGCCCTTGG + Intergenic
1118475462 14:66112142-66112164 CCCAGCGTGACTCCCGCCATTGG + Intergenic
1119542580 14:75450475-75450497 CCACCCGTGCCCCCAGCCATGGG + Intronic
1129686536 15:77689276-77689298 CCCCCGGTGCCTCCTACCATAGG - Intronic
1131184990 15:90266251-90266273 CCACGCATGGCTTCTGCCATTGG + Intronic
1131830527 15:96352111-96352133 CCGCGCCTGGCCCCTGCCCTGGG + Intergenic
1132356414 15:101174402-101174424 CCACATGTGCCTCCTGCCAAAGG - Intergenic
1132534518 16:471453-471475 CAGCTCGTGCCTCCTGCCTCCGG + Intronic
1133546605 16:6813761-6813783 CTGCAGGTGCCTGCTGCCATTGG - Intronic
1136316183 16:29455742-29455764 CCGCACGTGCCTCTGGCCTTCGG + Exonic
1136430760 16:30195084-30195106 CCGCACGTGCCTCTGGCCTTCGG + Exonic
1144675577 17:17159315-17159337 GCTCGCGCCCCTCCTGCCATCGG - Intronic
1147418953 17:40312509-40312531 CTGCACGTCCCTCCTGCCAGGGG - Intronic
1149846972 17:60014001-60014023 CCTCCCGTGGCTCCTACCATGGG + Intergenic
1155021887 18:21904021-21904043 CGGGGCCTGCCTCCTGCCTTTGG + Intergenic
1158540708 18:58351457-58351479 CAGAGCGGGCATCCTGCCATAGG - Intronic
1161400319 19:4064413-4064435 CCGCGAGGGCCACCCGCCATGGG - Intronic
1162426855 19:10602386-10602408 CCCCGCGCGCCTCCTCCAATGGG - Intergenic
1164936800 19:32221058-32221080 CCTGGCTTGCCTTCTGCCATGGG - Intergenic
1165055671 19:33174806-33174828 CAGCTCATGTCTCCTGCCATGGG - Intronic
1168495012 19:56840540-56840562 CCCCGCGCGCCTCCTGCCCGCGG - Intronic
927146577 2:20170067-20170089 CTGTGCCTGCCCCCTGCCATCGG - Intergenic
927868125 2:26606027-26606049 CCGCGCCTCCCCCCTGCCCTTGG - Intronic
928180005 2:29062294-29062316 CAGGGCGAGGCTCCTGCCATAGG - Exonic
928262286 2:29778811-29778833 CCCCCCGTGCGTCCTGCCACGGG + Intronic
936160984 2:110084199-110084221 CTGCACGTGCCTTCTGTCATTGG - Exonic
936183679 2:110287155-110287177 CTGCACGTGCCTTCTGTCATTGG + Intergenic
937119364 2:119431444-119431466 CTGCGCCTGCCTCCTCCCTTCGG + Intronic
942346254 2:175005440-175005462 CCGCGCGCGCCCGTTGCCATGGG - Intergenic
944653944 2:201859080-201859102 CTGCGCGGGCCTCCTGCAGTGGG + Intronic
946683271 2:222240118-222240140 CCCCGAGTGCCTGCTGCCCTGGG + Intronic
1182107217 22:27698155-27698177 AGGCGCCTGCCTCCTGCCCTCGG + Intergenic
1182485592 22:30636751-30636773 CAGCGAGTGCCGCCTGGCATGGG - Exonic
1185351668 22:50342927-50342949 CCGGGCCTCCCTCCTGCCACAGG - Intergenic
956467667 3:69535641-69535663 CCGCCCCTGCCTCCGGCCCTAGG + Intronic
965077894 3:164002566-164002588 CCGTGCATGGCTTCTGCCATTGG - Intergenic
968911171 4:3477670-3477692 CCGCACGTGCCTCCTGCAGCTGG - Intronic
997505287 5:134412037-134412059 CAGCCCGTGGCTCCTGCCCTGGG + Intergenic
998193160 5:140043559-140043581 CAGGGCGTGCCCCCTGCCTTTGG + Intergenic
999462910 5:151772166-151772188 CCGCGCGCGCCTGCGGCCGTTGG - Intronic
1000721943 5:164719040-164719062 CTGCTTGTGCCTCCTCCCATTGG + Intergenic
1006434629 6:34019841-34019863 CCAGGCGTCCCTCCTGCCATGGG + Intronic
1019726564 7:2606102-2606124 CAGCGCCTGCCGCCTGCCAGCGG + Intronic
1027409574 7:77900999-77901021 TCCCGCTTGCCTTCTGCCATGGG - Intronic
1035372662 7:158389162-158389184 CCGCACCTGCCTCCTGCCGAGGG - Intronic
1037975061 8:23203354-23203376 CAGCCCATGCCACCTGCCATGGG + Intronic
1041109396 8:54470485-54470507 CCGCGCGCGCCGCCCGCCAAGGG - Intergenic
1049796283 8:144498644-144498666 TCTGGTGTGCCTCCTGCCATCGG + Intronic
1062276616 9:135734302-135734324 CCGTGCCTGGCTCCAGCCATGGG + Intronic
1062572473 9:137191952-137191974 GCTAGGGTGCCTCCTGCCATCGG - Exonic
1189001953 X:36957541-36957563 CCGCGCGAGCCTCGGGCCCTGGG + Intergenic
1194782106 X:98036349-98036371 CAGCACTTGTCTCCTGCCATTGG + Intergenic
1194810273 X:98380342-98380364 CCGCGCGTGCCTGCAGCCATTGG + Intergenic