ID: 900412681

View in Genome Browser
Species Human (GRCh38)
Location 1:2520042-2520064
Sequence CGCGCGGGCAGGGGGTAAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 49
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 44}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900412662_900412681 15 Left 900412662 1:2520004-2520026 CCCCACGACCCCAGAAACCAAGC 0: 1
1: 0
2: 0
3: 10
4: 130
Right 900412681 1:2520042-2520064 CGCGCGGGCAGGGGGTAAATGGG 0: 1
1: 0
2: 0
3: 4
4: 44
900412672_900412681 -7 Left 900412672 1:2520026-2520048 CCCATGGCAGGAGGCACGCGCGG 0: 1
1: 0
2: 1
3: 1
4: 64
Right 900412681 1:2520042-2520064 CGCGCGGGCAGGGGGTAAATGGG 0: 1
1: 0
2: 0
3: 4
4: 44
900412663_900412681 14 Left 900412663 1:2520005-2520027 CCCACGACCCCAGAAACCAAGCC 0: 1
1: 0
2: 1
3: 14
4: 137
Right 900412681 1:2520042-2520064 CGCGCGGGCAGGGGGTAAATGGG 0: 1
1: 0
2: 0
3: 4
4: 44
900412674_900412681 -8 Left 900412674 1:2520027-2520049 CCATGGCAGGAGGCACGCGCGGG 0: 1
1: 0
2: 1
3: 3
4: 131
Right 900412681 1:2520042-2520064 CGCGCGGGCAGGGGGTAAATGGG 0: 1
1: 0
2: 0
3: 4
4: 44
900412664_900412681 13 Left 900412664 1:2520006-2520028 CCACGACCCCAGAAACCAAGCCC 0: 1
1: 0
2: 0
3: 16
4: 222
Right 900412681 1:2520042-2520064 CGCGCGGGCAGGGGGTAAATGGG 0: 1
1: 0
2: 0
3: 4
4: 44
900412671_900412681 -2 Left 900412671 1:2520021-2520043 CCAAGCCCATGGCAGGAGGCACG 0: 1
1: 0
2: 3
3: 20
4: 239
Right 900412681 1:2520042-2520064 CGCGCGGGCAGGGGGTAAATGGG 0: 1
1: 0
2: 0
3: 4
4: 44
900412667_900412681 6 Left 900412667 1:2520013-2520035 CCCAGAAACCAAGCCCATGGCAG 0: 1
1: 0
2: 3
3: 59
4: 542
Right 900412681 1:2520042-2520064 CGCGCGGGCAGGGGGTAAATGGG 0: 1
1: 0
2: 0
3: 4
4: 44
900412668_900412681 5 Left 900412668 1:2520014-2520036 CCAGAAACCAAGCCCATGGCAGG 0: 1
1: 0
2: 3
3: 15
4: 245
Right 900412681 1:2520042-2520064 CGCGCGGGCAGGGGGTAAATGGG 0: 1
1: 0
2: 0
3: 4
4: 44
900412666_900412681 7 Left 900412666 1:2520012-2520034 CCCCAGAAACCAAGCCCATGGCA 0: 1
1: 0
2: 2
3: 45
4: 509
Right 900412681 1:2520042-2520064 CGCGCGGGCAGGGGGTAAATGGG 0: 1
1: 0
2: 0
3: 4
4: 44

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900412681 Original CRISPR CGCGCGGGCAGGGGGTAAAT GGG Intronic
900412681 1:2520042-2520064 CGCGCGGGCAGGGGGTAAATGGG + Intronic
901288052 1:8098051-8098073 TGCGTGGGCAGGGAGTATATGGG - Intergenic
902794731 1:18793711-18793733 CGTGAGGGTCGGGGGTAAATAGG - Intergenic
905288488 1:36904060-36904082 TGTGTGGGCAGGGGGTATATGGG + Intronic
908272933 1:62437587-62437609 GGTGCGGGCTGGGCGTAAATAGG + Intronic
1063035849 10:2286094-2286116 TGCAGGGGCAGGGGTTAAATGGG - Intergenic
1073214523 10:101829266-101829288 GGGGCGGGGAGGGGGTGAATGGG - Intronic
1107027182 13:35814243-35814265 CGCGCGTGCAGGCTTTAAATGGG - Intronic
1122360201 14:101154995-101155017 TGTGGGGGCAGGGGGTATATGGG - Intergenic
1128830464 15:70763588-70763610 CGCCAGGGCAGCGGGTCAATTGG - Exonic
1133957381 16:10456590-10456612 GGCACCGGCAGGGGCTAAATGGG - Intronic
1134121484 16:11587282-11587304 GGCGCGGGGAGGGGGGAAAGTGG - Intronic
1148492701 17:48033536-48033558 AGCGTGGGCAGGAGGTAAACGGG - Intronic
1152245700 17:79183547-79183569 CGCCCGGGCAGGGGGAACACCGG - Intronic
1154325437 18:13387545-13387567 CGCGCGGGCGGGCGGTACCTGGG - Exonic
1159454930 18:68649160-68649182 GGCGAAGGCAGGGGGTATATGGG + Intergenic
1168315591 19:55483473-55483495 CCCGCGGGCAGTGGGGAAAGCGG + Exonic
926662037 2:15477893-15477915 CTCGCGGGTTGGGGGTAATTAGG - Intronic
929996836 2:46832203-46832225 TGTGAGGGCAGGGGGTATATGGG + Intronic
931838013 2:66120031-66120053 CGGGAGGGCAGGGGGTATATAGG - Intergenic
933696409 2:85221989-85222011 GGCGTGGGCAGGGTGGAAATAGG + Intronic
935853633 2:107249994-107250016 TGTGAGGGCAGGGGGTACATGGG - Intergenic
940110856 2:150151908-150151930 GGCGGGGGCAAGGGGTATATGGG + Intergenic
947872761 2:233448900-233448922 CGCCCTGGCAGGTGGGAAATTGG - Intronic
1171869324 20:30513187-30513209 AGCGCGGGCAGGGAGTGATTGGG - Intergenic
1172100568 20:32482565-32482587 GGCGCGCGCAGGGGTTAAGTTGG - Intronic
1180833768 22:18919672-18919694 CGCTCGGGCAGAGGGTACCTGGG - Intronic
1203283854 22_KI270734v1_random:144970-144992 CGCTCGGGCAGAGGGTACCTGGG - Intergenic
958608474 3:96391906-96391928 CATGAGGGCAGTGGGTAAATGGG - Intergenic
965152059 3:164990163-164990185 TGGGCGAGCAGGGGGTAAATGGG + Intronic
967087595 3:186108905-186108927 TGCGGGGGCAGGGGGGAGATCGG - Intronic
967510422 3:190304667-190304689 AGGGCAGGCTGGGGGTAAATGGG + Intergenic
968051475 3:195657960-195657982 CGCCCGGGCAGGGGTCTAATGGG - Intergenic
982125610 4:152181634-152181656 TGTGGGGGCAGGGGGTATATGGG - Intergenic
988822709 5:34903377-34903399 TGTGCAGGTAGGGGGTAAATGGG - Intergenic
996781032 5:127186749-127186771 AGCCCGGGCAGGGTGTGAATGGG + Intergenic
1000423721 5:161066259-161066281 TGTGCGGGCAGAGGGTAAATGGG - Intergenic
1004319598 6:14622034-14622056 CGGGGGGGCAGATGGTAAATTGG + Intergenic
1005633279 6:27729287-27729309 TGCGGGGGCAGGGGGTATATGGG - Intergenic
1020221169 7:6238784-6238806 CGTGGGGGCAGGGAGTATATGGG + Intronic
1024539962 7:50468139-50468161 CTCGCGGGCAGGGGGTGGCTGGG + Intronic
1030596876 7:111550544-111550566 TGTGAGGGCAGGGAGTAAATGGG + Intronic
1032391139 7:131556197-131556219 CGGCCGGGCAGGGGGCACATGGG + Intronic
1035285543 7:157804181-157804203 CGCGGGGGCATTGGGTAAACAGG - Intronic
1051160608 9:14203579-14203601 CGCGCGGGCAGGATCTAAAATGG + Intronic
1056844894 9:90029127-90029149 TGTGGGGGCAGAGGGTAAATGGG + Intergenic
1188849310 X:35112244-35112266 TGTGAGGGCAGGGAGTAAATGGG - Intergenic
1192125761 X:68499293-68499315 CACGAGGGCAGGGGGCAAAGCGG - Intronic
1198255596 X:134921681-134921703 TGTGGGGGCAGGGGCTAAATGGG + Intergenic