ID: 900412682

View in Genome Browser
Species Human (GRCh38)
Location 1:2520056-2520078
Sequence GTAAATGGGCCCTCATCGCG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 20
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 18}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900412664_900412682 27 Left 900412664 1:2520006-2520028 CCACGACCCCAGAAACCAAGCCC 0: 1
1: 0
2: 0
3: 16
4: 222
Right 900412682 1:2520056-2520078 GTAAATGGGCCCTCATCGCGTGG 0: 1
1: 0
2: 0
3: 1
4: 18
900412666_900412682 21 Left 900412666 1:2520012-2520034 CCCCAGAAACCAAGCCCATGGCA 0: 1
1: 0
2: 2
3: 45
4: 509
Right 900412682 1:2520056-2520078 GTAAATGGGCCCTCATCGCGTGG 0: 1
1: 0
2: 0
3: 1
4: 18
900412674_900412682 6 Left 900412674 1:2520027-2520049 CCATGGCAGGAGGCACGCGCGGG 0: 1
1: 0
2: 1
3: 3
4: 131
Right 900412682 1:2520056-2520078 GTAAATGGGCCCTCATCGCGTGG 0: 1
1: 0
2: 0
3: 1
4: 18
900412662_900412682 29 Left 900412662 1:2520004-2520026 CCCCACGACCCCAGAAACCAAGC 0: 1
1: 0
2: 0
3: 10
4: 130
Right 900412682 1:2520056-2520078 GTAAATGGGCCCTCATCGCGTGG 0: 1
1: 0
2: 0
3: 1
4: 18
900412663_900412682 28 Left 900412663 1:2520005-2520027 CCCACGACCCCAGAAACCAAGCC 0: 1
1: 0
2: 1
3: 14
4: 137
Right 900412682 1:2520056-2520078 GTAAATGGGCCCTCATCGCGTGG 0: 1
1: 0
2: 0
3: 1
4: 18
900412668_900412682 19 Left 900412668 1:2520014-2520036 CCAGAAACCAAGCCCATGGCAGG 0: 1
1: 0
2: 3
3: 15
4: 245
Right 900412682 1:2520056-2520078 GTAAATGGGCCCTCATCGCGTGG 0: 1
1: 0
2: 0
3: 1
4: 18
900412671_900412682 12 Left 900412671 1:2520021-2520043 CCAAGCCCATGGCAGGAGGCACG 0: 1
1: 0
2: 3
3: 20
4: 239
Right 900412682 1:2520056-2520078 GTAAATGGGCCCTCATCGCGTGG 0: 1
1: 0
2: 0
3: 1
4: 18
900412667_900412682 20 Left 900412667 1:2520013-2520035 CCCAGAAACCAAGCCCATGGCAG 0: 1
1: 0
2: 3
3: 59
4: 542
Right 900412682 1:2520056-2520078 GTAAATGGGCCCTCATCGCGTGG 0: 1
1: 0
2: 0
3: 1
4: 18
900412672_900412682 7 Left 900412672 1:2520026-2520048 CCCATGGCAGGAGGCACGCGCGG 0: 1
1: 0
2: 1
3: 1
4: 64
Right 900412682 1:2520056-2520078 GTAAATGGGCCCTCATCGCGTGG 0: 1
1: 0
2: 0
3: 1
4: 18

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900412682 Original CRISPR GTAAATGGGCCCTCATCGCG TGG Intronic
900412682 1:2520056-2520078 GTAAATGGGCCCTCATCGCGTGG + Intronic
901867190 1:12114528-12114550 GCAAATGGGACCTCTCCGCGAGG - Intronic
918144709 1:181745378-181745400 GTAAATGGGATCTCAGCCCGTGG + Intronic
920303044 1:205001215-205001237 GTAAATGGGCCAACATCACCTGG + Exonic
1096985918 12:55757388-55757410 GTACATGCTCCCTCATTGCGAGG + Exonic
1102749591 12:115280832-115280854 GAAAATGAGCCCTCATGGCTGGG + Intergenic
1113004146 13:105679439-105679461 GGCATTGGGCCCTCATCCCGTGG + Intergenic
1122273003 14:100576711-100576733 GCAAATGGGACCTCATCCAGGGG - Intronic
1142129369 16:88425766-88425788 GGAAAGGGGCCCTCCTCCCGGGG + Intergenic
1155525046 18:26707405-26707427 ATACATGGACCCTCATCGGGTGG - Intergenic
1158119546 18:54033423-54033445 TTAACTGGGCCCTGATCCCGGGG + Intergenic
1165848978 19:38838086-38838108 GAAATTGGGCCCTCATCACTGGG + Intronic
1165922654 19:39308355-39308377 AGAAATGGGCCCTCAGCGGGCGG + Exonic
940026377 2:149212748-149212770 GTAAATGGGCGCTCATCCTGTGG - Intronic
948999198 2:241602730-241602752 GTAAACGGGCCCTCATGGTCAGG + Intronic
975262521 4:72320244-72320266 GTAAATGGTCCTTCATATCGTGG + Intronic
1002617308 5:180463955-180463977 AGAAATGGACCCTCATCGTGGGG + Intergenic
1005073857 6:21888178-21888200 GCTAATGGGCCCTCATCACTAGG - Intergenic
1028100854 7:86818856-86818878 GGAAATTGGCCCACATCGTGTGG - Intronic
1042526500 8:69770152-69770174 CTAAATGGTGCCTCATCGGGTGG + Intronic