ID: 900412680

View in Genome Browser
Species Human (GRCh38)
Location 1:2520041-2520063
Sequence ACGCGCGGGCAGGGGGTAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 42
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 39}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900412667_900412680 5 Left 900412667 1:2520013-2520035 CCCAGAAACCAAGCCCATGGCAG 0: 1
1: 0
2: 3
3: 59
4: 542
Right 900412680 1:2520041-2520063 ACGCGCGGGCAGGGGGTAAATGG 0: 1
1: 0
2: 0
3: 2
4: 39
900412672_900412680 -8 Left 900412672 1:2520026-2520048 CCCATGGCAGGAGGCACGCGCGG 0: 1
1: 0
2: 1
3: 1
4: 64
Right 900412680 1:2520041-2520063 ACGCGCGGGCAGGGGGTAAATGG 0: 1
1: 0
2: 0
3: 2
4: 39
900412663_900412680 13 Left 900412663 1:2520005-2520027 CCCACGACCCCAGAAACCAAGCC 0: 1
1: 0
2: 1
3: 14
4: 137
Right 900412680 1:2520041-2520063 ACGCGCGGGCAGGGGGTAAATGG 0: 1
1: 0
2: 0
3: 2
4: 39
900412674_900412680 -9 Left 900412674 1:2520027-2520049 CCATGGCAGGAGGCACGCGCGGG 0: 1
1: 0
2: 1
3: 3
4: 131
Right 900412680 1:2520041-2520063 ACGCGCGGGCAGGGGGTAAATGG 0: 1
1: 0
2: 0
3: 2
4: 39
900412671_900412680 -3 Left 900412671 1:2520021-2520043 CCAAGCCCATGGCAGGAGGCACG 0: 1
1: 0
2: 3
3: 20
4: 239
Right 900412680 1:2520041-2520063 ACGCGCGGGCAGGGGGTAAATGG 0: 1
1: 0
2: 0
3: 2
4: 39
900412664_900412680 12 Left 900412664 1:2520006-2520028 CCACGACCCCAGAAACCAAGCCC 0: 1
1: 0
2: 0
3: 16
4: 222
Right 900412680 1:2520041-2520063 ACGCGCGGGCAGGGGGTAAATGG 0: 1
1: 0
2: 0
3: 2
4: 39
900412662_900412680 14 Left 900412662 1:2520004-2520026 CCCCACGACCCCAGAAACCAAGC 0: 1
1: 0
2: 0
3: 10
4: 130
Right 900412680 1:2520041-2520063 ACGCGCGGGCAGGGGGTAAATGG 0: 1
1: 0
2: 0
3: 2
4: 39
900412668_900412680 4 Left 900412668 1:2520014-2520036 CCAGAAACCAAGCCCATGGCAGG 0: 1
1: 0
2: 3
3: 15
4: 245
Right 900412680 1:2520041-2520063 ACGCGCGGGCAGGGGGTAAATGG 0: 1
1: 0
2: 0
3: 2
4: 39
900412666_900412680 6 Left 900412666 1:2520012-2520034 CCCCAGAAACCAAGCCCATGGCA 0: 1
1: 0
2: 2
3: 45
4: 509
Right 900412680 1:2520041-2520063 ACGCGCGGGCAGGGGGTAAATGG 0: 1
1: 0
2: 0
3: 2
4: 39

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900412680 Original CRISPR ACGCGCGGGCAGGGGGTAAA TGG Intronic
900412680 1:2520041-2520063 ACGCGCGGGCAGGGGGTAAATGG + Intronic
901875906 1:12167054-12167076 GCGCGAGGGCAGGGGGCAACCGG + Exonic
906452746 1:45965790-45965812 AGGTGAGGGCAGGGGGTATATGG - Intronic
1063975189 10:11409343-11409365 AGGCTCTGGCAGGGGGTTAAAGG - Intergenic
1089740920 11:120582457-120582479 ACTCGAGGGCAGGGGGTGAGAGG - Intronic
1106120722 13:26858133-26858155 ACATGCAGGCAGGGGGTAGAGGG + Intergenic
1108682335 13:52790775-52790797 AGGCAGGGGCAGGGGGAAAAGGG - Intergenic
1130655109 15:85786921-85786943 AGGGGCGGGCAGGGATTAAAGGG + Intronic
1132847374 16:2006721-2006743 ACGTGGGGGCAGGGGGGAGATGG + Intronic
1134998960 16:18760459-18760481 ACGGGCGGTCAGGGGTGAAAGGG - Intergenic
1139451101 16:67028910-67028932 GCGGGCGAGCAGGGGGAAAAGGG + Intergenic
1148492702 17:48033537-48033559 GAGCGTGGGCAGGAGGTAAACGG - Intronic
1151354084 17:73548374-73548396 ACTCGGGGGCAGGGGGGATAGGG - Intronic
1152111924 17:78361233-78361255 ACTGGCGGGGAGGGGGTAGAGGG + Intergenic
925429225 2:3776560-3776582 ACGAGCGGCCAGAGGGAAAAGGG - Intronic
928130275 2:28643981-28644003 AAGCCCAGGGAGGGGGTAAAGGG + Intergenic
930021565 2:47004871-47004893 ACACGCAGGCTGGGGGCAAAAGG - Intronic
948876240 2:240830980-240831002 ACCCGTGGGCACGGGCTAAATGG + Intergenic
1172448799 20:35007496-35007518 ACGCGTGGGCTGGGGGGAGACGG + Intronic
1172793048 20:37519505-37519527 ACGGGTGGGCAGGGAGGAAAGGG - Intronic
1174997729 20:55589747-55589769 ACAAGAGGGCAGGGTGTAAAAGG - Intergenic
1175843028 20:62042433-62042455 CCGAGAGGGCAGGGGGAAAAAGG + Intronic
1182586098 22:31345092-31345114 CGGCGCGGGCAGGGGGTACCAGG + Exonic
1184790081 22:46694885-46694907 AGGCCCCTGCAGGGGGTAAAGGG + Intronic
957885802 3:86286252-86286274 AAGTGTGGGTAGGGGGTAAAGGG - Intergenic
961868879 3:129974444-129974466 ACACGCGTGTAGGGGGCAAAGGG - Exonic
965152058 3:164990162-164990184 GTGGGCGAGCAGGGGGTAAATGG + Intronic
968051476 3:195657961-195657983 ACGCCCGGGCAGGGGTCTAATGG - Intergenic
995142458 5:108749041-108749063 ACGCGGGGGGAGGGGGGAAGAGG + Intronic
1000423722 5:161066260-161066282 ATGTGCGGGCAGAGGGTAAATGG - Intergenic
1001557559 5:172646945-172646967 AGGCGGGGGCCGGGGGTAAGAGG + Intronic
1005633280 6:27729288-27729310 GTGCGGGGGCAGGGGGTATATGG - Intergenic
1006375321 6:33668640-33668662 AAGTGCGGGCAGGGGGCACAGGG - Intronic
1020221168 7:6238783-6238805 ACGTGGGGGCAGGGAGTATATGG + Intronic
1026187263 7:68091598-68091620 ACGGGAGGTCAGGAGGTAAAAGG + Intergenic
1041063828 8:54061778-54061800 TCTGGGGGGCAGGGGGTAAAAGG + Intronic
1049212266 8:141392215-141392237 ACGCGCGGGCAGGGGGAAGGCGG - Intronic
1052765468 9:32635662-32635684 AGGCGGGGGGAGGGGGCAAAGGG + Exonic
1056645473 9:88408254-88408276 AGGTGGGGGGAGGGGGTAAAGGG - Intronic
1187416857 X:19100912-19100934 CCTCGCGGGCAAAGGGTAAAAGG + Intronic
1188849311 X:35112245-35112267 ATGTGAGGGCAGGGAGTAAATGG - Intergenic
1198255595 X:134921680-134921702 ATGTGGGGGCAGGGGCTAAATGG + Intergenic